Application of a SNP molecular marker in identifying clubroot resistance in Chinese cabbage and / or in breeding clubroot-resistant Chinese cabbage
By using the SNP molecular marker A08-12285323 and its detection primer set Crr5-funK2, efficient identification and screening of cabbage clubroot resistance were achieved, solving the problem of low efficiency of disease-resistant breeding in existing technologies and improving the accuracy and efficiency of breeding.
Patent Information
- Application Number
- CN202310760891.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-26
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2043-06-26
AI Technical Summary
Existing technologies make it difficult to efficiently screen out SNP molecular markers related to clubroot resistance in Chinese cabbage, resulting in low efficiency in disease-resistant breeding.
The SNP molecular marker A08-12285323 and its detection primer set Crr5-funK2 were used to accurately identify and screen for clubroot disease resistance in Chinese cabbage through competitive allele-specific PCR amplification and endpoint fluorescence signal reading.
Rapidly and accurately screen out clubroot-resistant individuals in the offspring population of Chinese cabbage at the molecular level, significantly improving the efficiency of disease-resistant breeding and reducing the workload of field selection.
Smart Images

Figure CN116622897B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular marker-assisted breeding, and particularly relates to application of a SNP molecular marker A08-12285323 in identifying Chinese cabbage clubroot resistance and / or breeding of clubroot-resistant Chinese cabbage. Background Art
[0002] Clubroot, also known as "root cancer," is a worldwide soil-borne disease caused by the fungus Plasmodiophora brassicae Woron. It primarily infects Brassicaceae plants, including Chinese cabbage, pakchoy, kale, radish, cauliflower, mustard, and rapeseed. Infection by the fungus causes abnormal root cell proliferation, forming tumors. This impairs the transport of water and nutrients, leading to nutrient deprivation and wilt in the aerial parts of the plant, eventually leading to plant death. Breeding resistant varieties using clubroot-resistance genes is safe, efficient, and economical, and is an important approach to fundamentally addressing the problem of clubroot. By identifying molecular markers closely linked to clubroot-resistance genes and using marker-assisted selection (MAS), the efficiency of breeding for resistance can be greatly improved. Therefore, identifying more SNPs associated with clubroot-resistance genes in cabbage and applying them to the selection of disease-resistant cabbage materials and breeding of disease-resistant varieties is crucial for improving cabbage yield and quality. Summary of the Invention
[0003] The present invention aims to provide a method for identifying clubroot resistance in Chinese cabbage and / or using a SNP molecular marker A08-12285323 in breeding clubroot-resistant Chinese cabbage. The SNP molecular marker A08-12285323 of the present invention can identify clubroot-resistant Chinese cabbage and be used for selecting and breeding clubroot-resistant Chinese cabbage.
[0004] The present invention provides an application of a SNP molecular marker A08-12285323 in identifying clubroot resistance in Chinese cabbage and / or in breeding clubroot-resistant Chinese cabbage. The sequence of the SNP molecular marker A08-12285323 is shown in SEQ ID NO.1. The 70th base from the 5' end of the sequence shown in SEQ ID NO.1 is a SNP site, and the base is T or C.
[0005] The present invention also provides a reagent for detecting the SNP molecular marker A08-12285323 in the application of the above technical solution.
[0006] Preferably, the reagent includes a primer set Crr5-funK2, and the primer set Crr5-funK2 includes Crr5-funK2Fa, Crr5-funK2Fb and Crr5-funK2R; the nucleotide sequence of the Crr5-funK2Fa is shown in SEQ ID NO.2; the nucleotide sequence of the Crr5-funK2Fb is shown in SEQ ID NO.3; and the nucleotide sequence of the Crr5-funK2R is shown in SEQ ID NO.4.
[0007] Preferably, the Crr5-funK2Fa and Crr5-funK2Fb are respectively labeled with fluorescent groups of different colors.
[0008] Preferably, the fluorescent groups include FAM and HEX.
[0009] The present invention also provides a kit for detecting the SNP molecular marker A08-12285323 in the application of the above technical solution, and the kit comprises the reagents and reaction solution described in the above technical solution.
[0010] The present invention also provides the use of the reagent described in the above technical solution or the kit described in the above technical solution in identifying the clubroot resistance of Chinese cabbage and / or breeding clubroot-resistant Chinese cabbage.
