Targeting phenylpyruvate to promote diabetic wound healing and inhibit excessive nlrp3 inflammasome activation

CN116688129BActive Publication Date: 2026-08-11THE FIRST AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-24
Publication Date
2026-08-11

AI Technical Summary

Technical Problem

然而,DFU中的代谢扰动如何调节失控的局部适应性炎症反应尚未阐明

Benefits of technology

[0045]本发明通过LiP-Map和MST等实验验证得到PPT1是苯丙酮酸的作用靶点,在PPT1敲低后,NLRP3的棕榈酰化被上调,而且PPT1和NLRP3之间存在相互作用,证明PPT1是NLRP3蛋白的去棕榈酰化酶。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004247254390000011
    Figure HDA0004247254390000011
  • Figure HDA0004247254390000021
    Figure HDA0004247254390000021
  • Figure HDA0004247254390000031
    Figure HDA0004247254390000031
Patent Text Reader

Abstract

This invention belongs to the field of medical technology and discloses methods for promoting diabetic wound healing by targeting phenylpyruvate and inhibiting excessive activation of the NLRP3 inflammasome. Specifically, it discloses the application of PPT1 as a target of phenylpyruvate in screening drugs for the treatment or adjuvant treatment of diabetic foot ulcers. This invention verifies through LiP-Map and MST experiments that PPT1 is a target of phenylpyruvate. Knockdown of PPT1 upregulates palmitoylation of NLRP3, and an interaction exists between PPT1 and NLRP3, demonstrating that PPT1 is a depalmitoylater of the NLRP3 protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of medical technology, specifically involving targeting phenylpyruvate to promote diabetic wound healing and inhibiting the activation of excessive NLRP3 inflammasomes. Background Technology

[0002] Diabetic foot ulcer (DFU) is one of the most common and challenging chronic complications of diabetes, characterized by its long onset and difficult-to-treat nature. For decades, DFU has been a serious global health problem and remains a leading cause of non-traumatic lower limb loss. Furthermore, DFU is strongly associated with an increased risk of disability and death in diabetic patients, whose 5-year survival rate is worse than that of patients with the most common cancers. An exciting ongoing area of ​​research on DFUS focuses on the aberrant polarization of macrophages, which play a crucial role in the chronic inflammation of diabetic wounds. Specifically, impaired conversion from a pro-inflammatory phenotype to a pro-healing phenotype leads to the accumulation of inflammatory mediators and hinders the healing of diabetic wounds. Therefore, exploring the pathogenic factors of chronic inflammation in diabetic wounds is of significant scientific importance for providing new treatment methods for personalized prevention and treatment.

[0003] Nucleotide-binding oligomerized domain-like receptors (NLRs) are a family of domains containing three pyrrole rings (NLRP3). They interact with apoptosis-associated speckle-like adaptor proteins containing a cysteine ​​aspartate recruiting domain (ASC) and cysteine ​​aspartate aminotransferase-1 (caspase-1) to form an intracellular protein complex called the NLRP3 inflammasome. It acts as an innate immune trigger in the presence of sterile danger signals or certain microbial products, initiating an inflammatory response. When the inflammasome is activated, biologically active IL-1β and IL-18 are produced by cleavage of caspase-1 and then released into the microenvironment, enhancing the adaptive immune response. Chronic activation of the NLRP3 inflammasome highlights the pathogenesis of several autoinflammatory diseases, including rheumatoid arthritis and gout. New evidence suggests that elevated NLRP3 levels in diabetic patients contribute to chronic inflammation and oxidative stress, thereby impairing wound healing. Even so, further research is needed to fully understand the regulation of NLRP3 in diabetic wounds and to determine the optimal approach to treating this disease.

[0004] Cumulative research has shown that numerous metabolic disorders exist in diabetes and its complications, which may be caused by hyperglycemia or occur independently. Changes in the metabolome are considered to reflect molecular characteristics closest to an individual's phenotype because they integrate information from exogenous exposure as well as the genome, transcriptome, and proteome. Metabolic reprogramming is closely related to the regulation of adaptive immunity and inflammation. For example, α-ketoglutarate (αKG), produced from glutamine breakdown, coordinates macrophage activation through metabolic and epigenetic reprogramming of the Jmjd3-dependent M2 gene. Itaconic acid and its derivatives attenuate macrophage alternating activation by directly modifying cysteine ​​residues on JAK1 and inhibiting its phosphorylation. However, how metabolic perturbations in DFU regulate runaway local adaptive inflammatory responses remains unclear. Summary of the Invention

[0005] The first aspect of this invention aims to provide the application of PPT1 as a target of phenylpyruvic acid in screening drugs for the treatment or adjuvant treatment of diabetic foot ulcers.

