A virus lysis preservation solution

Abstract

The invention provides a virus lysis preservation solution, which belongs to the field of biotechnology. The virus lysis preservation solution of the invention has the functions of both lysis and preservation of viral nucleic acid, can effectively amplify viral nucleic acid after being preserved at -20 to 37°C for 1 to 4 weeks, and is suitable for various samples.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a virus lysis preservation solution. Background Art

[0002] Rapid and accurate screening is one of the most effective ways to control the spread of the virus. RT-qPCR, as the "gold standard" for virus detection, is currently the most widely used method for virus nucleic acid screening. However, the establishment of RT-qPCR reactions requires front-end nucleic acid extraction and purification steps. Although nucleic acid extraction has evolved from traditional liquid extraction to today's magnetic bead extraction, and from previous manual extraction to today's automated extraction, the nucleic acid extraction step is the main rate-limiting step for rapid screening today, due to the many operating processes and large instrument footprint.

[0003] Various types of sample lysis solutions provide a faster, more convenient and lower-cost detection solution for virus detection. The use of sample lysis solutions to lyse nucleic acids does not require a complicated nucleic acid extraction process, and does not require supporting extraction reagents and equipment. However, due to the differences in the environment required for nucleic acid stability and lysis efficiency, sample lysis solutions are often difficult to be compatible with both storage and nucleic acid lysis functions. For example, CN109486903A provides an elution lysis solution for eluting and lysing cells on a swab to release nucleic acids, but the use of this lysis solution requires high-temperature treatment of the sample to improve the efficiency of nucleic acid release. CN111334503A discloses an inactivated virus preservation solution that can inactivate pathogenic microorganisms and effectively prevent the degradation of nucleic acids, effectively solving the problems of virus inactivation and nucleic acid transportation and storage at room temperature. However, this preservation solution does not have a lysis function and requires additional lysis / extraction steps. Summary of the invention

[0004] The present invention aims to address the deficiencies of the prior art and provide a virus lysis and preservation solution, which has the functions of both lysis and preservation of viral nucleic acids and is suitable for various samples.

[0005] The first aspect of the present application provides a virus lysis preservation solution, which comprises a buffer component, a chelating agent, an anionic surfactant and a protein denaturing agent.

[0006] In some embodiments, the buffer component is Tris (tris(hydroxymethyl)aminomethane), the chelating agent is EDTA (ethylenediaminetetraacetic acid), the protein denaturing agent is NaOH (sodium hydroxide), and the anionic surfactant is SDS (sodium dodecyl sulfate).

[0007] In some embodiments, the virus lysis storage solution comprises Tris, EDTA, NaOH and SDS.

[0008] In some embodiments, the virus lysis preservation solution further comprises a stabilizer; preferably, the stabilizer includes a non-ionic surfactant and / or an amino acid, the non-ionic surfactant is, for example, one or more of PEG200 (polyethylene glycol 200), PEG2000, PEG400, PEG4000, PEG800 and PEG8000, preferably PEG200, and the amino acid is, for example, a basic amino acid, preferably lysine.

[0009] In some embodiments, the virus lysis storage solution comprises Tris, EDTA, NaOH, SDS, PEG200 and / or lysine.

[0010] In some embodiments, the concentration of Tris in the lysis preservation solution is 1-50mM, preferably 2-30mM, more preferably 5-20mM, including 5mM, 6mM, 7mM, 8mM, 9mM, 10mM, 11mM, 12mM, 13mM, 14mM, 15mM, 15.5mM, 16mM, 16.5mM, 17mM, 17.5mM, 18mM, 18.5mM, 19mM, 19.5mM and 20mM within the range.

[0011] In some embodiments, the concentration of EDTA in the lysis preservation solution is 1-10 mM, preferably 1-5 mM, including 1 mM, 1.25 mM, 1.5 mM, 1.75 mM, 2 mM, 2.2 mM, 2.5 mM, 2.8 mM, 3 mM, 3.5 mM, 4 mM, 4.5 mM and 5 mM within the range.