[0011] The present invention also provides a method for identifying Chinese cabbage clubroot resistance, comprising the following steps:
[0012] Competitive allele-specific PCR amplification of Chinese cabbage genomic DNA is performed using the reagent described in the above technical solution or the kit described in the above technical solution. Finally, the KASP amplification product is read by endpoint fluorescence signal to obtain a genotyping result. When the genotype is TT or TC, the Chinese cabbage is identified as clubroot-resistant Chinese cabbage; when the genotype is CC, the Chinese cabbage is identified as clubroot-susceptible Chinese cabbage.
[0013] Preferably, the PCR amplification reaction system, based on 8 μL, includes 1.5 μL genomic DNA, 4 μL KASP Mastermix (2×), 0.14 μL primer set Crr5-funK2 and the balance water.
[0014] Preferably, the reaction program of the PCR amplification includes: 94°C for 15 min; 94°C for 20 s, 61°C for 60 s, for a total of 10 cycles, starting from the second cycle, decreasing by 0.6°C each cycle; 94°C for 20 s, 55°C for 60 s, for a total of 26 cycles; 37°C for 1 min.
[0015] The present invention provides an application of a SNP molecular marker A08-12285323 in identifying clubroot resistance in Chinese cabbage and / or in breeding clubroot-resistant Chinese cabbage. The SNP molecular marker A08-12285323 described in the present invention can identify clubroot-resistant Chinese cabbage and is used for screening and breeding of clubroot-resistant Chinese cabbage. Specifically, using a reagent for detecting the SNP molecular marker A08-12285323 for detection, it is possible to differentiate and identify clubroot-resistant and clubroot-susceptible Chinese cabbage materials, and rapidly screen individuals containing the clubroot-resistant gene Crr5 in a Chinese cabbage offspring population at the molecular level, with high accuracy, which can greatly improve the efficiency of disease-resistant breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0017] Figure 1 This is a diagram showing the results of KASP genotyping of the F2 population using the marker Crr5-funK2 provided by the present invention;
[0018] Figure 2 This is a diagram of the KASP genotyping results of a natural population using the marker Crr5-funK2 provided by the present invention. DETAILED DESCRIPTION
[0019] The present invention provides use of a SNP molecular marker A08-12285323 in identifying clubroot resistance in Chinese cabbage and / or in breeding clubroot-resistant Chinese cabbage. The sequence of the SNP molecular marker A08-12285323 is shown in SEQ ID NO. 1 (ACTCAAACCAAACATAACACACAATGATAATCTAACACACATACTGCAAAATGCGAAATGTTTCTTCAGYTTCCATCAACATGAGAGAGCTAAGCTTTCTAAAGGACGTAGCCCGCATTCTTTAATCTCCCCGTTTTTT, Y=T / C). The 70th base from the 5' end of the sequence shown in SEQ ID NO. 1 is a SNP site, and the base is T or C. The SNP molecular marker A08-12285323 of the present invention is a SNP molecular marker for the clubroot resistance-related gene Crr5 in Chinese cabbage. The present invention discloses for the first time a single-nucleotide polymorphism (SNP) molecular marker A08-12285323 associated with the clubroot resistance gene Crr5 in Chinese cabbage. Using a reagent for detecting the SNP molecular marker A08-12285323, it is possible to differentiate between clubroot-resistant and clubroot-susceptible Chinese cabbage materials, allowing for rapid molecular screening of individuals containing the clubroot resistance gene within a Chinese cabbage offspring population with high accuracy, significantly improving the efficiency of disease resistance breeding.
