Agarase, agarase gene, and preparation method and application

By screening α-agarase genes from *Rhodophyta agariculata* and expressing them in *Escherichia coli*, the problem of high production costs of agarase was solved, achieving efficient and stable production of agar oligosaccharides and broadening their application in food, pharmaceuticals, and cosmetics.

CN116515798BActive Publication Date: 2025-12-16CHENGDU UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310136464.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-20
Publication Date
2025-12-16
Estimated Expiration
2043-02-20

AI Technical Summary

Technical Problem

Existing agarase strains are unstable and have low enzyme yields, resulting in high production costs and hindering commercial application. Furthermore, the insufficiency of stability and enzyme activity of β-agarase limits the industrial preparation and application of agarotetraose and agarohexaose.

Method used

The α-agarase gene was screened from *E. coli*, a red algae that can hydrolyze agar, and a recombinant plasmid was constructed and expressed in *E. coli* to obtain a highly efficient recombinant strain *E. coli* BL21-pET28a(+)-AgaB. Enzymatic hydrolysis conditions were optimized to generate agar oligosaccharides with a degree of polymerization of 3-6.

Benefits of technology

This technology enables efficient and stable production of agar oligosaccharides, improves the catalytic activity and thermal stability of agarase, and expands its application in the industrial production of food, pharmaceuticals, and cosmetics, demonstrating high economic value and promising industrial application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116515798B_ABST
    Figure CN116515798B_ABST
Patent Text Reader

Abstract

The application discloses a agarase, an agarase gene, and a preparation method and application, and recombines alpha-agarase gene of agar-decomposing bacterium of Rhodophyta in E.coli engineering bacteria, obtains recombinant E.coli engineering bacteria E.coli BL21-pET28a(+)‑AgaB which can efficiently express the gene, has higher economic value and industrial application prospect, widens resources for mining and application of new enzymes, and the enzyme is a secreted intracellular protein of GH96 family.In addition, by comparing the gene sequence of the enzyme, it is found that the highest similarity of the amino acid sequence of the enzyme with the reported alpha-agarase is only 54.15%.Through enzymatic property research, the optimal reaction temperature is 40 DEG C; the optimal reaction pH is 7; metal ions Ca2+ and Ba2+ promote the activity.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of bioengineering technology, and particularly relates to a agarase derived from Agarilytica rhodophyticola MCCC 1H00123, and further relates to the acquisition and recombinant expression of the enzyme, and further relates to the specific application of the recombinant bacteria in the production of agar oligosaccharide, and the application of the agar oligosaccharide in food, medicine and cosmetics. BACKGROUND

[0002] Agar is a kind of marine polysaccharide with economic value extracted from Gelidium and other red algae. Agar oligosaccharide with a degree of polymerization of 2-20 is generated after hydrolysis of agar, and has the advantages of good water solubility, high bioavailability, etc., and can be widely applied in the fields of food, medicine and cosmetics.

[0003] Agar oligosaccharide has many unique medical and health care functions, and can be used as a raw material for functional food, medicine and cosmetics. The main performances are as follows: 1) Agar oligosaccharide has an antioxidant effect, which can directly or through improving the activity of antioxidant enzymes to scavenge active oxygen free radicals, and can also inhibit oxidation by chelating metal ions necessary for free radicals. Therefore, it can be applied to health care food with functions such as anti-fatigue. 2) Agar oligosaccharide can inhibit the production of nitric oxide in macrophages and monocytes, the content of prostaglandin E2 and the increase of pro-inflammatory reaction cell activity, and has the functions of anti-tumor and improving immunity. It can be used in the production of anti-tumor, anti-inflammatory and anti-virus medicines. 3) Studies have found that agar oligosaccharide has good moisturizing and whitening effects, can inhibit the activity of tyrosinase in melanoma cells, and has no toxicity to cells. Therefore, it can be used as a high-quality raw material for cosmetics. 4) Agar oligosaccharide has certain antibacterial activity and can inhibit bacterial growth. Agar oligosaccharide can be used as a good natural preservative in food, and can also reduce the heat of food. 5) In vivo and in vitro experiments have proved that new agar oligosaccharide is resistant to the action of digestive enzymes, can improve the structure of intestinal flora, promote the growth of bifidobacterium and lactobacillus in the intestine, and inhibit the growth of pathogenic bacteria. The antibacterial effect of agar oligosaccharide with high degree of polymerization is better than that of agar oligosaccharide with low degree of polymerization. Therefore, agar oligosaccharide can be used as a raw material for developing new probiotic preparations.