[0012] In some embodiments, the concentration of NaOH in the lysis preservation solution is 5-20mM, preferably 6-18mM, more preferably 8-15mM, including 8mM, 8.2mM, 8.5mM, 8.8mM, 9mM, 9.2mM, 9.5mM, 9.8mM, 10mM, 10.2mM, 10.5mM, 10.8mM, 11mM, 11.2mM, 11.5mM, 11.8mM, 12mM, 12.5mM, 13mM, 13.5mM, 14mM, 14.5mM and 15mM within the range.

[0013] In some embodiments, the concentration of SDS in the lysis preservation solution is 0.005-0.1 mM, preferably 0.008-0.08 mM, more preferably 0.01-0.05 mM, including 0.01 mM, 0.015 mM, 0.02 mM, 0.025 mM, 0.03 mM, 0.035 mM, 0.04 mM, 0.045 mM and 0.05 mM within the range.

[0014] In some embodiments, the concentration (volume fraction) of PEG200 in the lysis preservation solution is 0.5-20%, preferably 1-15%, more preferably 1-12%, including 1%, 2%, 3%, 4%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5% and 12% within the range.

[0015] In some embodiments, the concentration of lysine in the lysis preservation solution is 0.5-20mM, preferably 1-15mM, more preferably 1-12mM, including 1mM, 2mM, 3mM, 4mM, 5mM, 5.5mM, 6mM, 6.5mM, 7mM, 7.5mM, 8mM, 8.5mM, 9mM, 9.5mM, 10mM, 10.5mM, 11mM, 11.5mM and 12mM within the range.

[0016] In some embodiments, the lysis preservation solution comprises 5-25mM Tris, 1-2mM EDTA, 10-12mM NaOH, 0.01-0.02mM SDS, 1-10% PEG200 and / or 1-10mM lysine; preferably, the lysis preservation solution comprises 5-20mMTris, 1mM EDTA, 10mM NaOH, 0.01mM SDS, 1-10% PEG200 and / or 1-10mM lysine; more preferably, the lysis preservation solution comprises 5-20mMTris, 1mM EDTA, 10mM NaOH, 0.01mM SDS, 1-8% PEG200 and / or 1-8mM lysine; most preferably, the lysis preservation solution comprises 5-15mM Tris, 1mM EDTA, 10mM NaOH, 0.01mM SDS, 1-5% PEG200 and / or 1-5 mM lysine.

[0017] The second aspect of the present application provides a kit, which comprises the virus lysis preservation solution described in the first aspect.

[0018] The third aspect of the present application provides the use of the virus lysis preservation solution described in the first aspect and the kit described in the second aspect in lysing virus samples.

[0019] In some embodiments, the virus sample is a swab sample or a liquid sample, the swab sample is, for example, a throat swab, a nasal swab, or a surface swab, and the liquid sample is, for example, sputum, saliva, serum, plasma, and whole blood.

[0020] In some embodiments, the virus is a DNA virus or an RNA virus; the DNA virus is, for example, smallpox virus, hepatitis B virus, herpes virus, rubella virus, human papillomavirus, etc.; the RNA virus is, for example, monkeypox virus, influenza A virus, new coronavirus (2019-nCoV), HIV, hepatitis C virus, Japanese encephalitis virus, all influenza viruses, rhinovirus, polio virus, coxsackie virus, dengue virus, rotavirus, SARS virus, MERS virus, Ebola virus, Marburg virus, etc.

[0021] The fourth aspect of the present application provides the use of the virus lysis preservation solution described in the first aspect and the kit described in the second aspect in preserving viral nucleic acids.

[0022] In some embodiments, the viral nucleic acid is DNA or RNA.

[0023] In some embodiments, the preservation of viral nucleic acid means that the viral nucleic acid can be effectively amplified by qPCR after being preserved at a certain temperature and time.