[0020] The present invention also provides a reagent for detecting the SNP molecular marker A08-12285323 in the application of the above technical solution. In the present invention, the primers preferably include KASP (Kompetitive Allele Specific PCR) primers. In the present invention, the reagent preferably includes a primer set Crr5-funK2, wherein the primer set Crr5-funK2 includes Crr5-funK2Fa, Crr5-funK2Fb, and Crr5-funK2R; the nucleotide sequence of Crr5-funK2Fa is shown in SEQ ID NO. 2: 5'- GAAGGTGACCAAGTTCATGCT AAATGCGAAATGTTTCTTCAGT-3'; the nucleotide sequence of Crr5-funK2Fb is shown in SEQ ID NO.3: 5'- GAAGGTCGGAGTCAACGGATTATGCGAAATGTTTCTTCAGC-3'; the nucleotide sequence of the Crr5-funK2R is shown in SEQ ID NO. 4: 5'-CGTCCTTTAGAAAGCTTAGCTCTCTC-3'. In the present invention, the Crr5-funK2Fa and Crr5-funK2Fb are preferably labeled with fluorescent groups of different colors, respectively. In the present invention, the fluorescent groups preferably include FAM and HEX. In the present invention, the Crr5-funK2Fa is linked to FAM, and the Crr5-funK2Fb is linked to HEX. The present invention discloses for the first time a detection primer set Crr5-funK2 for the SNP molecular marker A08-12285323 associated with the clubroot resistance trait of Chinese cabbage. The detection primer set comprises three primers. By performing PCR amplification on DNA of disease-resistant and disease-susceptible Chinese cabbage DH lines and an F2 generation segregating population produced by hybridization of the two, and detecting using the KASP gene analysis system, it was found that Crr5-funK2 can clearly distinguish between clubroot-resistant and clubroot-susceptible materials, and individuals containing the clubroot resistance gene Crr5 in the Chinese cabbage offspring population can be quickly screened at the molecular level.
[0021] The present invention also provides a kit for detecting the SNP molecular marker A08-12285323 in the application of the above technical solution, the kit comprising the reagents and a reaction solution of the above technical solution. In the present invention, the reaction solution preferably comprises KASP Mastermix (2×).
[0022] The present invention also provides the use of the reagent described in the above technical solution or the kit described in the above technical solution in identifying the clubroot resistance of Chinese cabbage and / or breeding clubroot-resistant Chinese cabbage.
[0023] The present invention also provides a method for identifying Chinese cabbage clubroot resistance, comprising the following steps:
[0024] Competitive allele-specific PCR amplification of Chinese cabbage genomic DNA is performed using the reagent described in the above technical solution or the kit described in the above technical solution. Finally, the KASP amplification product is read by endpoint fluorescence signal to obtain a genotyping result. When the genotype is TT or TC, the Chinese cabbage is identified as clubroot-resistant Chinese cabbage; when the genotype is CC, the Chinese cabbage is identified as clubroot-susceptible Chinese cabbage.
[0025] In the present invention, the PCR amplification reaction system, based on 8 μL, preferably includes 1.5 μL of genomic DNA, 2×4 μL of KASP Mastermix, 0.14 μL of the primer set Crr5-funK2, and the remainder of water. In the present invention, the concentration of each primer in the primer set Crr5-funK2 is preferably 100 μmol / L. In the present invention, the volume ratio of Crr5-funK2Fa, Crr5-funK2Fb, Crr5-funK2R, and ddH2O in the primer set Crr5-funK2 is preferably 12:12:30:46. There are no specific limitations on the method for extracting genomic DNA from Chinese cabbage; conventional genomic DNA extraction methods familiar to those skilled in the art can be used. In the present invention, the reaction procedure of the PCR amplification preferably includes: 94°C for 15 min; 94°C for 20 s, 61°C for 60 s, for a total of 10 cycles, starting from the second cycle, decreasing by 0.6°C each cycle; 94°C for 20 s, 55°C for 60 s, for a total of 26 cycles; 37°C for 1 min.
[0026] After obtaining the KASP amplification product, the present invention performs endpoint fluorescence signal reading to obtain a genotyping result: when the genotype is TT or TC, the Chinese cabbage is identified as clubroot-resistant Chinese cabbage; when the genotype is CC, the Chinese cabbage is identified as clubroot-susceptible Chinese cabbage.
[0027] In the present invention, the endpoint fluorescence signal reading is preferably performed using a Roche fluorescent quantitative PCR instrument LightCycler 480 Instrument II (LC480II), and the SNP typing results are analyzed using LC480 software v1.5.1.
[0028] To further illustrate the present invention, the application of a SNP molecular marker A08-12285323 provided by the present invention in identifying clubroot resistance in Chinese cabbage and / or breeding clubroot-resistant Chinese cabbage is described in detail below with reference to the accompanying drawings and examples. However, these should not be construed as limiting the scope of protection of the present invention.