[0004] In recent years, the development scale of agar in China is small, and the products are mostly agar and agar powder for export as raw materials for chemical industry and medicine, with low added value and easy to pollute the environment. In order to reasonably utilize agar resources and produce high value-added products such as agar oligosaccharide, it is of great significance to prevent resource waste, increase economic benefits and protect the environment. At present, agar oligosaccharide is mainly prepared by acid hydrolysis and enzymatic hydrolysis. The acid hydrolysis method has high efficiency and large yield, but it produces a large amount of by-products, and has problems such as difficulty in separation and purification of agar oligosaccharide and safety hazard. The agarase enzymatic hydrolysis method has the advantages of high catalytic efficiency, strong substrate specificity and mild reaction conditions, and is the preferred method for degrading agar polysaccharide. However, most of the research on the enzymatic degradation of agar polysaccharide is still in the laboratory stage. The main problem is that most of the agarase-producing strains are from the ocean, and the enzyme production characteristics of the strains are unstable and the enzyme production amount is low, which makes the production cost of agarase high and the price expensive, and it is difficult to realize commercial application. Therefore, finding a kind of agarase gene with high hydrolysis activity and stable characteristics, and realizing heterologous expression has become the most economical and efficient method for producing agarase.

[0005] Agarases are divided into alpha-agarase and beta-agarase. Alpha-agarase hydrolyzes alpha-1,3 glycosidic bond to generate agar oligosaccharide, and beta-agarase hydrolyzes beta-1,4 glycosidic bond to generate neo-agar oligosaccharide. Research reports that agarotetraose and agarohexaose have better antioxidant performance than other agar oligosaccharides. However, most of the agarases found at present are beta-agarases, and only the performance of four alpha-agarases has been explored and reported. Therefore, the stability, enzyme activity and product specificity of the agarases need to be improved, and the industrialized production and application of agarotetraose and agarohexaose are seriously limited.

[0006] Therefore, it is the development direction of the agar oligosaccharide industry in the future and the problem to be solved at present to reasonably develop a new alpha-agarase gene screened from nature, to study the characteristics of the new enzyme and to apply it to actual production, and to solve the serious environmental problems caused by chemical production. SUMMARY

[0007] In view of the drawbacks of the existing production technology of agar oligosaccharide, a kind of agarase gene derived from agarolytic bacterium living on red algae is provided, and a kind of recombinant plasmid containing the gene is also provided. In addition, an E. coli engineering bacterium containing the gene and a method for obtaining the same are also provided.

[0008] More specifically, the first aspect of the present application provides an agarase, the amino acid sequence of which is shown in SEQ ID NO: 1.

[0009] In particular, the agarase is an alpha-agarase derived from Agarilytica rhodophyticola MCCC 1H00123, which has the highest similarity of 54.15% with the reported agarase amino acid sequence (derived from Agarilytica rhodophyticola, accession number WP_020208740.1).

[0010] Further, the CMB2 domain contained in the agarase is a domain not found in other agarases.

[0011] For those skilled in the art, the alpha-agarase (E.C.3.2.1.158) is a glycosyl hydrolase mainly derived from bacteria and fungi, which acts on alpha-1,3 glycosidic bonds in an endo manner to generate a series of agar oligosaccharides with 3-6-endo-α-L-galactose as the reducing sugar end and β-D-galactose as the non-reducing end. According to the difference in amino acid sequence, the agarase can be divided into five glycosyl hydrolase families, which are GH-16, GH-50, GH-86, GH-96 and GH-118.

[0012] The agarase of the present application belongs to the GH-96 family.

[0013] The agarase of the present application has high catalytic activity, and has good thermal stability and pH stability. The enzyme has high enzyme activity for degrading agarose in the range of 35-50℃ and pH 6.0-8.0, the optimal reaction temperature is 40℃, the optimal reaction pH is 7.0, Ba 2+ , Ca 2+ have a certain promoting effect on its activity, Mg 2+ , Ni 2+ , Co 2+ have a certain inhibitory effect on its activity, and has high economic value and industrial application prospect.

