Preparation method and application of an electrochemical sensor for detecting circulating tumor cells with dual signal output

Abstract

The present invention discloses a preparation method and application of an electrochemical sensor for detecting circulating tumor cells with dual signal outputs, which is characterized by comprising the following steps: 1) synthesizing a capture unit 2DNM@Fe3O4-APTs; 2) simultaneously immobilizing an amino-modified MUC1 aptamer and an amino-modified EpCAM aptamer on BPNS@CuNPs via Cu-N coordination bonds to prepare a signal unit BPNS@CuNPs-APTs; 3) adding the capture unit and the signal unit to a cell standard solution, and dripping the solution onto the surface of a magnetic glassy carbon electrode after treatment, thereby preparing a dual-mode FSCV / ECL dual-signal output electrochemical sensor for detecting circulating tumor cells in a sample to be tested in one step; the electrochemical sensor can be used for FSCV / ECL dual-mode detection of circulating tumor cells in a sample to be tested, and has the advantages of high sensitivity, high selectivity, accuracy and reliability, and simple and rapid operation.

Description

Technical Field

[0001] The present invention relates to an electrochemical sensor for detecting circulating tumor cells, and in particular to a preparation method and application of an electrochemical sensor for detecting circulating tumor cells with dual signal output. Background Art

[0002] Circulating tumor cells (CTCs) are a general term for various types of tumor cells present in peripheral blood. As invasive cancer cells, they can shed from the primary tumor or metastatic site, spread into the bloodstream and circulate in blood vessels, then rapidly proliferate in other parts of the body, becoming the primary vector of tumor metastasis. Therefore, developing methods for rapid, sensitive, and accurate detection of CTCs in the blood is of great significance. Currently, the main methods for detecting CTCs in the blood are physical separation methods and chemical analysis methods based on bioaffinity. Physical separation methods include microfiltration, fixed lateral displacement, and density gradient centrifugation. These methods are complex in experimental setup, result in high CTC loss, and have low sample purity, making accurate quantification difficult. Chemical analysis methods based on bioaffinity, such as Cellsearch, are relatively mature, highly sensitive, and easy to operate, but they require a large amount of blood and their magnetic beads are not very efficient in capturing CTCs. Compared to these methods, electrochemical biosensors offer potential advantages in CTC detection due to their simple instrumentation, ease of operation, small sample size, and low analysis cost. However, the current electrochemical biosensor has low sensitivity and accuracy in directly detecting intact CTCs, mainly due to the following reasons: (1) Low capture efficiency of target CTCs. The CTC content in whole blood is extremely low, only 1 to 100 cells / mL, and the contact area between the modified electrode and the sample is small, resulting in low capture efficiency. (2) The sensor construction mode limits the electron transfer efficiency. CTCs are usually 10 to 25 μm in size. If the traditional sandwich sensor construction mode is used, the distance between most electrochemical markers and the electrode surface is too large, and the electron tunneling efficiency between the two is extremely low, resulting in almost no electrochemical reaction, which directly limits the detection sensitivity and accuracy. Obviously, in order to achieve high sensitivity and high accuracy direct detection of intact CTCs in whole blood by electrochemical biosensors, it is necessary to design efficient CTC identification, capture and separation methods and reliable signal amplification strategies.

[0003] Two-dimensional conductive nanomaterials have been widely used in the field of electrochemical biosensing, including graphene oxide (GO), graphite-like carbon nitride (g-C3N4), molybdenum disulfide (MoS2), titanium carbide Ti3C2T x(MXene), black phosphorus nanosheets (BPNS), etc. Their common characteristics include: (1) large specific surface area and numerous functional groups, which can load a large number of molecules; (2) good conductivity, which facilitates electron transfer and corresponding electrochemical reactions; (3) good biocompatibility, which can achieve compatibility between electrochemistry and biosensing, and is also conducive to the identification and capture of biomolecules. Electrochemiluminescence (ECL) is a highly sensitive analytical method and has been widely used in bioanalysis fields such as immunoassay and nucleic acid hybridization analysis. This method combines the advantages of high sensitivity, wide linear range and simple instrumentation of chemiluminescence with the advantages of good reproducibility and easy control of electrochemical methods. Fast scan voltammetry (FSCV) is an electrochemical method with sub-second resolution. Its detection sensitivity increases with the increase of scan rate and is suitable for the detection of trace analytes. At present, there are no reports on the detection of circulating tumor cells based on the dual signal output of ECL and FSCV based on two-dimensional conductive nanomaterials at home and abroad. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a preparation method and application of an electrochemical sensor for detecting circulating tumor cells with dual signal output, which is highly sensitive, highly selective, accurate, reliable, simple and fast to operate.