[0006] The second aspect of the present invention is to provide the application of PPT1 accelerator.

[0007] A third aspect of the present invention aims to provide a nucleic acid molecule encoding a PPT1 protein with a phenylpyruvate binding site defect containing K229N and G245A.

[0008] The fourth aspect of this invention aims to provide biomaterials related to nucleic acid molecules in the third aspect of this invention.

[0009] The fifth aspect of this invention aims to provide the application of nucleic acid molecules of the third aspect of this invention and / or biological materials of the fourth aspect of this invention.

[0010] The sixth aspect of this invention aims to provide a product.

[0011] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0012] The first aspect of this invention is to provide the use of PPT1 as a target of phenylpyruvic acid in screening drugs for the treatment or adjuvant treatment of diabetic foot ulcers.

[0013] Preferably, the drug can promote the healing of diabetic wounds and / or inhibit the activation of excessive NLRP3 inflammasomes.

[0014] A second aspect of the present invention is to provide the use of any one of the PPT1 accelerators (1) to (5):

[0015] (1) Preparation of a product for inhibiting NLRP3 palmitoylation;

[0016] (2) Inhibit the upregulation of NLRP3 expression;

[0017] (3) Prepare products for inhibiting the upregulation of NLRP3 expression;

[0018] (4) Reduces the stability of NLRP3 protein;

[0019] (5) Prepare products that reduce the stability of NLRP3 protein.

[0020] Preferably, the NLRP3 palmitoylation, NLRP3 expression upregulation, M1 characteristic gene upregulation, and increased secretion of IL-1β, IL-18, and tumor necrosis factor α are all induced by phenylpyruvate.

[0021] Preferably, the PPT1 promoter is at least one of the following: substances that increase PPT1 activity, substances that generate PPT1, and substances that improve PPT1 expression levels.

[0022] A third aspect of the present invention is to provide a nucleic acid molecule encoding a PPT1 protein with a phenylpyruvate binding site defect containing K229N and G245A, the nucleotide sequence of said nucleic acid molecule being shown in SEQ ID NO:27.

[0023] The nucleotide sequence is as follows:

[0024] atggcgtcgtcctgttcgcggaggctgctagctgccgctctgctgccttggtgctgcgccgcctgggccctggggcatctggacccaccttcaccaccaccgctggtgatctggcatgggatgggggacagctgttgtaaccccatgagcatgggtgtcattaaaaagatggttgaaaaagaaatacctgggatttacgtcctgtctctagagattgggaagaacatgatggaggatgtggagaacagcttcttcttgaatgttaatgtccaagtcaacatggtgtgtcagattctggaaaaggatcctaagttgcagcagggatacaatgctattggcttctcccagggaggccagttcctgagggcagtggctcagagatgcccaacacctcccatgatgaccctgatctcagttggaggacaacatcaaggtgtctttggactcccccgatgcccaggagagagttctcacatctgcgacttcatcaggaagtcacttaatgccggtgcttactccaaacttgtgcaagaacgcctggtgcaagcacagtactggcatgaccctatcaaggagagtgtgtaccgaaactacagcatcttcttggcagacataaatcaagagaggtgtgtcaatgagtcctacaagaagaacctgatggccctcaagaagtttgtgatggtgaaCttctttaatgattccattgtggaccctgtcgactctgagtggtttgCattttacagaagtggccaagctaaggaaaccattcccctccaggagagcactctatacacagaggaccgcctggggctaaagaaaatggacaaagcaggaaagctagtgtttctggctaaggaaggggaccatcttcaaatatctaaagaatggtttactgcccacatcataccttttcttaag(SEQ ID NO:27)。

[0025] A fourth aspect of the present invention is to provide a biological material related to the nucleic acid molecule of the third aspect of the present invention; said biological material is any one of (a1) to (a3):

[0026] (a1) An expression cassette containing the nucleic acid molecule of the third aspect of the present invention;

[0027] (a2) A vector containing the nucleic acid molecule of the third aspect of the present invention or the expression cassette of (a1);

[0028] (a3) A cell line containing the nucleic acid molecule of the third aspect of the present invention, the expression cassette of (a1) or the vector of (a2).

[0029] Preferably, the vector is a plasmid vector, a viral vector, or a cell vector.

[0030] Preferably, the plasmid vector can be an optional plasmid, the viral vector can be an optional virus, and the cell vector does not include propagation material.

[0031] Preferably, the carrier containing the nucleic acid molecule of the third aspect of the present invention is pIRES2-Flag-PPT1-MUT, the nucleotide sequence of which is shown in SEQ ID NO:26.