[0014] It should be noted that those skilled in the art can understand that, as a result of the degeneracy of the genetic code, many different polynucleotides can encode the same polypeptide. In addition, it should be understood that those skilled in the art can use conventional techniques to make nucleotide substitutions, which will not affect the polypeptide sequence encoded by the polynucleotides used in the present application. In addition, the polynucleotides can be modified using known methods in the art to enhance the in vivo activity or survival period of the polynucleotides of the present application.

[0015] More specifically, the second aspect of the present application provides a gene encoding the above-mentioned agarase, and the nucleotide sequence thereof is shown in SEQ ID NO: 2.

[0016] In an implementable manner, the agarase gene is obtained, and the recombinant plasmid and the recombinant engineering bacteria are constructed in the following manner:

[0017] According to the alpha agarase gene sequence from Agarilytica rhodophytiola MCCC1H00123 found from NCBI, the signal peptide is predicted and deleted, the gene sequence of the deleted signal peptide is designed with an upstream primer and a downstream primer by using SnapGene, and is sent to a company for synthesis. The primer sequences are as follows:

[0018] The upstream primer is AATTGTGAATACATCGTCGA.

[0019] The downstream primer is ATGCCCAAGTTCAATAATTC.

[0020] The agarase gene fragment is obtained from the bacteria by amplifying the target gene sequence with the agarase genomic DNA as a template, and the nucleotide sequence is shown as SEQ ID NO: 2.

[0021] More specifically, the third aspect of the present application provides a recombinant plasmid comprising the agarase gene described above.

[0022] In an implementable manner, the recombinant expression plasmid is constructed by double enzyme digestion of the target gene fragment and the plasmid pET28a(+) with EcoR I and Hind III endonucleases, 20 DEG C water bath for 1 h, 65 DEG C water bath for 10 min, 0.8% agarose gel electrophoresis and gel recovery, to obtain the target gene with sticky ends and the expression vector pET28a(+), 16 DEG C overnight connection.

[0023] More specifically, the fourth aspect of the present application provides a recombinant bacteria comprising the recombinant plasmid described above.

[0024] Preferably, the recombinant bacteria is a recombinant Escherichia coli engineering bacteria.

[0025] More specifically, the fifth aspect of the present application provides a vector comprising the agarase gene or gene cluster described above.

[0026] It is worth noting that: in the present application, various vectors known in the art can be selected, such as plasmids, cosmids, bacteriophages and retroviruses, etc.

[0027] In an implementable manner, the recombinant expression vector can be introduced into the host cell by methods well known in the art, including: calcium chloride heat shock method, electroporation method, PEG-mediated method, gene gun method, etc.

[0028] More specifically, the sixth aspect of the present application provides a host cell comprising the vector described above.

[0029] More specifically, the seventh aspect of the present application provides a preparation method of agarase, comprising the steps of culturing the recombinant bacteria as described above in a nutrient medium and collecting the polypeptide with agarase activity.

[0030] As a preferred implementation, the nutrient medium is 10 g / L of tryptone, 5 g / L of yeast extract powder and 10 g / L of sodium chloride.

[0031] More specifically, the eighth aspect of the present application provides the use of the agarase in the preparation of agarooligosaccharide.

[0032] As a preferred implementation, the agarooligosaccharide is obtained by directly reacting the agarase with a substrate of 0.1-3% agarose solution at an addition amount of 0.8 U / mL agarooligosaccharide for 4-8 h.

[0033] Further, the reaction temperature is 35-45℃ and the reaction pH is 6.0-8.0.

[0034] Preferably, the reaction temperature is 40℃ and the reaction pH is 7.0.

[0035] The polymerization degree of the agarooligosaccharide is 3-9.

[0036] Preferably, the polymerization degree of the agarooligosaccharide is mainly distributed in the range of 3-5.

[0037] The agarooligosaccharide is prepared by hydrolyzing colloidal agarose by the agarase, wherein the concentration of the colloidal agarose is not limited to a certain concentration, and the concentration range is 0.1%-3%. The polymerization degree of the agarooligosaccharide prepared by the enzymatic catalysis reaction is 3-9, and the main polymerization degree range is 3-6. The polymerization degree range of the product is relatively more concentrated and stable.

[0038] More specifically, the eighth aspect of the present application provides the use of the agarooligosaccharide in the preparation of antibacterial drugs.