[0005] The technical solution adopted by the present invention to solve the above technical problems is:

[0006] 1. A method for preparing an electrochemical sensor with dual signal output for detecting circulating tumor cells, comprising the following steps:

[0007] (1) Synthesis of capture unit 2DNM@Fe3O4-APTs

[0008] A. 1-2 mL of 5 mg / mL 2DNM was added to 1-2 mL of NH2-Fe3O4 dispersion, stirred at room temperature for 6-8 h, magnetically separated, and redispersed in 5-10 mL of water to obtain 2DNM@Fe3O4 dispersion. B. 1-Ethyl-(3-dimethylaminopropyl)carbodiimide (EDC), N-hydroxysuccinimide (NHS), carboxyl-modified mucin 1 (MUC1) aptamer, and carboxyl-modified epithelial cell adhesion molecule (EpCAM) aptamer were added to TE-Mg 2+ The components were mixed in a buffer solution to make the final concentrations of 1.2 mg / mL, 1.8 mg / mL, 5 μmol / L, and 5 μmol / L, respectively, and stirred at room temperature for 4 to 8 hours to activate the carboxyl groups to obtain a mixed solution;

[0009] C. Add 300-500 μL of the mixture to 2-3 mL of 2DNM@Fe3O4 dispersion and incubate at 4°C for 5-8 h. Then, add 200-300 μL of 2 wt% bovine serum albumin (BSA) to block nonspecific active sites. The resulting capture units, 2DNM@Fe3O4-APTs, were magnetically separated and redispersed in 2-3 mL of water to obtain the capture units.

[0010] (2) Synthesis of signaling unit BPNS@CuNPs-APTs

[0011] A. In situ reduction of [Cu(NH3)4] on black phosphorus nanosheets (BPNS) 2+ Preparation of BPNS@CuNPs;

[0012] B. BPNS@CuNPs-APTs were prepared by simultaneously immobilizing amino-modified MUC1 aptamer and amino-modified EpCAM aptamer on BPNS@CuNPs via Cu-N coordination bonds.

[0013] (3) Preparation of dual-mode FSCV / ECL biosensor:

[0014] Add 30-60 μL of capture unit and 30-60 μL of signal unit to 1 mL of cell standard solution, incubate at 37°C for 30-40 min, magnetically separate and rinse twice with PBS solution, then redisperse the resulting complex capture unit-cell-signal unit in 50 μL of PBS solution and drop it onto the surface of a magnetic glassy carbon electrode (MGCE). This is how a dual-mode FSCV / ECL electrochemical sensor with dual signal output for detecting circulating tumor cells can be prepared in one step.

[0015] Furthermore, the two-dimensional conductive nanomaterials described in step (1)A include graphene oxide (GO), graphite-like carbon nitride (g-C3N4), molybdenum disulfide (MoS2), titanium carbide Ti3C2T x (MXene) and black phosphorus nanosheets (BPNS).

[0016] Furthermore, the preparation method of the magnetic material NH2-Fe3O4 described in step (1)A is as follows: 0.23-0.32g FeCl3·6H2O, 0.7-0.8g NH4Ac and 0.07-0.09g sodium citrate are added to 13-15mL ethylene glycol, and after vigorous stirring at 150-170°C under a nitrogen atmosphere for 1h, the mixed solution is transferred to a polytetrafluoroethylene-lined stainless steel autoclave, heated at 180-210°C for 17h, and magnetically cleaned to obtain Fe3O4 nanoparticles; the obtained Fe3O4 is dispersed together with 180-230μL 3-aminopropyltriethoxysilane APTES in 5-15mL ethanol, ultrasonically treated for 1h and stirred at room temperature for 6h, and redispersed in 30-50mL water after magnetic cleaning to obtain NH2-Fe3O4 (amino-functionalized Fe3O4 nanoparticles) dispersion.

[0017] Further, the TE-Mg 2+ Preparation of buffer solution: Dissolve 0.0292g EDTA and 0.6271g MgCl2·6H2O in 50mL 0.05mol / L pH=8.0 Tris-HCl buffer solution to obtain TE-Mg 2+ Buffer solution.

[0018] Furthermore, the BPNS@CuNPs preparation method described in step (2) A specifically comprises the following steps: adding 0.05-0.1 mL of 0.1 mmol / L Cu(NO3)2 to 10-15 mL of 5 mol / L NH3·H2O, and then adding 10-15 mL of 0.2 mg / mL BPNS. After stirring at room temperature for 14-16 h, the mixture was centrifuged at 6644 × g and redispersed in 2-3 mL of water to obtain a BPNS@CuNPs dispersion.

[0019] Furthermore, the BPNS@CuNPs-APTs preparation method described in step (2) B has the following specific steps: adding 200-250 μL of 10 μmol / L amino-modified mucin 1 MUC1 aptamer and 200-250 μL of 10 μmol / L amino-modified epithelial cell adhesion molecule EpCAM aptamer to 2-3 mL of BPNS@CuNPs dispersion, incubating at 4°C for 8-10 h, centrifuging and washing at 6644 × g and redispersing in 2-3 mL of water, adding 200 μL of 2 wt% BSA to block nonspecific active sites, centrifuging and washing again and redispersing in 2-3 mL of water to obtain signaling unit BPNS@CuNPs-APTs.

[0020] Furthermore, the sequence of the mucin 1MUC1 aptamer is as follows: GCAGTTGATCCTTTGGATACCCTGG; the sequence of the epithelial cell adhesion molecule EpCAM aptamer is as follows: CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG.

[0021] 2. A method for detecting circulating tumor cells using the electrochemical sensor for detecting circulating tumor cells with dual signal output obtained by the above preparation method, which is not intended for diagnosis or treatment, comprises the following steps:

[0022] (1) FSCV detection: An electrochemical sensor for detecting circulating tumor cells with dual signal output was used as the working electrode and a platinum electrode as the auxiliary electrode. The electrodes were placed in a 0.1 mol / L pH = 7.0 KNO3 solution. Fast scanning cyclic voltammetry was used with a potential range of -0.7 to 1.3 V and a potential scan rate of 500 V / s. The oxidation peak current corresponding to different concentrations of circulating tumor cells was measured, and the concentration of circulating tumor cells in the test solution was calculated based on the current signal value.