[0024] In some embodiments, the temperature for storing viral nucleic acids can be -20°C to 45°C, for example, -20°C to 40°C, for example, -20°C to 37°C; the time for storing viral nucleic acids can be 1d-50d, for example, 1d-40d, for example, 1d-30d, for example, stored at -20°C to 37°C for 1d-30d.

[0025] The fifth aspect of the present application provides a method for using the virus lysis preservation solution described in the first aspect, the method comprising adding a virus sample to the virus lysis preservation solution described in the first aspect, vortexing to mix and letting stand at room temperature, and then centrifuging instantly.

[0026] In some embodiments, the vortex mixing time is, for example, 20-60 s, for example, 30-40 s, for example, 30 s.

[0027] In some embodiments, the standing time is, for example, 5-20 min, for example, 8-15 min, for example, 10 min.

[0028] In some embodiments, the virus sample is a swab sample or a liquid sample, the swab sample is, for example, a throat swab, a nasal swab, or a surface swab, and the liquid sample is, for example, sputum, saliva, serum, plasma, and whole blood.

[0029] In some embodiments, the volume ratio of the liquid sample to the lysis preservation solution is 1:1-1:20, preferably 1:5-1:20, and more preferably 1:10-1:20. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] none DETAILED DESCRIPTION

[0031] The technical scheme of the present invention is further illustrated by specific examples below. However, the following examples are merely examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims. In the following examples, unless otherwise specified, the reagents and consumables used are purchased from ordinary suppliers in the field, and the experimental methods and technical means used are conventional methods and means in the field.

[0032] Example 1

[0033] Use pure water as solvent to prepare the following 4 groups of lysis preservation solutions and store them in sample collection tubes:

[0034] Lysis preservation solution 1: Tris (trishydroxymethylaminomethane) 5mM, EDTA (ethylenediaminetetraacetic acid) 1mM, NaOH (sodium hydroxide) 10mM, SDS (sodium dodecyl sulfate) 0.01mM;

[0035] Lysis preservation solution 2: Tris (trishydroxymethylaminomethane) 10mM, EDTA (ethylenediaminetetraacetic acid) 1mM, NaOH (sodium hydroxide) 10mM, SDS (sodium dodecyl sulfate) 0.01mM, PEG200 (polyethylene glycol 200) 1% (volume fraction), lysine 1mM;

[0036] Lysis preservation solution 3: Tris (trishydroxymethylaminomethane) 15mM, EDTA (ethylenediaminetetraacetic acid) 1mM, NaOH (sodium hydroxide) 10mM, SDS (sodium dodecyl sulfate) 0.01mM, PEG200 (polyethylene glycol 200) 3% (volume fraction); lysine 3mM;

[0037] Lysis preservation solution 4: Tris (trishydroxymethylaminomethane) 15mM, EDTA (ethylenediaminetetraacetic acid) 1mM, NaOH (sodium hydroxide) 10mM, SDS (sodium dodecyl sulfate) 0.01mM, PEG200 (polyethylene glycol 200) 5% (volume fraction), lysine 5mM;

[0038] Lysis storage solution 5: Tris (trishydroxymethylaminomethane) 10mM, EDTA (ethylenediaminetetraacetic acid) 1mM, NaOH (sodium hydroxide) 10mM, SDS (sodium dodecyl sulfate) 0.01mM, lysine 10mM;

[0039] Lysis preservation solution 6: Tris (trishydroxymethylaminomethane) 10 mM, EDTA (ethylenediaminetetraacetic acid) 1 mM, NaOH (sodium hydroxide) 10 mM, SDS (sodium dodecyl sulfate) 0.01 mM, PEG200 (polyethylene glycol 200) 10% (volume fraction).