[0039] In summary, the present application has the following beneficial effects:

[0040] 1. The agarase gene in the agarolytic bacterium of Rhodophyta is obtained by PCR, and is recombined in the E. coli engineering bacteria to obtain the recombinant E. coli engineering bacteria E. coli BL21-pET28a(+)-AgaB capable of efficiently expressing the gene, which widens the resources for mining and application of new enzymes.

[0041] 2. The agarase mined by the present application has an amino acid sequence as shown in SEQ ID NO:1, and the highest similarity with the amino acid sequence of the reported agarase is 54.15%.

[0042] 3.The application provides a recombinant E.coli BL21-pET28a(+)-AgaB containing an agarase gene, which can efficiently express agarase, wherein the agarase belongs to the 96th family of glycoside hydrolase, has high catalytic activity, and has good thermal stability and pH stability, and the optimal action temperature of the agarase is 40℃, the optimal reaction pH is 7.0, Ca2+ and Ba2+ can promote the activity of the agarase, Mg2+, Ni2+ and Co2+ can inhibit the activity of the agarase, and the agarase has high economic value and industrial application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0043] Figure 1 is the optimal action temperature of the agarase isolated from Agarilytica rhodophytiola MCCC1H00123 according to the application;

[0044] Figure 2 is the optimal action pH of the agarase isolated from Agarilytica rhodophytiola MCCC1H00123 according to the application;

[0045] Figure 3 is a hydrolysis product thin layer chromatogram;

[0046] Figure 4 is an agarose gel electrophoresis: M: 10K DNA maker; 1: genomic DNA;

[0047] Figure 5 is the inhibitory effect of agarooligosaccharide on MRSA.

[0048] Figure 6 is a structural formula of agarase. DETAILED DESCRIPTION

[0049] The technical solutions in the embodiments of the application will be described clearly and completely below with reference to the drawings in the embodiments of the application. Obviously, the described embodiments are only part of the embodiments of the application, rather than all the embodiments of the application. Based on the embodiments in the application, all other embodiments obtained by those skilled in the art without creative work fall within the protection scope of the application.

[0050] Embodiment 1: Obtaining of agarase gene and construction of recombinant plasmid

[0051] According to the alpha-agarase gene sequence from Agarilytica rhodophytiola MCCC1H00123 obtained from NCBI, the agarase gene sequence is as follows: Figure 6As shown, the agarase contains a CBM2 domain at N-terminal 22-133 and a GH96 family protein domain at C-terminal, and the signal peptide is predicted and deleted. The gene sequence of the deleted signal peptide is designed for upstream and downstream primers by SnapGene, and is sent to GenScript for synthesis. The primer sequences are as follows:

[0052] Upstream primer: AATTGTGAATACATCGTCGA

[0053] Downstream primer: ATGCCCAAGTTCAATAATTC.

[0054] 1) The agarase genomic DNA was used as a template to amplify the target gene sequence, and the agarase gene fragment was obtained from the bacteria. The total volume of the reaction system was 20 μL, Mix (I-5) 10 μL, plasmid template 1 μL; upstream primer 1 μL, downstream primer 1 μL, ddH2O 7 μL.

[0055] 2) The PCR amplification reaction program was first 95°C pre-denaturation for 300 s, then 95°C denaturation for 40 s, 75-60°C gradient annealing for 40 s, 72°C extension for 110 s, a total of 32 cycles, and finally 72°C extension for 300 s.

[0056] 3) Cut the target band, weigh, and dissolve in the dissolution solution.

[0057] 4) Prepare a clean collection tube, suck in the above liquid, wash, and add non-nuclease water for recovery.

[0058] 5) The recovered target gene was verified by 0.8% agarose gel electrophoresis.

[0059] 6) Measure 30.00 mL of 0.5x TAE in a conical flask, weigh 0.24 g of agarose, and place for a period of time. Add 2.00 μL of GodViewTM nucleic acid dye, mix well, and prepare the gel.

[0060] 7) Add 0.5x TAE solution to the electrophoresis tank, place the gel in the electrophoresis tank, set the sample loading sequence, mix the sample with 10x loading buffer, and then load the samples in order. Connect the power supply, set the voltage to 120 V, and the time to 20 min.

[0061] 8) After electrophoresis, observe the results under UV, and refer to Figure 4 .