[0023] (2) ECL detection: An electrochemical sensor for detecting circulating tumor cells with dual signal output was used as the working electrode, and a platinum electrode was used as the auxiliary electrode. The electrodes were placed in a 0.1 mol / L pH = 7.0 KNO3 solution containing 0.1 mol / L co-reactant K2S2O8. The electrochemiluminescence method was used with a potential range of 0 to -1.5 V, a potential scan rate of 0.3 V / s, and a photomultiplier tube voltage of 800 V. The electrochemiluminescence intensity corresponding to different concentrations of circulating tumor cells was measured, and the circulating tumor cell concentration in the test solution was calculated based on the electrochemiluminescence intensity value.

[0024] Invention principle: The principle of electrochemical sensor is as follows Figure 1 As shown. The capture unit is 2DNM@Fe3O4-APTs, which uses 2DNM with good conductivity and large specific surface area as the substrate. A large number of amino-Fe3O4 nanoparticles are bound to the 2DNM surface by electrostatic adsorption, and a large number of dual aptamer APTs (EpCAM aptamer and MUC1 aptamer) are bound by amide bonds. The signal unit is BPNS@CuNPs-APTs, which uses BPNS with excellent photoelectric properties and good reducibility as the substrate. By in situ reduction of [Cu(NH3)4] 2+CuNPs are rapidly, uniformly, and massively assembled on the BPNS surface, and the dual aptamer APTs are bound to the CuNPs via Cu-N bonds. When the target circulating tumor cell, A549, is present, the specific recognition of the aptamer enables the capture unit and signal unit to rapidly bind to the cell, ultimately forming a "capture unit-A549-signal unit" complex. This complex can be rapidly assembled on the electrode surface under the action of a magnetic force, facilitating the rapid, simple, and reproducible preparation of the sensor. CuNPs provide FSCV signals, while BPNS provide electrochemiluminescence (ECL) signals. The two signals do not interfere with each other, forming a FSCV / ECL dual-mode detection.

[0025] Compared with the prior art, the advantages of the present invention are

[0026] (1) High selectivity: Two different nucleic acid aptamers with high specificity and high affinity are used to separate the circulating tumor cells A549 in the test sample, achieving specific recognition and capture of A549.

[0027] (2) High sensitivity: Two multifunctional two-dimensional bionanomaterials are used together to construct a Faraday cage electrochemical biosensor, which not only loads more signal markers and effectively promotes electron transfer behavior, but also improves the CTC capture efficiency and achieves multi-level signal enhancement. The ECL method uses electrons as excitation and performs detection in a completely dark background without background light interference, which has an inherent sensitivity advantage. The FSCV method can transfer a certain amount of electrons between the electrochemical signal marker and the electrode in a shorter time, so it can obtain a Faraday current that increases linearly with the scan rate, achieving a detection sensitivity increase of hundreds or thousands of times.

[0028] (3) High reliability: ECL and FSCV are used for simultaneous detection, and ECL and FSCV signals can be cross-validated, which helps to avoid false positive / false negative results.

[0029] In summary, the present invention provides a method for preparing an electrochemical sensor for detecting circulating tumor cells with dual signal output and its application. Two multifunctional bio-nanomaterials, the capture unit 2DNM@Fe3O4-APTs and the signal unit BPNS@CuNPs-APTs, are prepared. Due to the synergistic effect of the two multifunctional two-dimensional bio-nanomaterials, the electrochemical biosensor realizes high-efficiency capture of intact CTCs and rapid scanning cyclic voltammetry / electrochemiluminescence dual-channel detection for the first time, providing a highly sensitive, highly specific, simple and rapid CTC detection method with potential application value in real-time cancer diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Schematic diagram of an electrochemical sensor for detecting circulating tumor cells with dual signal output;

[0031] Figure 2 The biosensor was tested at different A549 concentrations (1-10 6 cells / mL);

[0032] Figure 3 is the linear relationship between the peak current and the logarithm of A549 concentration;

[0033] Figure 4 The biosensor was tested at different A549 concentrations (1-10 6 cells / mL);

[0034] Figure 5 is the linear relationship between electrochemiluminescence intensity and the logarithm of A549 concentration;

[0035] Figure 6 Signal stability of electrochemical biosensors;

[0036] Figure 7 for the reproducibility and storage stability of electrochemical biosensors;

[0037] Figure 8 for the selectivity of electrochemical biosensors;

[0038] Figure 9 The signal response of the electrochemical biosensor to different concentrations of A549 in whole blood and PBS;

[0039] Figure 10 The results of the FSCV and ECL methods were consistent. DETAILED DESCRIPTION

[0040] The present invention will be described in further detail below with reference to the accompanying drawings and embodiments. Specific embodiment 1

[0042] Example 1

[0043] A method for preparing an electrochemical sensor for detecting circulating tumor cells with dual signal output, such as Figure 1 The following steps are shown:

[0044] (1) Synthesis of capture unit 2DNM@Fe3O4-APTs

[0045] A. Add 1.5 mL of 5 mg / mL 2DNM to 1.5 mL of NH2-Fe3O4 dispersion, stir at room temperature for 6-8 h, separate magnetically and redisperse in 5 mL of water to obtain 2DNM@Fe3O4 dispersion. The synthesis method of magnetic material NH2-Fe3O4 is as follows: 0.27 g FeCl3·6H2O, 0.77 g NH4Ac and 0.08g sodium citrate were added to 14mL ethylene glycol, and after vigorous stirring at 160℃ under nitrogen atmosphere for 1h, the mixed solution was transferred to a polytetrafluoroethylene-lined stainless steel autoclave, heated at 200℃ for 17h, and magnetically cleaned to obtain Fe3O4 nanoparticles. The obtained Fe3O4 was dispersed in 10mL ethanol together with 200μL 3-aminopropyltriethoxysilane (APTES), ultrasonically treated for 1h and stirred at room temperature for 6h. After magnetic cleaning, it was redispersed in 50mL water to obtain amino-functionalized Fe3O4 nanoparticles (NH2-Fe3O4) dispersion.

[0046] B. Add 1-ethyl-(3-dimethylaminopropyl)carbodiimide (EDC), N-hydroxysuccinimide (NHS), carboxyl-modified mucin 1 (MUC1) aptamer, and carboxyl-modified epithelial cell adhesion molecule (EpCAM) aptamer to TE-Mg 2+ The final concentrations of the components were 1.2 mg / mL, 1.8 mg / mL, 5 μmol / L, and 5 μmol / L, respectively, and stirred at room temperature for 4 to 8 hours to activate the carboxyl groups to obtain a mixed solution; TE-Mg 2+ Preparation of buffer solution: Dissolve 0.0292g EDTA and 0.6271g MgCl2·6H2O in 50mL 0.05mol / L pH=8.0 Tris-HCl buffer solution to obtain TE-Mg 2+ Buffer solution;

[0047] C. 400 μL of the mixture was added to 2 mL of 2DNM@Fe3O4 dispersion and incubated at 4°C for 5–8 h. Then, 250 μL of 2 wt% bovine serum albumin (BSA) was added to block nonspecific active sites. The mixture was magnetically separated and redispersed in 2 mL of water to obtain the capture units 2DNM@Fe3O4-APTs.

[0048] (2) Synthesis of signaling unit BPNS@CuNPs-APTs

[0049] A. By in situ reduction of [Cu(NH3)4] 2+BPNS@CuNPs were prepared as follows: 0.08 mL of 0.1 mmol / L Cu(NO3)2 was added to 12 mL of 5 mol / L NH3·H2O to form a mixed solution, followed by the addition of 12 mL of 0.2 mg / mL BPNS. The mixture was stirred at room temperature for 14 h, centrifuged at 6644 × g, and redispersed in 2.5 mL of water to obtain a BPNS@CuNPs dispersion.

[0050] B. BPNS@CuNPs-APTs were prepared by simultaneously immobilizing amino-modified MUC1 aptamers and amino-modified EpCAM aptamers on BPNS@CuNPs via Cu-N coordination bonds. The specific steps were as follows: 225 μL of 10 μmol / L amino-modified mucin-1 MUC1 aptamer and 225 μL of 10 μmol / L amino-modified epithelial cell adhesion molecule EpCAM aptamer were added to 2.5 mL of BPNS@CuNPs dispersion. After incubation at 4°C for 8 h, the suspension was washed by centrifugation at 6644 × g and redispersed in 2.5 mL of water. 200 μL of 2 wt% BSA was added to block nonspecific active sites. The suspension was washed by centrifugation again and redispersed in 2.5 mL of water to obtain the signaling units BPNS@CuNPs-APTs.

[0051] (3) Preparation of dual-mode FSCV / ECL biosensor

[0052] 50 μL of capture unit and 50 μL of signal unit were added to 1 mL of cell standard solution, incubated at 37°C for 35 min, magnetically separated and rinsed twice with PBS solution, and then the resulting complex capture unit-cell-signal unit was redispersed in 50 μL of PBS and dropped onto the surface of a magnetic glassy carbon electrode (MGCE). This is how a dual-mode FSCV / ECL electrochemical sensor with dual signal output for detecting circulating tumor cells was prepared in one step.

[0053] The above two-dimensional conductive nanomaterials include graphene oxide (GO), graphite-like carbon nitride (g-C3N4), molybdenum disulfide, titanium carbide Ti3C2T x and black phosphorus nanosheets (BPNS).

[0054] The sequence of the above-mentioned mucin 1MUC1 aptamer is as follows: GCAGTTGATCCTTTGGATACCCTGG; the sequence of the epithelial cell adhesion molecule EpCAM aptamer is as follows: CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG.