[0029] Example 1
[0030] 1.1 Investigation of test materials and disease resistance traits
[0031] A disease-resistant DH line of Chinese cabbage, EDHR1 (P1), and a susceptible line, EDHS1 (P2), were selected as parents (Yang Shuangjuan et al. Localization of the clubroot resistance gene BraA.Pb.8.4 in Chinese cabbage and development of a KASP marker. Acta Horticulturae Sinica, 2021, 48(7): 1317-1328. The public can obtain this biological material from the applicant for use only in repeating the experiments related to the present invention and cannot be used for other purposes). The two materials were reciprocally crossed to obtain F1 seeds, and the F1 material was self-pollinated to obtain F2 seeds. P1, P2, F1 and F2 were inoculated and identified at the seedling stage. The fungus source was Henan Xinye Xinji XY-2, which was identified as physiological race 4 according to the Williams identification system and ECD21 / 31 / 31 according to the ECD identification system (Yuan Yuxiang, Zhao Yanyan, Wei Xiaochun, et al. 2017. Identification of physiological races of Chinese cabbage clubroot in Henan Province. Henan Agricultural Science, 46(7): 71-76). Six weeks after inoculation, the disease level of each plant was investigated. The disease level was divided into 0, 1, 3, 5 and 7. The specific investigation method was referred to Zhao Yanyan, et al. (Zhao Yanyan, Jiang Wusheng, Yuan Yuxiang, et al. Comparison of indoor artificial inoculation methods and conditions for Chinese cabbage clubroot and identification of resistance of different varieties. Acta Horticulturae Sinica, 2014, 41(S1): 2675).
[0032] Disease resistance identification results showed that all 10 plants from the resistant parent, 1EDHR1(P1), had a disease grade of 0, while all 10 plants from 1EDHS1(P2) had a disease grade of 7. All 10 F1 plants had a disease grade of 0 (Table 1). In the F2 population, 159 plants had a disease grade of 0, 156 had a disease grade of 1, 9 had a disease grade of 3, 15 had a disease grade of 5, and 96 had a disease grade of 7. Disease grades 0 and 1 were classified as resistant, while grades 3, 5, and 7 were classified as susceptible. In the F2 population, there were 315 resistant plants and 120 susceptible plants, with a chi-square test showing a segregation ratio of 3:1 (Table 1). This indicates that the clubroot resistance gene carried by 1EDHR1(P1) is controlled by a pair of dominant nuclear genes, with resistance being dominant over susceptibility.
[0033] Table 1 Segregation of disease-resistant and disease-susceptible plants in Chinese cabbage parents and their offspring
[0034]
[0035] 1.2 Genomic DNA extraction
[0036] The modified CTAB method was used to extract genomic DNA from the two parents, F1, and F2 strains. The specific steps are as follows.
[0037] Fresh leaves were placed in 2.0 mL Eppendorf centrifuge tubes. One steel ball (5 mm in diameter) was placed in each tube. 1000 μL of 2% CTAB extraction buffer was then added. The leaves were disrupted in a tissue disruptor (model: Retsch MM400, Germany) at a frequency of 30 times / second for 1 min. Incubate at 65°C for 1 hour, add 500 μL of 24:1 chloroform / isoamyl alcohol extract after cooling, shake up and down 30 times, let stand to separate, centrifuge (12000 r / min) for 10 minutes, aspirate 400 μL of supernatant into a new 1.5 mL centrifuge tube, then add 400 uL of isopropanol to precipitate DNA, mix up and down, centrifuge (12000 r / min) for 5 minutes, discard the supernatant, and then add 750 μL of 70% ethanol to wash the DNA precipitate, centrifuge (12000 r / min) for 2 minutes, discard the supernatant, dry the DNA at room temperature, add 100 μL of ddH2O to dissolve the DNA, and place in a -20°C refrigerator for use.
[0038] 1.3 Discovery of the clubroot gene Crr5-linked SNP marker and development of its detection primer set Crr5-funK2
[0039] The candidate gene of the cabbage clubroot resistance gene Crr5 was identified by gene mapping. The candidate gene was sequenced and aligned, and a SNP variation T / C was found at the 12285323bp position on chromosome A08 (Brapa_Chiifu_V3.0 reference gene). As shown in the following paragraph, at the 70bp position, the base in the disease-resistant material is T, and the base in the susceptible material is C. This variation is called SNP marker A08-12285323.