[0040] Example 2

[0041] Ten pseudo-virus pharyngeal swab samples of COVID-19 1-10 were prepared (mixed from negative samples of real human pharyngeal swabs and pseudo-virus of COVID-19 with the item number GBW(E)091089 purchased from the National Institute of Metrology), each of which was divided into 7 groups. The first group of pharyngeal swab samples was subjected to nucleic acid extraction using Vazyme#RM201-02, and the extraction process was performed according to the instructions of the extraction kit. The other 6 groups of pharyngeal swab samples were respectively placed in 500 μl of the above-mentioned lysis preservation solution 1-6 as experimental groups. At room temperature, the sampling tubes containing the pharyngeal swab samples and the lysis preservation solution were vortexed for 30 seconds, allowed to stand for 10 minutes, and centrifuged instantaneously to obtain the lysis products.

[0042] Take 10 μL of the control group extraction product and 10 μL of the experimental group lysis product as templates, and prepare the fluorescence quantitative qPCR system as shown in Table 1, where the upstream and downstream primers and probe sequences are (5'-3'):

[0043] Forward primer (SEQ ID NO.1): Primer-F: GAAATGGTCATGTGTGGCGG

[0044] Reverse primer (SEQ ID NO.2): Primer-R:

[0045] CTTGACAAATGTTAAAAACACTATTAGCATA

[0046] Probe sequence (SEQ ID NO.3): Probe:

[0047] FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1

[0048] Table 1: Fluorescence quantitative qPCR amplification system

[0049] Components Addition amount <![CDATA[5×OneStepU + Mix a ]]> 4μL Upstream primer (10 μmol / L) 0.4μL Downstream primer (10 μmol / L) 0.4μL Probe (10 μmol / L) 0.2μL <![CDATA[OneStepU + EnzymeMix b ]]> 1μL template 10μL <![CDATA[ddH2O]]> To20μL

[0050] a&b:Vazyme#Q231

[0051] The amplification experiment was performed according to the reaction program in Table 2, and the Ct values ​​of the amplification curves were obtained as shown in Table 3.

[0052] Table 2 Fluorescence quantitative qPCR reaction procedure

[0053]

[0054]

[0055] Table 3

[0056]

[0057] According to the test results, both the control group and the lysis preservation solution 1-6 have effective amplification and can detect positive samples of the new coronavirus, with a consistency rate of 100% and good accuracy. Comparing the Ct values, it can be seen that the sensitivity of the conventional nucleic acid extraction method using the lysis preservation solution 1-6 and the control group in RNA sample amplification detection is equivalent.

[0058] Example 3

[0059] The novel coronavirus pseudovirus throat swab sample 1 (same as sample 1 in Example 1) was lysed and preserved using the lysis preservation solution of the present invention, and the preservation effect of the lysis preservation solution 1-6 on the virus sample was determined. The specific storage conditions were: 37°C for 1, 3, 5, 10, 15, 20 days; 25°C for 1, 3, 5, 10, 15, 20 days; 4°C for 1, 2, 3, 4 weeks; -20°C for 1, 2, 3, 4 weeks. At the same time, the novel coronavirus pseudovirus throat swab sample 1 that was not temperature treated was set as a control.

[0060] 10 μL of the lysate stored at different temperatures and time in the experimental group and the lysate stored at different time in the control group without temperature treatment were respectively taken for fluorescence quantitative PCR amplification. The PCR amplification system and reaction procedure were the same as those in Example 2.

[0061] The Ct value data are shown in Table 4. The test results show that under the conditions of -20℃, 4℃, 25℃, and 37℃, lysis preservation solutions 1-6 all showed good preservation effects on nucleic acid samples, among which lysis preservation solution 4 had the best effect, and could be effectively amplified after being stored at 37℃ for 20 days and -20℃ for 4 weeks.

[0062] Table 4

[0063]

[0064]

[0065] Example 4

[0066] Ten influenza A virus pseudovirus throat swab samples 11-20 (mixed from negative samples of real human throat swabs and influenza A pseudovirus with the catalog number NIM-RM 4054 purchased from the National Institute of Metrology) were prepared, each divided into 6 groups, of which the first group of throat swab samples were subjected to nucleic acid extraction using Vazyme#RM201-02, and the extraction process was performed according to the instructions of the extraction kit. The other 6 groups of throat swab samples were respectively placed in 500 μl of the above-mentioned lysis preservation solution 1-6 as experimental groups. At room temperature, the sampling tube containing the throat swab sample and the lysis preservation solution was vortexed for 30 seconds, allowed to stand for 10 minutes, and centrifuged instantaneously to obtain the lysis product.