[0055] Example 2

[0056] The same as the above embodiment 1, except that:

[0057] Step (1) in the synthesis of the capture unit 2DNM@Fe3O4-APTs:

[0058] A. 1 mL of 5 mg / mL two-dimensional conductive nanomaterial was added to 1 mL of NH2-Fe3O4 dispersion, stirred at room temperature for 6-8 h, magnetically separated, and redispersed in 8 mL of water to obtain a 2DNM@Fe3O4 dispersion. The synthesis method of the magnetic material NH2-Fe3O4 is as follows: 0.23 g of FeCl3·6H2O, 0.7 g of NH4Ac, and 0.07 g of sodium citrate were added to 13 mL of ethylene glycol. After vigorous stirring at 150°C under a nitrogen atmosphere for 1 h, the mixed solution was transferred to a polytetrafluoroethylene-lined stainless steel autoclave, heated at 180°C for 17 h, and magnetically cleaned to obtain Fe3O4 nanoparticles. The obtained Fe3O4 was mixed with 180 μL of 3-Aminopropyltriethoxysilane (APTES) was dispersed in 5 mL of ethanol, ultrasonicated for 1 h and stirred at room temperature for 6 h. After magnetic cleaning, it was redispersed in 30 mL of water to obtain a dispersion of amino-functionalized Fe3O4 nanoparticles (NH2-Fe3O4).

[0059] C. 300 μL of the mixture was added to 2.5 mL of 2DNM@Fe3O4 dispersion. After incubation at 4°C for 5–8 h, 200 μL of 2 wt% bovine serum albumin (BSA) was added to block nonspecific active sites. The mixture was magnetically separated and redispersed in 2 mL of water to obtain the capture units 2DNM@Fe3O4-APTs.

[0060] Step (2) Synthesis of signaling unit BPNS@CuNPs-APTs:

[0061] A. Add 0.05 mL of 0.1 mmol / L Cu(NO3)2 to 10 mL of 5 mol / L NH3·H2O, then add 10 mL of 0.2 mg / mL BPNS. Stir at room temperature for 14–16 h, centrifuge at 6644 × g, and redisperse in 2 mL of water to obtain a BPNS@CuNPs dispersion.

[0062] B. 200 μL of 10 μmol / L amino-modified MUC1 aptamer and 200 μL of 10 μmol / L amino-modified EpCAM aptamer were added to 2 mL of BPNS@CuNPs dispersion. After incubation at 4°C for 8-10 h, the mixture was washed by centrifugation at 6644 × g and redispersed in 2 mL of water. 200 μL of 2 wt% BSA was added to block nonspecific active sites. The mixture was washed by centrifugation again and redispersed in 2 mL of water to obtain the signaling units BPNS@CuNPs-APTs.

[0063] Step (3) Preparation of the dual-mode FSCV / ECL biosensor: add 30 μL of capture unit and 30 μL of signal unit to 1 mL of cell standard solution, incubate at 37°C for 30-40 min, magnetically separate and rinse twice with PBS solution, then redisperse the resulting complex capture unit-cell-signal unit in 50 μL PBS and drop it onto the surface of the magnetic glassy carbon electrode (MGCE). This is how the dual-mode FSCV / ECL electrochemical sensor for detecting circulating tumor cells with dual signal output can be prepared in one step.

[0064] Example 3

[0065] The same as the above embodiment 1, the difference is:

[0066] Step (1) in the synthesis of the capture unit 2DNM@Fe3O4-APTs:

[0067] A. Add 2 mL of 5 mg / mL two-dimensional conductive nanomaterial to 2 mL of NH2-Fe3O4 dispersion, stir at room temperature for 6-8 h, magnetically separate, and redisperse in 10 mL of water to obtain a 2DNM@Fe3O4 dispersion. The synthesis method of the magnetic material NH2-Fe3O4 is as follows: add 0.32 g of FeCl3·6H2O, 0.8 g of NH4Ac, and 0.09 g of sodium citrate to 15 mL of ethylene glycol, vigorously stir at 170°C under a nitrogen atmosphere for 1 h, transfer the mixed solution to a polytetrafluoroethylene-lined stainless steel autoclave, heat at 210°C for 17 h, and obtain Fe3O4 nanoparticles after magnetic cleaning. The obtained Fe3O4 is mixed with 230 μL of 3-Aminopropyltriethoxysilane (APTES) was dispersed in 15 mL of ethanol, ultrasonicated for 1 h and stirred at room temperature for 6 h. After magnetic cleaning, it was redispersed in 50 mL of water to obtain a dispersion of amino-functionalized Fe3O4 nanoparticles (NH2-Fe3O4).

[0068] C. Add 500 μL of the mixture to 3 mL of 2DNM@Fe3O4 dispersion and incubate at 4°C for 5-8 h. Then, add 300 μL of 2 wt% bovine serum albumin (BSA) to block nonspecific active sites. The mixture was magnetically separated and redispersed in 3 mL of water to obtain the capture units 2DNM@Fe3O4-APTs.

[0069] Step (2) Synthesis of signaling unit BPNS@CuNPs-APTs:

[0070] A. Add 0.1 mL of 0.1 mmol / L Cu(NO3)2 to 15 mL of 5 mol / L NH3·H2O, then add 15 mL of 0.2 mg / mL BPNS. Stir at room temperature for 14–16 h, centrifuge at 6644 × g, and redisperse in 2–3 mL of water to obtain a BPNS@CuNPs dispersion.

[0071] B. 250 μL of 10 μmol / L amino-modified MUC1 aptamer and 250 μL of 10 μmol / L amino-modified EpCAM aptamer were added to 3 mL of BPNS@CuNPs dispersion. After incubation at 4°C for 8-10 h, the mixture was washed by centrifugation at 6644 × g and redispersed in 3 mL of water. 200 μL of 2 wt% BSA was added to block nonspecific active sites. The mixture was washed by centrifugation again and redispersed in 3 mL of water to obtain the signaling units BPNS@CuNPs-APTs.