[0040] ACTCAAACCAAACATAACACACAATGATAATCTAACACACATACTGCAAAATGCGAAATGTTTCTTCAG[T / C]TTCCATCAACATGAGAGAGCTAAGCTTTCTAAAGGACGTAGCCCGCATTCTTTAATCTCCCCGTTTTTT (SEQ ID NO. 1).
[0041] The KASP marker Crr5-funK2 was designed for this SNP marker A08-12285323, including three primers:
[0042] Crr5-funK2Fa:5'- GAAGGTGACCAAGTTCATGCT AAATGCGAAATGTTTCTTCAGT-3'(SEQ IDNO.2);
[0043] Crr5-funK2Fb:5'- GAAGGTCGGAGTCAACGGATTATGCGAAATGTTTCTTCAGC-3'(SEQ IDNO.3);
[0044] Crr5-funK2R: 5'-CGTCCTTTAGAAAGCTTAGCTCTCTC-3' (SEQ ID NO. 4).
[0045] Crr5-funK2Fa and Crr5-funK2Fb are two allele-specific forward primers. Crr5-funK2Fa is specific for the disease-resistant genotype, and Crr5-funK2Fb is specific for the susceptible genotype. FAM and HEX fluorescent sequence tags (underlined) are added to the 5' end, respectively. Crr5-funK2Fa is linked to FAM, and Crr5-funK2Fb is linked to HEX. Crr5-funK2R is a common reverse primer.
[0046] The KASP-PCR reaction was carried out in a 96-well PCR instrument. The reaction system was 8 μL: 1.5 μL DNA (80 ng / μL), 4 μL KASP Mastermix (2×), 0.14 μL primer mixture (Crr5-funK2Fa, Crr5-funK2Fb, Crr5-funK2R at a concentration of 100 μmol / L and ddH2O at a volume ratio of 12:12:30:46), and the rest was filled with ddH2O.
[0047] The KASP-PCR amplification program was as follows: first stage denaturation at 94°C for 15 min; second stage denaturation at 94°C for 20 s, annealing at 61°C for 60 s, for a total of 10 cycles (starting from the second cycle, the temperature was reduced by 0.6°C each cycle); third stage denaturation at 94°C for 20 s, annealing at 55°C for 60 s, for a total of 26 cycles; fourth stage 37°C for 1 min.
[0048] The KASP-PCR amplification products were analyzed using a Roche LightCycler 480 Instrument II (LC480II) for endpoint fluorescence signal reading. The SNP genotyping results were analyzed using LC480 software v1.5.1: the signal points of the homozygous disease-resistant material were blue, and the primers with the FAM fluorescent tag sequence at the 5' end were competitively amplified and aggregated near the X axis, with a genotype of TT; the signal points of the homozygous disease-susceptible material were green, and the primers with the HEX fluorescent tag sequence at the 5' end were competitively amplified and aggregated near the Y axis, with a genotype of CC; the signal points of the heterozygous disease-resistant material were red, and aggregated near the diagonal, with a genotype of TC ( Figure 1(Figure 3) KASP genotyping results of the F2 population using the marker Crr5-funK2. The Crr5-funK2 marker can significantly distinguish between two homozygous genotypes and can also identify the heterozygous genotype, demonstrating its codominant nature, confirming successful marker development.
[0049] The Crr5-funK2 marker was used to genotype 86 individual plants in the F2 population. The homozygous resistant genotype was recorded as a, the homozygous susceptible genotype was recorded as b, and the heterozygous type was recorded as h. The results showed that there were 18 plants with genotype a, and their disease level was 0; there were 21 plants with genotype h, and their disease level was 0; there were 47 plants with genotype b, and their disease level was 7 ( Figure 1 The genotype and phenotype concordance rate of the marker Crr5-funK2 in 86 F2 plants reached 100%. The Crr5-funK2 marker can be used for molecular-assisted breeding of clubroot-resistant varieties of Chinese cabbage.
[0050] 1.4 Application of SNP marker detection primers
[0051] Leaf DNA was extracted using the CTAB method. Forty-seven DH lines, including Y636-9, Y663-8, Y623-1, and Y578-2, were selected. KASP marker Crr5-funK2 was validated in 47 DH populations, with 1EDHR1 serving as a resistance control. Results showed that all 47 susceptible DH lines clustered near the Y-axis, indicating susceptible genotypes, while 1EDHR1, representing resistant lines, clustered near the X-axis. Genotypic and phenotypic concordance between marker Crr5-funK2 and 48 DH lines was 100%. Marker Crr5-funK2 exhibits excellent versatility and accuracy, making it suitable for marker-assisted selection of Chinese cabbage clubroot disease materials.