[0032] A fifth aspect of the present invention is to provide the use of the nucleic acid molecule of the third aspect of the present invention and / or the biological material of the fourth aspect of the present invention in any one of (b1) to (b9):

[0033] (b1) Preparation of drugs to promote wound healing in diabetic patients;

[0034] (b2) Inhibit excessive activation of the NLRP3 inflammasome;

[0035] (b3) Prepare products that inhibit the activation of excessive NLRP3 inflammasomes;

[0036] (b4) Inhibit phenylpyruvic acid-induced NLRP3 expression levels;

[0037] (b5) Prepare a product for inhibiting phenylpyruvate-induced NLRP3 expression levels;

[0038] (b6) Inhibits the secretion of phenylpyruvate-induced inflammatory factors IL1β, IL18 and TNFα;

[0039] (b7) Prepare products for inhibiting the secretion of phenylpyruvate-induced inflammatory factors IL1β, IL18 and TNFα;

[0040] (b8) Inhibits phenylpyruvate-induced upregulation of M1 characteristic genes;

[0041] (b9) Prepare a product for inhibiting the upregulation of the M1 characteristic gene induced by phenylpyruvate.

[0042] Preferably, the M1 characteristic genes include Nos, Tnf, and Il6.

[0043] A sixth aspect of the present invention is to provide a product comprising the nucleic acid molecule of the third aspect of the present invention and / or the biological material of the fourth aspect of the present invention.

[0044] The beneficial effects of this invention are:

[0045] This invention verifies through experiments such as LiP-Map and MST that PPT1 is the target of phenylpyruvate. After PPT1 is knocked down, palmitoylation of NLRP3 is upregulated, and there is an interaction between PPT1 and NLRP3, proving that PPT1 is the depalmitoylate of NLRP3 protein.

[0046] Given the spatial conformational similarity between the binding site and the active site, phenylpyruvate treatment can significantly reduce the activity of PPT1 palmitoyl-CoA hydrolase. Experiments show that after mutation of the PPT1 binding site, the mutant PPT1 reverses the phenylpyruvate-mediated upregulation of NLRP3 expression and the phenylpyruvate-induced increase in NLRP3 protein palmitoylation. Attached Figure Description

[0047] Figure 1To identify potential phenylpyruvate targets in macrophages using LiP-SMap; A is a flowchart of the LiP-SMap assay; B is a rose diagram reflecting the proportion of differentially expressed peptide-dependent proteins mapped to each subcellular location; C is a bubble diagram of KEGG pathway enrichment analysis, with the x-axis representing enrichment values ​​and the y-axis representing enriched KEGG pathways. Larger circles indicate greater enrichment of differentially expressed peptide-dependent proteins in the pathway, and the color of the circle represents the p-value; D is a dot plot showing differentially expressed proteins mapped in the lysosomal pathway, where changes greater than or less than 1 indicate potential interactions between proteins and metabolites; E is the results of Western blot analysis of NLRP3 expression levels in BMDM with knockdown of PPT1, M6pr, and Psap; F is a graph showing the results of cell heat transfer analysis and statistical analysis of PPT1 in BMDM with and without phenylpyruvate treatment; G is a graph showing phenylpyruvate and PPT1 WT protein or PPT1 The results of micro-thermophoresis analysis of MUT protein binding; H is a representative image of phenylpyruvate automatically docking to the PPT1 protein backbone structure; I is a representative image of phenylpyruvate automatically docking to the PPT1 protein signal domain; J is a statistical graph of PPT1 enzyme activity measurement results; K is a graph of immunoblotting analysis results of BMDMs treated with phenylpyruvate and transfected with PPT1 WT plasmid or PPT1 MUT plasmid for 24 h; in the figure, * represents P<0.05, and ** represents P<0.01.

[0048] Figure 2 This image shows the identification of PPT1 as a target of phenylpyruvate. A shows the immunostaining and statistical analysis results of LysoTracker in phenylpyruvate-treated BMDMs (scale bar: 10 μm); B shows the immunostaining and statistical analysis results of LysoSensor in phenylpyruvate-treated BMDMs (scale bar: 10 μm); C shows the mRNA expression levels of PSAP, M6PR, and PPT1 in BMDMs detected by RT-qPCR; D shows the immunoblotting results of PSAP, M6PR, and PPT1 mRNA expression in BMDMs; E shows the expression level of Nlrp3 mRNA in BMDMs after PPT1 knockdown detected by RT-qPCR; F shows a schematic diagram of the PPT1 protein structure; G shows a schematic diagram of mutations at the binding site between PPT1 and phenylpyruvate; H shows PPT1 co-cultured with increased phenylpyruvate concentrations. Figure 1 shows the results of enzyme activity assay of MUT protein; I represents the mRNA expression level of PPT1 in BMDM treated with different concentrations of phenylpyruvate by RT-qPCR; J represents the results of immunoblotting analysis of PPT1 expression in BMDM treated with different concentrations of phenylpyruvate; in the figure, * represents P<0.05, ** represents P<0.01, and ns represents no significant difference.