[0072] Step (3) Preparation of dual-mode FSCV / ECL biosensor:

[0073] Add 30-60 μL of capture unit and 30-60 μL of signal unit to 1 mL of cell standard solution, incubate at 37°C for 30-40 min, magnetically separate and rinse twice with PBS solution, then redisperse the resulting complex capture unit-cell-signal unit in 50 μL PBS and drop it onto the surface of a magnetic glassy carbon electrode (MGCE). This is how a dual-mode FSCV / ECL electrochemical sensor with dual signal output for detecting circulating tumor cells can be prepared in one step. Specific embodiment 2

[0075] The method for detecting circulating tumor cells using the dual-mode FSCV / ECL electrochemical sensor prepared in the first embodiment is as follows:

[0076] 1. Cell culture

[0077] The cells were stored in DMEM medium containing 10% fetal bovine serum, 100U / mL streptomycin, and 100U / mL penicillin, and cultured in a 5% CO2, 37°C culture environment. Before the experiment, all old culture medium was discarded and the cells were rinsed with 1mL1×PBS solution. Then, 1mL of 25% trypsin was added for digestion for 1.5min, the trypsin was discarded and the cells were allowed to stand in a 5% CO2, 37°C culture environment for 1min, and then 2mL of new culture medium was added for cell suspension. Then, the mixture was centrifuged at 800×g for 5min to separate the cells from the culture medium solution. Finally, the cells were resuspended in 1×PBS solution for electrochemical determination. The number of cells was counted using a cell counter, and a series of cell standard solutions were obtained by serial dilution, with concentrations of 1.0×10 6 , 1.0×10 5 , 1.0×10 4 , 1.0×10 3 , 1.0×10 2 , 1.0×10 1 and 1.0 cells / mL.

[0078] 2. FSCV detection: An electrochemical sensor for detecting circulating tumor cells with dual signal output was used as the working electrode, and a platinum electrode was used as the auxiliary electrode. The solution was placed in a 0.1 mol / L pH = 7.0 KNO3 solution. Fast scanning cyclic voltammetry (FSCV) was used with a potential range of -0.7 to 1.3 V and a potential scan rate of 500 V / s. The corresponding oxidation peak current under different A549 concentrations was measured, and the A549 concentration in the A549 solution to be tested was calculated based on the current signal value.

[0079] like Figure 2 As shown in Figure 2, the FSCV signal response increased with increasing A549 concentration. Figure 3 As shown, the peak current is between 10 and 10 6 The logarithm of A549 concentration showed a good linear relationship in the range of cells / mL. The linear regression equation was y=0.26*logx+0.06, and the square correlation coefficient R 2 =0.994, where y is the peak current (mA) and x is the A549 concentration (cells / mL). Based on the signal-to-noise ratio S / N=3, the LOD is approximately 3 cells / mL.

[0080] 3. ECL Detection: An electrochemical sensor for detecting circulating tumor cells with dual signal output was used as the working electrode, and a platinum electrode was used as the auxiliary electrode. The sample was placed in a 0.1 mol / L pH = 7.0 KNO3 solution containing 0.1 mol / L of the co-reactant K2S2O8. Electrochemiluminescence (ECL) was used over a potential range of 0 to -1.5 V, a potential scan rate of 0.3 V / s, and a photomultiplier tube voltage of 800 V. The ECL intensities corresponding to different A549 concentrations were measured, and the A549 concentration in the test A549 solution was calculated based on the ECL intensities.

[0081] like Figure 4 As shown in Figure 2, the ECL intensity increased with the increase of A549 concentration. Figure 5 As shown, the ECL intensity is between 10 and 10 6 There is a good linear relationship between the logarithm of A549 concentration and the cells / mL range. The linear regression equation is y=1528*logx-833.3, and the square correlation coefficient R 2 =0.993, where y is the ECL intensity (au) and x is the A549 concentration (cells / mL). Based on the signal-to-noise ratio S / N=3, the LOD is approximately 3 cells / mL. Specific embodiment three

[0083] Signal stability is an important indicator of electrochemical sensors. 4 cells / mL A549, and scanned continuously for 500 cycles at a scan rate of 500 V / s to examine the stability of the FSCV signal. Figure 6 As shown in the figure, the FSCV signal intensity hardly changes. For ECL, its intensity is stable in 13 consecutive scanning cycles with a relative standard deviation (RSD) of 2.0%. Therefore, the dual-mode electrochemical biosensor has good signal stability. In addition, the relevant materials were stored in a refrigerator at 4°C, and a batch of sensors were made every day and tested continuously for 10 days to investigate the reproducibility and storage stability. Figure 7 As shown, the RSDs for the FSCV and ECL assays were 2.1% and 2.2%, respectively, demonstrating excellent reproducibility and storage stability. This is primarily due to the sensor's one-step preparation. In this one-step strategy, all materials in the experiment can be adsorbed onto the MGCE in a single step after recognition with A549, making it simple to operate. Traditional electrochemical biosensors typically use a sandwich-type assembly process, requiring layer-by-layer assembly on the electrode surface. This is time-consuming and complex, hindering the stability and reproducibility of the sensor's detection signal. Specific embodiment 4