[0067] Take 10 μL of the control group extraction product and 10 μL of the experimental group lysis product as templates, and prepare the fluorescent quantitative qPCR system according to Table 1 of Example 2, wherein the upstream and downstream primers and probe sequences are (5'-3'):

[0068] Forward primer (SEQ ID NO.4): Primer-F: TCACCTCTGACTAAGGGRATTT

[0069] Reverse primer (SEQ ID NO.5): Primer-R: TCTACGCTGCAGTCCTCGC

[0070] Probe sequence (SEQ ID NO.6): Probe: VIC-TGTTCACGCTCACCGTGCC-BHQ1 The qPCR amplification reaction procedure was the same as that in Table 2 of Example 2. The Ct value of the amplification curve was shown in Table 5.

[0071] Table 5

[0072]

[0073]

[0074] According to the test results, the control group and lysis preservation solution 1-6 were both effectively amplified and could detect positive samples of influenza A virus throat swabs, with a 100% consistency rate and good accuracy. Comparison of Ct values ​​showed that the sensitivity of the conventional nucleic acid extraction method using lysis preservation solution 1-6 and the control group in RNA sample amplification detection was comparable.

[0075] Example 5

[0076] The influenza A pseudovirus throat swab sample 16 (same as the sample 16 in Example 4) was preserved using the lysis preservation solution of the present invention, and the preservation effect of the lysis preservation solution 1-6 on the influenza A pseudovirus throat swab sample was determined. The specific storage conditions were: 37° C. for 1, 3, 5, 10, 15, and 20 days; 25° C. for 1, 3, 5, 10, 15, and 20 days; 4° C. for 1, 2, 3, and 4 weeks; -20° C. for 1, 2, 3, and 4 weeks. At the same time, the influenza A pseudovirus throat swab sample 16 that was not temperature-treated was set as a control.

[0077] 10 μL of the lysate stored at different temperatures and time and the lysate stored without temperature treatment were taken for fluorescence quantitative PCR amplification. The PCR amplification system and reaction procedure were the same as those in Example 4.

[0078] The Ct value data are shown in Table 6. The test results show that the lysis preservation solution 4 has the best effect and exhibits good preservation effects at -20°C, 4°C, 25°C, and 37°C.

[0079] Table 6

[0080]

[0081]

[0082] Example 6

[0083] Ten monkeypox virus serum samples 21-30 were prepared, each divided into 7 groups, of which 50 μl of the monkeypox virus serum samples in group 1 were used for nucleic acid extraction using Vazyme#RM201-02, and the extraction process was operated according to the instructions of the extraction kit. 50 μl of the other 6 groups of monkeypox virus serum samples were respectively taken and put into 500 μl of the above lysis preservation solution 1-6 as experimental groups. Under room temperature, the sampling tube containing the monkeypox virus serum sample and the lysis preservation solution (a total of 550 μl) was vortexed for 30 seconds, allowed to stand for 10 minutes, and centrifuged instantly to obtain the lysis product.

[0084] Take 10 μL of the control group extraction product and 10 μL of the experimental group lysis product as templates, and prepare the fluorescent quantitative qPCR amplification system according to Table 1 of Example 2, wherein the upstream and downstream primers and probe sequences are (5'-3'):

[0085] Forward primer (SEQ ID NO.7): Primer-F: CGATCTAACGAAGAATTTGATCCA Reverse primer (SEQ ID NO.8): Primer-R: TCGAGAGTTTGCTCAGATCTGTCT Probe sequence (SEQ ID NO.9): Probe: VIC-TGGATGATGGTCCCGAC-MGB

[0086] The qPCR amplification reaction procedure was the same as that in Table 2 of Example 2, and the Ct values ​​of the amplification curves were shown in Table 7.