[0049] Figure 3This diagram illustrates how phenylpyruvate upregulates NLRP3 palmitoylation by binding to PPT1 protein. A shows a schematic diagram of the full-length NLRP3 structure and the location of palmitoylation sites; B shows the immunoblotting results of NLRP3 palmitoylation in BMDM with and without palmitate treatment; C shows the immunoblotting and statistical analysis results of NLRP3 expression in BMDM; D shows the immunoblotting and statistical analysis results of NLRP3 expression in BMDM treated with 2BP; E shows the immunostaining images of LAMP1 (representing lysosomes), PPT1, and NLRP3 locations in macrophages, with cell nuclei stained with Hoechst dye (scale bar: 10 μm); F shows the detection of endogenous NLRP3 and PPT1 in macrophages. 1. Immunoprecipitation and immunoblotting results associated with PPT1 in macrophages; G. Immunoprecipitation and immunoblotting results associated with PPT1 in macrophages; H. ABE assay and immunoblotting results of NLRP3 palmitoylation in PPT1-knockdown BMDM; I. ABE assay and immunoblotting analysis of palmitoylation levels in NLRP3 mutants, with or without PPT1 knockdown, used to transfect mouse embryonic fibroblasts (MEFs) with wild-type NLRP3 protein or NLRP3 mutants for 24 h; J. ABE assay and immunoblotting analysis used to determine NLRP3 palmitoylation levels in BMDM treated with increased phenylpyruvate concentrations; K. Treatment with phenylpyruvate followed by PPT1... Figure 1 shows the ABE assay and Western blot analysis results of NLRP3 palmitoylation level in BMDMs transfected with WT plasmid or PPT1 MUT plasmid for 24 h; L represents the ABE assay and Western blot analysis results of NLRP3 expression level in BMDMs after treatment with 400 μM phenylpyruvate, with or without 100 μM 2BP, and with or without PPT1 MUT plasmid transfection; in the figure, * represents P<0.05, ** represents P<0.01, and ns represents no significant difference.

[0050] Figure 4 This section describes the identification of NLRP3 palmitoylation sites. A shows the alignment results of NLRP3 sequences containing predicted palmitoylation sites across different species. B is a schematic diagram of the general procedure for ABE palmitoylation assay. C shows the ABE assay and immunoblotting results of palmitoylation levels in NLRP3 mutants transfected with wild-type NLRP3 or NLRP3 mutants for 24 hours, with or without PPT1 knockdown. In the figures, * represents P < 0.05, ** represents P < 0.01, and ns represents no significant difference.

[0051] Figure 5Phenylerulic acid increases NLRP3 protein stability and promotes inflammasome activation; Figure A shows the immunoblotting and statistical analysis results of NLRP3 protein stability in cells; Figure B shows the immunoblotting analysis results of NLRP3 protein levels in BMDM; Figure C shows the presence of NLRP3 in different species. Alignment of palmitoylation sites in the pyrin domain; D shows the results of immunoprecipitation and immunoblotting analysis of NLRP3 and ASC; E shows the immunofluorescence of ASC in BMDM, scale bar: 50 μm; F shows the results of immunoblotting analysis of supernatant and cell extract in BMDM; G shows the results of ELISA measurement of the level of inflammatory factor IL1β in the supernatant; H shows the results of ELISA measurement of the level of inflammatory factor IL18 in the supernatant; I shows the results of ELISA measurement of the level of inflammatory factor TNFα in the supernatant; J shows the results of RT-qPCR detection of the relative mRNA expression level of Nos in the supernatant; K shows the results of RT-qPCR detection of the relative mRNA expression level of Tnf in the supernatant; L shows the results of RT-qPCR detection of the relative mRNA expression level of Il6 in the supernatant, with ACTB as the reference gene; In the figures, * represents P<0.05, ** represents P<0.01, and ns represents no significant difference. Detailed Implementation

[0052] The present invention will now be described in detail with reference to specific embodiments, but this does not limit the scope of the invention.

[0053] Unless otherwise specified, the materials and reagents used in this embodiment are commercially available.