[0062] 9) The target gene fragment and plasmid pET28a(+) are double-enzyme cut by EcoR I and Hind III, 20℃ water bath for 1 hour, 65℃ water bath for 10 minutes, 0.8% agarose gel electrophoresis and gel recovery, to obtain the target gene with sticky ends and expression vector pET28a(+), 16℃ overnight connection; wherein, the connection system is:

[0063] 0.5 μL carrier, 0.5 μL PCR recovered fragments, 1 μL CE buffer, 1 μL T4 ligase, 1 μL ddH2O.

[0064] Example 2: Construction of recombinant E. coli engineering bacteria containing the agarase gene

[0065] The ligation product is transferred into E. coli BL21, bacterial colonies are picked, screened and verified, and BL21-pET28a-AgaB is obtained.

[0066] The transformed E. coli BL21-pET28a(+)-AgaB is inoculated into LB containing kanamycin with a final concentration of 100 μg / mL, and cultured overnight at 180 rpm. The bacterial solution is extracted according to the method described in the plasmid extraction box, and is transferred into competent cells.

[0067] The constructed expression system is plated into LB solid medium containing kanamycin with a final concentration of 100 μg / mL, and 20 single monoclonal antibodies are picked in LB medium containing kanamycin with a final concentration of 100 μg / mL, and are cultured overnight at 37℃ on a shaker.

[0068] The cultured bacterial solution is subjected to PCR amplification (amplification conditions are shown in Table 1), and after amplification, each group of products is verified by 0.8% agarose gel electrophoresis. After successful verification, glycerol is used for preservation at -80℃.

[0069] Table 1 PCR amplification conditions

[0070]

[0071] Example 3: Determination of agarase enzyme activity

[0072] (1) High-density induced expression of agarase

[0073] Firstly, the strain was activated on LB plate medium (yeast powder 5 g / L, peptone 10 g / L, sodium chloride 10 g / L, agar powder 15 g / L) and cultured overnight at 37°C, then a single colony was picked and cultured in LB liquid medium (yeast powder 5 g / L, peptone 10 g / L, sodium chloride 10 g / L) for 16 h, and then inoculated into fermentation medium at an inoculation amount of 2%. The fermentation medium was composed of LB liquid medium: yeast powder 5 g / L, peptone 10 g / L, sodium chloride 10 g / L. When the OD600 of the fermentation medium reached 0.8, it was cooled to 20°C, and IPTG was added to a final concentration of 5 mmol / L. After 18 h of enzyme induction at low temperature 4°C, the bacterial cells were collected by centrifugation at 8000 rpm for 5 min. Then the cells were washed with physiological saline for 3 times, and resuspended with buffer (20 mM Tris-HCl, 10 mM CaCl2, pH 7.0) for standby.

[0074] (2) Preparation of crude enzyme solution

[0075] The cells resuspended with buffer (20 mM Tris-HCl, 10 mM CaCl2, pH 7.0) were broken in an ice bath with an ultrasonic disrupter, with a pulse of 3 s and a breaking time of 30 min. Then the bacterial fragments were removed by centrifugation at 12000 rpm for 6 min at 4°C, and the supernatant was collected to prepare the crude enzyme solution.

[0076] (3) Agarase activity determination by DNS method

[0077] A 0.2% agar powder substrate solution was prepared (using the corresponding buffer) and incubated at 40°C for standby; 20 μL of purified Agab was added to each 480 μL of substrate, and after 15 min of reaction at 40°C, 500 uL of DNS was added and boiled in boiling water for 7 min. The number of moles of reducing sugar generated was calculated according to the standard curve of D-galactose. The unit of agarase activity was defined as: the amount of enzyme required to catalyze the production of 1 umol of reducing sugar per minute under the experimental conditions was one unit of enzyme activity (U). The enzyme activity of the agarase under the above optimal conditions was 12.1 U / mL, which was higher than the enzyme activity of the agarase from Altermonas agarlyticus (9.0 U / mL) and the enzyme activity of the agarase from Thalassomonas sp. (0.04 U / mL)

[0078] 2. Micro-broth dilution method

[0079] MRSA standard strain was cultured overnight using MH broth medium, and the overnight culture was diluted 1:100 with MH broth in a sterile clean bench. Chondroitinase was diluted to six concentrations (16, 8, 4, 2, 1, 0.5 mg / mL). According to the micro-broth dilution method of the American Clinical Laboratory Standardization Committee (Clinical and Laboratory Standards Institute CLSI), 100 μL of the diluted bacteria solution was added to a sterile 96-well plate, and 100 μL of the chondroitinase and bacteria suspension was added. The negative control wells contained 100 μL of MH broth and 100 μL of chondroitinase, and the positive control wells contained 100 μL of the diluted bacteria solution mixed with 100 μL of sterile water. After incubation at 37°C for 24 h, the optical density value at OD 600 was measured using an enzyme marker analyzer, and the results were analyzed according to Figure 5 . Each group was repeated at least three times.