[0085] The selectivity of the electrochemical biosensor was studied by testing the following samples: blank group, 10 5cells / mL of cervical cancer cells (Hela), 10 4 cells / mL of target A549 and a mixture of two cancer cells. Figure 8 As shown in the figure, the signal of Hela, which is 10 times higher than the target A549 concentration, is very weak, while the signal intensity of A549 and cell mixture samples containing A549 are close, indicating that the electrochemical biosensor has high selectivity in detecting targets in complex samples, which is mainly due to the specific recognition of A549 by the dual aptamer. Specific embodiment five

[0087] Accuracy and precision verification

[0088] Processing of whole blood samples: The spiked samples were cell suspensions containing different concentrations of A549 added to blank whole blood samples. The actual whole blood samples were obtained from the Second Affiliated Hospital of Fujian Medical University. 3 mL of red blood cell lysis buffer was added to the whole blood sample, and after a 15-minute ice bath, the sample was centrifuged at 800 × g for 5 minutes. The supernatant was discarded and the sample was resuspended in 50 μL of 1 × PBS for testing. A series of standard spiked solutions were prepared by adding different concentrations of A549 to blank whole blood samples to evaluate their accuracy and precision. The results are shown in Table 1.

[0089] Table 1 Detection results of A549 in whole blood samples ( n=5)

[0090]

[0091]

[0092] As shown in Table 1, the recovery rate of FSCV detection was 93% to 104% with an RSD of 2.0% to 7.0%, while the recovery rate of ECL detection was 92% to 103% with an RSD of 3.0% to 7.0%. Figure 9 As shown in the figure, the signal difference between the buffer PBS sample and the whole blood sample is negligible. The above results indicate that the dual-mode electrochemical biosensor has good accuracy and precision. Specific embodiment six

[0094] ECL and FSCV signal consistency verification

[0095] Based on the test results of the spiked samples in Table 1, the consistency of the FSCV and ECL results was studied. Figure 10 As shown in Figure 2, the linear regression equation between the two methods is y = 0.999*x–0.003, where y is the A549 concentration measured by ECL and x is the A549 concentration measured by FSCV. The slope is 0.999, the intercept is -0.003, and R 2The p-value was 0.999, indicating that the detection results of the two methods were highly consistent and could be cross-validated. This dual-mode detection method helps avoid false negative / positive results that may occur in single-mode methods, effectively improving the reliability of detection. Specific embodiment seven

[0097] Real whole blood sample analysis

[0098] To verify whether the proposed dual-mode electrochemical biosensor can perform sensitive detection on real blood samples, the biosensor and flow cytometry were used to quantitatively detect whole blood samples. The results are shown in Table 2.

[0099] Table 2 A549 content test in real whole blood samples

[0100]

[0101] As shown in Table 2, the intergroup t-test was used to examine the significant differences between the two groups. It can be found that the t-value between FSCV and flow cytometry was 0.23, the t-value between ECL and flow cytometry was 0.59, and the t-value between FSCV and ECL was 0.48, which were all much smaller than t 0.05,6 =2.45, no significant difference (P>0.05). The results showed that the sensor has good reliability and practicality.

[0102] The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by persons of ordinary skill in the art within the spirit and scope of the present invention shall also fall within the scope of protection of the present invention.

Claims

1. A method for preparing an electrochemical sensor for detecting circulating tumor cells with dual signal output, characterized in that The following steps are involved: (1) Synthesis of capture unit 2DNM@Fe3O4-APTs A. Add 1-2 mL of 5 mg / mL 2DNM to 1-2 mL of NH2-Fe3O4 dispersion, stir at room temperature for 6-8 h, magnetically separate, and redisperse in 5-10 mL of water to obtain a 2DNM@Fe3O4 dispersion. B. Add 1-ethyl-(3-dimethylaminopropyl)carbodiimide (EDC), N-hydroxysuccinimide (NHS), carboxyl-modified mucin 1 (MUC1) aptamer, and carboxyl-modified epithelial cell adhesion molecule (EpCAM) aptamer to TE-Mg 2+ The components were mixed in a buffer solution to make the final concentrations of 1.2 mg / mL, 1.8 mg / mL, 5 μmol / L, and 5 μmol / L, respectively, and stirred at room temperature for 4 to 8 hours to activate the carboxyl groups to obtain a mixed solution; C. Add 300-500 μL of the mixture to 2-3 mL of 2DNM@Fe3O4 dispersion and incubate at 4°C for 5-8 h. Then, add 200-300 μL of 2 wt% bovine serum albumin to block nonspecific active sites. The mixture is magnetically separated and redispersed in 2-3 mL of water to obtain capture units 2DNM@Fe3O4-APTs. (2) Synthesis of signaling unit BPNS@CuNPs-APTs A. In situ reduction of [Cu(NH3)4] on black phosphorus nanosheets (BPNS) 2+ Preparation of BPNS@CuNPs; B. BPNS@CuNPs-APTs were prepared by simultaneously immobilizing amino-modified MUC1 aptamer and amino-modified EpCAM aptamer on BPNS@CuNPs via Cu-N coordination bonds. (3) Preparation of dual-mode FSCV / ECL biosensor: Add 30-60 μL of capture unit and 30-60 μL of signal unit to 1 mL of cell standard solution, incubate at 37°C for 30-40 min, magnetically separate and rinse twice with PBS solution, then redisperse the resulting complex capture unit-cell-signal unit in 50 μL of PBS solution and drop it onto the surface of a magnetic glassy carbon electrode. This is how a dual-mode FSCV / ECL electrochemical sensor for detecting circulating tumor cells with dual signal output can be prepared in one step.