[0054] Example 1

[0055] The antibody used in this invention:

[0056] NLRP3(for immunblot)(Cell Signaling Technology,Cat#15101);ASC(CellSignaling Technology,Cat#67824);Cleaved-IL-1β(Cell Signaling Technology,Cat#63124);IL-1β(Cell Signaling Technology,Cat#31202);Cleaved Caspase-1(CellSignaling Technology,Cat#89332);Caspase-1(Cell Signaling Technology,Cat#24232);β-Actin(Cell Signaling Technology,Cat#3700);GAPDH(Cell SignalingTechnology,Cat#5174);PPT1(Proteintech,Cat#29653-1-AP);Anti-DDDDK tag(Abcam,Cat#ab205606);M6PR(Abcam,Cat#ab124767);PSAP(Abcam,Cat#ab300469);HSC70(Proteintech,Cat#10654-1-AP);Anti-Rabbit IgG(H+L),HRP Conjugate(Promega,Cat#W4011);Anti-Mouse IgG(H+L),HRP Conjugate(Promega,Cat#W4021);APC anti-mouseCD86,clone GL-1(Biolegend,Cat#105012);PE anti-mouse CD163,clone S15049F(Biolegend,Cat#156704);APC anti-mouse CD36,clone HM36(Biolegend,Cat#102611);Brilliant Violet 421 TM anti-mouse F4 / 80,clone BM8(Biolegend,Cat#123137);APCanti-mouse / human CD11b,clone M1 / 70(Biolegend,Cat#101212);TruStain FcX TM(anti-mouse CD16 / 32), clone 93 (Biolegend, Cat#101319); PE anti-mouse CD163, cloneS15049F (Biolegend, Cat#156704); Anti-F4 / 80Rabbit pAb (Servicebio, Cat#GB11027); Anti-Mannose Receptor / CD206 Rabbit pAb (Servicebio, Cat#GB113497); NLRP3 (for IHCstaining, Affinity, Cat#DF7438); NOS (D6B6S) Rabbit mAb (Cell Signaling Technology, Cat#13120), CD206 / MRC1 (E6T5J) Rabbit mAb (Cell Signaling Technology, Cat#24595); Cholera Toxin Subunit B (Recombinant), Alexa Fluor TM 555Conjugate (ThermoFisher Scientific, Cat#C22843); Hoechst 33342Solution (Thermo Fisher Scientific, Cat#62249); Lyso-Tracker Red (Beyotime, C1046); LysoSensor TM Green DND-189 (Yeasen, Cat#40767ES50); ABflo TM 555-conjugated Goat Anti-Mouse IgG (H+L) (Abclonal, Cat#AS057); Alexa Fluor 647-conjugated Goat Anti-Rabbit IgG (H+L) (Abclonal, Cat#AS060).

[0057] Primer sequence information:

[0058] Table 1 Primer sequences used in this invention

[0059] Nos2-F GTTCTCAGCCCAACAATACAAGA(SEQ ID NO:1) Nos2-R GTGGACGGGTCGATGTCAC(SEQ ID NO:2) Tnf-F CAGGCGGTGCCTATGTCTC(SEQ ID NO:3) Tnf-R CGATCACCCCGAAGTTCAGTAG(SEQ ID NO:4) Il6-F CTGCAAGAGACTTCCATCCAG(SEQ ID NO:5) Il6-R AGTGGTATAGACAGGTCTGTTGG(SEQ ID NO:6) Nlrp3-F ATTACCCGCCCGAGAAAGG(SEQ ID NO:7) Nlrp3-R CATGAGTGTGGCTAGATCCAAG(SEQ ID NO:8) Psap-F CCTGTCCAAGACCCGAAGAC(SEQ ID NO:9) Psap-R AAGGAAGGGATTTCGCTGTGG(SEQ ID NO:10) M6pr-F TGCTGGAGGACTGAACTGTTA(SEQ ID NO:11) M6pr-R GAGCCACCTCGTTCTTTGACT(SEQ ID NO:12) Ppt1-F TACCTGGGATTTACGTCCTGT(SEQ ID NO:13) Ppt1-R TGACACACCATGTTGACTTGG(SEQ ID NO:14) Lrp1-F CCACTATGGATGCCCCTAAAAC(SEQ ID NO:15) Lrp1-R GCAATCTCTTTCACCGTCACA(SEQ ID NO:16) Actb-F GTGACGTTGACATCCGTAAAGA(SEQ ID NO:17) Actb-R GCCGGACTCATCGTACTCC(SEQ ID NO:18)

[0060] Experimental methods:

[0061] Isolation and cell culture of mouse BMDMs: BMDMs (bone marrow-derived macrophages) were obtained from 8-week-old female BKS-DB mice and flushed through the femur and tibia into DMEM using a 25-gauge needle. The cell suspension was filtered through a 70 μm cell filter and centrifuged at 1000 rpm for 5 min. The cell particles were then resuspended in erythrocyte lysis buffer (Beyotime, China) for 3 min. After centrifugation and resuspending, the cells were cultured in DMEM containing 1% L-glutamine, 30 mM glucose, 10% fetal bovine serum (FBS, Gibco), 1% penicillin-streptomycin (Sigma-Aldrich), and 20 ng / mL macrophage colony-stimulating factor (PeproTech). On day 3, half of the medium was replaced, and on day 5, all medium was replaced with fresh medium. The cells were used for various experiments on day 7. Mouse embryonic fibroblasts (MEFs) were cultured in DMEM containing 30 mM glucose, 10% FBS, and 1% penicillin-streptomycin. All cells were cultured in an incubator at 37°C and 5% carbon dioxide.