[0080] Example 4: Enzymatic properties and biological activity of chondroitinase

[0081] According to the method shown in Figure 1 , the purified enzyme obtained by purifying the crude enzyme solution of Example 3 using a nickel column was measured for enzyme activity at different temperature points (10°C intervals) ranging from 0°C to 60°C. The maximum enzyme activity was taken as 100% to determine the optimal temperature of the enzyme. Meanwhile, the purified enzyme solution was incubated at different temperatures for 120 min, and the residual enzyme activity was measured, with the maximum enzyme activity taken as 100% to determine the temperature stability of the enzyme.

[0082] According to the method shown in Figure 2 , a certain amount of purified enzyme solution was reacted in Glycine-HCl buffer at pH 2.0-5.0, Bis-Tris buffer at pH 5.8-7.0, Tris-HCl buffer at pH 7.5-9.0, and CAPS (3-(cyclohexylamino)-1-propanesulfonic acid) buffer at pH 9.7-11.1 (pH interval 1.0 unit), and the enzyme activity at different pH values was measured, with the maximum enzyme activity taken as 100% to determine the optimal pH of the enzyme.

[0083] Meanwhile, the purified enzyme solution was placed in Glycine-HCl buffer at pH 2.0-5.0, Bis-Tris buffer at pH 5.8-7.0, Tris-HCl buffer at pH 7.5-9.0, and CAPS (3-(cyclohexylamino)-1-propanesulfonic acid) buffer at pH 9.7-11.1 (pH interval 1.0 unit) for 120 min, and the enzyme activity was measured after adjusting the pH to 7.0, with the maximum enzyme activity taken as 100% to determine the pH stability of the enzyme.

[0084] Metal ions Mg2+, Mn2+, Co2+, Ba2+, Ni2+, Fe2+, Cu2+, Li2+, Zn2+, Cr2+, and Fe3+ were selected and added to the reaction mixture to a concentration of 10 mmol / L. After incubation at 4℃ for 1 h, enzyme activity was measured according to the enzyme activity assay method described above. A pure enzyme solution without any added metal ions was used as a control to compare the effects of different metal ions on enzyme activity. The results are shown in Table 2.

[0085] Table 2. Effects of different metal ions on agarase activity

[0086]

[0087]

[0088] The experimental results above show that, using no metal ions as a blank control, Ca... 2+ Ba 2+ The promoting effect on its activity is quite obvious, Mg 2+ Ni 2+ Co 2+ It has a certain inhibitory effect on its activity.

[0089] Example 5: Degree of polymerization analysis of hydrolysis products

[0090] Reference Figure 3 As shown, to study the enzymatic hydrolysis products of recombinant agarase, sufficient Agab was added to a 0.2% agarose solution. Samples were taken at different time points: 0 min, 3 min, 8 min, 10 min, 15 min, 20 min, 30 min, 60 min, 120 min, and 240 min. The supernatant was collected by centrifugation, and the substrate degradation was detected by thin-layer chromatography. The developing solvent was n-butanol, glacial acetic acid, and distilled water (volume ratio 2:1:1), and the colorimetric reagent was aniline-diphenylamine solution.

[0091] The hydrolysis products of the agarase of the present invention have a relatively concentrated degree of polymerization, and can specifically hydrolyze to obtain agar oligosaccharides with a degree of polymerization between 3 and 6.

[0092] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. Use of a gelling enzyme in the preparation of a gelling oligosaccharide, characterized in that, The amino acid sequence of the agarase is shown as SEQ ID NO:

1.

2. Use according to claim 1, characterized in that, The agarase is an alpha-agarase derived from Agarilytica rhodophyticola MCCC 1H00123.

Citation Information

Patent Citations

  • Use of agar-derived oligosaccharides for inhibiting growth of staphylococcus

    US20210369765A1