2. The method for preparing an electrochemical sensor for detecting circulating tumor cells with dual signal output according to claim 1, characterized in that The two-dimensional conductive nanomaterials described in step (1)A include graphene oxide, graphite-like carbon nitride, molybdenum disulfide, titanium carbide Ti3C2T x and black phosphorus nanosheets.

3. The method for preparing an electrochemical sensor for detecting circulating tumor cells with dual signal output according to claim 1, characterized in that The preparation method of the NH2-Fe3O4 dispersion described in step (1) A comprises the following specific steps: adding 0.23-0.32 g of FeCl3·6H2O, 0.7-0.8 g of NH4Ac and 0.07-0.09 g of sodium citrate to 13-15 mL of ethylene glycol, vigorously stirring the mixture at 150-170° C. under a nitrogen atmosphere for 1 hour, transferring the mixed solution to a polytetrafluoroethylene-lined stainless steel autoclave, heating the mixture at 180-210° C. for 17 hours, and obtaining Fe3O4 nanoparticles after magnetic cleaning; dispersing the obtained Fe3O4 together with 180-230 μL of 3-aminopropyltriethoxysilane (APTES) in 5-15 mL of ethanol, ultrasonically treating the mixture for 1 hour and stirring the mixture at room temperature for 6 hours, and redispersing the mixture in 30-50 mL of water after magnetic cleaning to obtain the NH2-Fe3O4 dispersion.

4. The method for preparing an electrochemical sensor for detecting circulating tumor cells with dual signal output according to claim 1, characterized in that TE-Mg described in step (1)B 2+ Preparation of buffer solution: Dissolve 0.0292g EDTA and 0.6271g MgCl2·6H2O in 50mL 0.05mol / L pH=8.0 Tris-HCl buffer solution to obtain TE-Mg 2+ Buffer solution.

5. The method for preparing an electrochemical sensor for detecting circulating tumor cells with dual signal output according to claim 1, characterized in that The BPNS@CuNPs preparation method described in step (2)A comprises the following steps: adding 0.05-0.1 mL of 0.1 mmol / L Cu(NO3)2 to 10-15 mL of 5 mol / L NH3·H2O, and then adding 10-15 mL of 0.2 mg / mL BPNS. The mixture is stirred at room temperature for 14-16 h, centrifuged at 6644 × g, and redispersed in 2-3 mL of water to obtain a BPNS@CuNPs dispersion.

6. The method for preparing an electrochemical sensor for detecting circulating tumor cells with dual signal output according to claim 1, characterized in that The BPNS@CuNPs-APTs preparation method described in step (2) B comprises the following specific steps: adding 200-250 μL of 10 μmol / L amino-modified mucin 1 MUC1 aptamer and 200-250 μL of 10 μmol / L amino-modified epithelial cell adhesion molecule EpCAM aptamer to 2-3 mL of BPNS@CuNPs dispersion, incubating at 4°C for 8-10 h, centrifuging and washing at 6644 × g, and redispersing in 2-3 mL of water, adding 200 μL of 2 wt% BSA solution, centrifuging and washing again, and redispersing in 2-3 mL of water to obtain the signal unit BPNS@CuNPs-APTs.

7. A method for preparing an electrochemical sensor for detecting circulating tumor cells with dual signal output according to any one of claims 1 to 6, characterized in that The sequence of the mucin 1MUC1 aptamer is as follows: GCAGTTGATCCTTTGGATACCCTGG; the sequence of the epithelial cell adhesion molecule EpCAM aptamer is as follows: CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG.

8. A method for detecting circulating tumor cells using an electrochemical sensor for detecting circulating tumor cells with dual signal output obtained by the preparation method of claim 1, wherein the method is not intended for diagnosis or treatment, and is characterized in that The following steps are involved: (1) FSCV detection: An electrochemical sensor for detecting circulating tumor cells with dual signal output was used as the working electrode and a platinum electrode as the auxiliary electrode. The electrodes were placed in a 0.1 mol / L pH = 7.0 KNO3 solution. Fast scanning cyclic voltammetry was used with a potential range of -0.7 to 1.3 V and a potential scan rate of 500 V / s. The oxidation peak current corresponding to different concentrations of circulating tumor cells was measured, and the concentration of circulating tumor cells in the test solution was calculated based on the current signal value. (2) ECL detection: An electrochemical sensor for detecting circulating tumor cells with dual signal output was used as the working electrode, and a platinum electrode was used as the auxiliary electrode. The electrodes were placed in a 0.1 mol / L pH = 7.0 KNO3 solution containing 0.1 mol / L co-reactant K2S2O8. The electrochemiluminescence method was used with a potential range of 0 to -1.5 V, a potential scan rate of 0.3 V / s, and a photomultiplier tube voltage of 800 V. The electrochemiluminescence intensity corresponding to different concentrations of circulating tumor cells was measured, and the circulating tumor cell concentration in the test solution was calculated based on the electrochemiluminescence intensity value.

Images