[0062] Immunofluorescence staining: BMDMs were incubated on a 35 μm confocal disc and stimulated with the specified reagents. Cells were washed with PBS, fixed with 4% paraformaldehyde for 15 min, and then permeabilized with 0.3% Triton X-100 for 10 min at room temperature. After washing three times with PBS, cells were blocked with 6% fetal goat serum (Solarbio) for 1 h, followed by incubation with the corresponding primary antibody and subsequently fluorescently labeled secondary antibody. Confocal images were observed using a confocal microscope (Zeiss LSM880). Images were analyzed using Zen 2.6 or ImageJ software.

[0063] RT-qPCR: Total RNA was extracted from BMDM using TRIzol reagent (Invitrogen), and cDNA was obtained by reverse transcription using a cDNA synthesis kit (Vazyme, R111). Finally, RT-qPCR was performed using an ABI 7900HT rapid real-time PCR system (Applied Biosystems, CA, USA) and a real-time quantitative PCR kit (Vazyme, Q321). -△△Ct The method calculates the relative mRNA expression level.

[0064] Immunoprecipitation and immunoblotting: The treated whole-cell extract was incubated overnight with Protein A / G beads (Pierce), pretreated with the specified antibody or rabbit IgG for 3 h, and gently shaken at 4 °C; the beads were washed 5 times on ice and boiled in sample buffer for SDS-PAGE; the proteins were separated and transferred to a PVDF membrane (Merck Millipore) and stored at 350 mA and 4 °C for 1 h; after blocking, the membrane was incubated overnight at 4 °C with an appropriate primary antibody, and then incubated at room temperature for 1 h with an HRP-bound secondary antibody; the ECL detection reagent (EpiZyme) was used for protein detection in a MiniChrome Chemiluminescence imaging system (SAGECREATION, Beijing).

[0065] The thermal shift assay (refer to Peng L, et al. A cellular thermal shift assay for detecting amino acid sites involved in drug target engagement. STAR Protococ. 2022.3, 101423) was performed as follows: First, BMDMs were treated with phenylpyruvic acid or dimethyl sulfoxide (DMSO, as a control group); second, intact cell suspensions were harvested and heated for 3 min at various temperatures: 37°C, 42°C, 47°C, 52°C, 57°C, and 62°C; finally, protein extraction was performed, and protein expression was assessed by immunoblotting analysis.

[0066] Micro-thermophoresis (MST): PPT1 protein was used as the target and labeled according to the instructions of the Monolith protein labeling kit RED-NHS second generation kit. After labeling, preliminary experiments were performed to evaluate the labeling effect. If no protein adsorption and aggregation occurred after the preliminary experiments and the signal-to-noise ratio met the requirements, binding affinity was tested. 10 μL of serially diluted unlabeled molecule (phenylpyruvic acid) and 10 μL of a fixed concentration of labeled molecule (PPT1 protein) were incubated for 5 min. The mixed sample was loaded into a glass capillary tube and analyzed using an MST-NT.115 instrument.

[0067] The activity assay of PPT1 (refer to van Diggelen OP, et al. A rapid fluorogenic palmoyl-protein thioesterase assay: pre-and postnatal diagnosis of INCL. MolGenet Metab. 1999. 66, 240-244): The assay is roughly as follows: palmitate ester linked to 4-methylumbelliferone-6-thio-β-d-glucoside (MU-6S-Palm-βGlc, MedBio) is selected as the substrate. PPT1 cleaves the thioester bond, releasing the intermediate 4-methylumbelliferone-6-thio-β-d-glucopyranoside and palmitic acid. This intermediate is further hydrolyzed to 4-methylumbelliferone by exogenous amygdalin β-glucosidase (Sigma). The fluorescence of this intermediate is measured to quantify the cleavage of the palmitate ester group by PPT1.

[0068] Plasmid transfection: The expression vector pIRES2-Flag-PPT1, which encodes the full-length mouse PPT1 protein (PPT1 WT, whose nucleotide sequence is shown in SEQ ID NO:25), and the expression vector pIRES2-Flag-PPT1-MUT, which encodes the PPT1 protein with K229N and G245A phenylpyruvate binding site defects (PPT1-MUT, whose nucleotide sequence is shown in SEQ ID NO:26), were prepared by Umine Biotechnology Co., Ltd. (Guangzhou, China). According to the instructions, the above plasmid DNA was transiently transfected into serum-free BMDM cells cultured in Opti-MEM using Lipofectamine 2000 (Invitrogen) (80-90%).