[0087] Table 7

[0088]

[0089] According to the test results, the control group and lysis preservation solution 1-6 were both effectively amplified and could detect positive samples of monkeypox virus serum samples, with a consistency rate of 100% and good accuracy. Comparison of Ct values ​​showed that the sensitivity of the conventional nucleic acid extraction method using lysis preservation solution 1-6 and the control group in DNA sample amplification detection was equivalent.

[0090] Example 7

[0091] The monkeypox virus serum sample 25 (same as the sample 25 in Example 6) was preserved by using the lysis preservation solution 1-6 of the present invention, and the preservation effect of the lysis preservation solution 1-6 on the monkeypox virus serum sample was determined. The specific storage conditions were: 37° C. for 1, 3, 5, 10, 15, and 20 days; 25° C. for 1, 3, 5, 10, 15, and 20 days; 4° C. for 1, 2, 3, and 4 weeks; and -20° C. for 1, 2, 3, and 4 weeks. At the same time, the monkeypox virus serum sample 25 that was not subjected to temperature treatment was set as a control.

[0092] 10 μL of the lysate stored at different temperatures and time in the experimental group and the lysate stored at different time in the control group without temperature treatment were respectively taken for fluorescence quantitative PCR amplification. The PCR amplification system and reaction procedure were the same as those in Example 6.

[0093] The Ct value data are shown in Table 8. The test results show that the lysis preservation solution 4 has the best effect and exhibits good preservation effects at -20°C, 4°C, 25°C, and 37°C.

[0094] Table 8

[0095]

[0096]

Claims

1. A virus lysis preservation solution, comprising 5-15 mM Tris, 1-2 mM EDTA, 10-12 mM NaOH, 0.01-0.02 mM SDS, 1-10% PEG200 and 1-10 mM lysine. 2 . The lysis preservation solution according to claim 1 , comprising 10 mM Tris, 1 mM EDTA, 10 mM NaOH, 0.01 mM SDS, 1% PEG200 and 1 mM lysine. 3 . The lysis preservation solution according to claim 1 , comprising 15 mM Tris, 1 mM EDTA, 10 mM NaOH, 0.01 mM SDS, 3% PEG200 and 3 mM lysine. The lysis preservation solution according to claim 1 , comprising 15 mM Tris, 1 mM EDTA, 10 mM NaOH, 0.01 mM SDS, 5% PEG200 and 5 mM lysine.

5. A kit comprising the virus lysis preservation solution according to any one of claims 1 to 4.

6. Use of the virus lysis preservation solution according to any one of claims 1 to 4 and the kit according to claim 5 in lysing virus samples.

7. The use according to claim 6, wherein the virus sample is a swab sample or a liquid sample.

8. The use according to claim 7, wherein the swab sample is a throat swab, a nasal swab or a surface swab, and the liquid sample is sputum, saliva, serum, plasma or whole blood.

9. Use of the virus lysis preservation solution according to any one of claims 1 to 4 and the kit according to claim 5 in preserving viral nucleic acids.

10. A method for using the virus lysis preservation solution according to any one of claims 1 to 4, comprising adding a virus sample to the virus lysis preservation solution according to any one of claims 1 to 4, vortexing and mixing at room temperature and letting stand, followed by instant centrifugation.

11. The method according to claim 10, wherein the vortex mixing time is 30 seconds and the standing time is 10 minutes.

12. The method according to claim 10, wherein the virus sample is a swab sample or a liquid sample.

13. The method according to claim 12, wherein the swab sample is a throat swab, a nasal swab or a surface swab, and the liquid sample is sputum, saliva, serum, plasma or whole blood.

14. The method according to claim 12, wherein the volume ratio of the liquid sample to the lysis preservation solution is 1:1-1:

20.

15. The method according to claim 12, wherein the volume ratio of the liquid sample to the lysis preservation solution is 1:5-1:

20.

16. The method according to claim 12, wherein the volume ratio of the liquid sample to the lysis preservation solution is 1:10-1:20.

Images