[0052] Figure 2 This is the result of KASP genotyping in natural populations using marker Crr5-funK2.
[0053] Conclusion: This study discovered the SNP marker A08-12285323, which is associated with the clubroot resistance gene Crr5 in Chinese cabbage, and published the primer set Crr5-funK2 for detecting this marker. This SNP marker and its detection primer set Crr5-funK2 enable accurate and efficient detection of both resistant and susceptible accessions. This screening method is unaffected by environmental factors, significantly reduces field selection workload, and facilitates accelerated disease-resistant breeding in Chinese cabbage.
[0054] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. Use of a SNP molecular marker A08-12285323 in identifying clubroot resistance in Chinese cabbage and / or in breeding clubroot-resistant Chinese cabbage. The sequence of the SNP molecular marker A08-12285323 is shown in SEQ ID NO.
1. The 70th base from the 5' end of the sequence shown in SEQ ID NO. 1 is a SNP site, and the base is T or C.
2. Use of a reagent for detecting the SNP molecular marker A08-12285323 or a kit for detecting the SNP molecular marker A08-12285323 in identifying Chinese cabbage clubroot resistance and / or in breeding Chinese cabbage resistant to clubroot; The reagent includes a primer set Crr5-funK2, and the primer set Crr5-funK2 includes Crr5-funK2Fa, Crr5-funK2Fb and Crr5-funK2R; the nucleotide sequence of Crr5-funK2Fa is shown in SEQ ID NO.2; the nucleotide sequence of Crr5-funK2Fb is shown in SEQ ID NO.3; and the nucleotide sequence of Crr5-funK2R is shown in SEQ ID NO.4; The Crr5-funK2Fa and Crr5-funK2Fb are respectively labeled with fluorescent groups of different colors; the fluorescent groups include FAM and HEX; The kit includes the reagents and reaction solution; The sequence of the SNP molecular marker A08-12285323 is shown in SEQ ID NO.
1. The 70th base from the 5' end of the sequence shown in SEQ ID NO. 1 is a SNP site, and the base is T or C.
3. A method for identifying resistance to clubroot in Chinese cabbage, characterized in that: The following steps are involved: Competitive allele-specific PCR amplification of Chinese cabbage genomic DNA is performed using a reagent for detecting the SNP molecular marker A08-12285323 or a kit for detecting the SNP molecular marker A08-12285323, and finally the KASP amplification product is read by an endpoint fluorescence signal to obtain a genotyping result. When the genotype is TT or TC, the Chinese cabbage is identified as clubroot-resistant Chinese cabbage, and when the genotype is CC, the Chinese cabbage is identified as clubroot-susceptible Chinese cabbage; The reagent includes a primer set Crr5-funK2, and the primer set Crr5-funK2 includes Crr5-funK2Fa, Crr5-funK2Fb and Crr5-funK2R; the nucleotide sequence of Crr5-funK2Fa is shown in SEQ ID NO.2; the nucleotide sequence of Crr5-funK2Fb is shown in SEQ ID NO.3; and the nucleotide sequence of Crr5-funK2R is shown in SEQ ID NO.4; The Crr5-funK2Fa and Crr5-funK2Fb are respectively labeled with fluorescent groups of different colors; the fluorescent groups include FAM and HEX; The kit includes the reagents and reaction solution; The sequence of the SNP molecular marker A08-12285323 is shown in SEQ ID NO.
1. The 70th base from the 5' end of the sequence shown in SEQ ID NO. 1 is a SNP site, and the base is T or C.
4. The method according to claim 3, characterized in that The PCR amplification reaction system was 8 μL, including 1.5 μL genomic DNA, 4 μL 2×KASP Master mix, 0.14 μL primer set Crr5-funK2, and the balance water.
5. The method according to claim 3, characterized in that The PCR amplification reaction program includes: 94°C for 15 min; 94°C for 20 s, 61°C for 60 s, for a total of 10 cycles, starting from the second cycle, decreasing 0.6°C each cycle; 94°C for 20 s, 55°C for 60 s, for a total of 26 cycles; 37°C for 1 min.