[0069] Acyl-Biotin Exchange (ABE) Assay: ABE was determined using the IP-ABE Palmitoylation Kit (AIMS, China). The procedure generally included blockade, reduction, labeling, elution, and detection. BMDM cells were collected, suspended in lysis buffer, and incubated overnight at 4°C with anti-NLRP3 beads. Unmodified cysteine ​​residues were blocked with Nethylmaleimide (NEM) for 30 min. The beads were then washed and incubated with hydroxylamine (HAM) at room temperature for 1 h. Each group was divided into two parts, including a HAM step (+HAM) and an omitted HAM lysis step (-HAM). After washing, the samples were treated with thiol-active biotin molecules at room temperature for 1 h. Immunoprecipitated samples were analyzed using Western blotting.

[0070] Example 2

[0071] In their previous metabolomics analysis, the inventors discovered that phenylpyruvate (PKA) significantly accumulated in DFU wounds, which was positively correlated with the level of the inflammatory protein NLRP3. Furthermore, experiments showed that PKA can enter macrophages and promote a pro-inflammatory phenotype. To determine the molecular mechanism by which PKA regulates macrophage phenotype, the inventors employed a chemical proteomics screening process following the LIP-Small Molecule Mapping (LIP-SMAP) workflow, using BMDM cell lysates (obtained using cell protein lysis buffer) to explore cellular proteins that may bind to PKA. Figure 1 (A) Specifically: From three independently obtained replicates of cell lysates, equal amounts of 100 mg proteome samples were taken and incubated with phenylpyruvate (final concentration: 0.33 nM per microgram of total protein) at 25 °C for 10 min. Proteinase K (Tritirachium album) was simultaneously added to all proteome-phenylpyruvate samples at a proteinase K:substrate mass ratio of 1:100, and incubated at 25 °C for 5 min. The samples were then heated at 98 °C for 5 min in a thermal cycler, followed by the addition of sodium deoxycholate to a final concentration of 2%, stopping the digestion reaction. Protein fragments cleaved by proteinase K were reduced with 10 mM DTT at 37 °C for 30 min, followed by alkylation with 40 mM iodoacetamide in the dark at 25 °C for 45 min. The samples were then digested with trypsin at 37 °C and 800 rpm with an enzyme-substrate ratio of 1:50. Digestion was stopped, and DOC was precipitated by adding 50% TFA solution. The pH of the sample was adjusted to less than 3 using formic acid. The acidified peptide mixture was packed into a Sep-Pak C18 column, desalted, and eluted with 70% acetonitrile-0.1% formic acid. The sample was dried in a vacuum centrifuge, dissolved in 0.1% formic acid, and immediately analyzed by mass spectrometry.

[0072] The results showed that a total of 193 proteins were obtained. Among the structural changes induced by phenylpyruvate binding, the abundance of haptenase peptides changed significantly (folding change ≤0.5 or ≥2, P <0.05). Further bioinformatics analysis indicated that most of these proteins were located in the cytoplasm. Figure 1 (B), which is consistent with the inventors' previous tracing results. KEGG analysis of the obtained protein showed that the lysosomal pathway was the most abundant metabolic pathway. Figure 1 Previous studies have shown that damage to lysosomes, leading to the release of their contents, can activate the NLRP3 inflammasome. The inventors then explored whether phenylpyruvate could damage lysosomes to activate the NLRP3 inflammasome. The results showed that phenylpyruvate (… Figure 2The staining of LysoTracker (a reagent for identifying lysosomal compartments) and LysoSensor (a reagent for indicating lysosomal pH) in samples A and B showed no significant changes, indicating that phenylpyruvic acid has little effect on lysosomes.

[0073] The inventors further investigated the three most prominent proteins in the lysosomal pathway (PPT1, M6pr, and PSAP). Figure 1 (D). Small interfering RNA (siRNA) was used to knock down the corresponding PPT1, M6pr, and PSAP targets. Figure 2 The siRNA oligonucleotides (see Table 2 for corresponding sequences) were synthesized by GenePharma Co., Ltd. (Suzhou, China). siRNA (50 nM) was mixed with 5 μL of Lipofectamine RNAi Max transfection reagent (Invitrogen), followed by the addition of 100 μL of Opti-MEM (ThermoFisher Scientific) and incubation for 20 min. The prepared mixture was then added to 6-well plates containing BMDM cells and cultured. The expression of Psap, M6pr, and PPT1 mRNA in BMDM cells was detected using RT-qPCR and Western blotting.

[0074] Table 2 siRNA oligonucleotide sequence information

[0075] siPPT1-1 GUUGCAGCAGGGAUACAAUTT(SEQ ID NO:19) siPPT1-2 GUGCUUACUCCAAACUUGUTT(SEQ ID NO:20) siM6PR-1 CUGAACUGUUAUUGUUGCUTT(SEQ ID NO:21) siM6PR-2 GGAGAAUCAACGAGACUCATT(SEQ ID NO:22) siPSAP-1 GUCCAAGACCCGAAGACAUTT(SEQ ID NO:23) siPSAP-2 GAACUUGCCUGAAAGAUAAUTT(SEQ ID NO:24)

[0076] The results showed that NLRP3 protein levels only increased significantly after PPT1 was knocked down, while knockdown of other proteins did not lead to changes in NLRP3 expression. Figure 1 (E). However, the mRNA level of NLRP3 did not change after PPT1 gene knockdown. Figure 2 (E). These data suggest that the PPT1 protein may be a potential target for mediating the effects of phenylpyruvate on macrophage polarization.

[0077] To verify the binding of phenylpyruvate to PPT1, a thermal displacement experiment was performed. The results showed that phenylpyruvate treatment significantly altered the stability of the PPT1 protein after heating. Figure 1 (F). The inventors then performed micro-thermophoresis (MST) on a series of dilutions of PPT1 protein and phenylpyruvate. The results showed that, as expected, phenylpyruvate readily binds to PPT1 protein. The dissociation constant (Kd) of phenylpyruvate / PPT1 in the MST analysis was 863.09 μM, indicating an interaction between phenylpyruvate and PPT1. Figure 1 (G).

[0078] PPT1 consists of a signal domain and a main chain structure, with three essential sites, including S115, D233, and H289, which are the basis for its palmitoyl-CoA hydrolase activity. Figure 2 To assess the precise binding site of phenylpyruvate on PPT1, the inventors performed molecular docking using Autodock to calculate the interaction between phenylpyruvate and PPT1, detecting possible binding modes on the two domains of PPT1. Specifically, the crystal structure of PPT1 was obtained from UniProt (https: / / www.uniprot.org / ), and Autodock (https: / / autodock.scripps.edu / ) was used to induce fitting docking at each potential binding site of phenylpyruvate on PPT1. Based on the docking data, the optimal docking configuration, binding energy, potential conformation, type of interaction, and bond distance were predicted. The lowest-energy binding configuration in the docking data was selected as the representative binding configuration for further analysis. The results showed that the predicted binding mode of phenylpyruvate to the main chain structure exhibited a suitable shape match, and the residues Lys229 and Gly245 of PPT1 formed hydrogen bonds with phenylpyruvate. Figure 1 (H); the predicted binding mode with the signal domain involves hydrogen bonds between phenylpyruvic acid and residue Arg8. Figure 1 (I). Clearly, phenylpyruvic acid is more suitable for the binding pocket of the former, because the former's docking energy (-5 kcal / M) is significantly lower than the latter's (-3.39 kcal / M).

[0079] Since the binding modes of Lys229 and Gly245 residues are adjacent to the catalytic site D233, it was further investigated whether phenylpyruvic acid would affect the activity of PPT1. The results, obtained by measuring the activity of PPT1, showed that, as expected, the activity of PPT1 significantly decreased after treatment with phenylpyruvic acid. Figure 1 (J). The inventors constructed a PPT1 mutant with a mutation at the phenylpyruvate binding site (J). Figure 2 (G), no binding of phenylpyruvate to the PPT1 mutant protein was detected. Figure 1 (G). Furthermore, it was found that phenylpyruvic acid did not affect the activity of the PPT1 mutant (G). Figure 2 (H). Furthermore, PPT1 MUT plasmid transfection reversed the phenylpyruvate exposure-induced increase in NLRP3 protein levels, while the PPT1 WT transfection group did not. Figure 1 (K). It was also found that treatment of BMDM with phenylpyruvic acid had no effect on the mRNA and protein levels of PPT1. Figure 2 (I and J). In summary, phenylpyruvate binds to and inhibits PPT1 protein activity, thereby mediating phenylpyruvate-induced upregulation of NLRP3 expression.

[0080] Example 3: Phenylacetic acid regulates NLRP3 palmitoylation by binding to PPT1 protein.

[0081] PPT1, a thioesterase, removes palmitic acid from S-acylated proteins, essential for dynamic palmitoylation. Since phenylpyruvate has been shown to inhibit PPT1 activity, this study further investigated whether phenylpyruvate regulates palmitoylation of NLRP3. To explore the role of palmitoylation on NLRP3, palmitoylation sites on NLRP3 were first predicted using the online software Css-Palm (http: / / csspalm.biocuckoo.org / ). The results showed that several highly conserved palmitoylation sites on NLRP3 exist across different species. Figure 3 China A and Figure 4 (A). In BMDM cells, ABE was determined using the IP-ABE palmitoylation kit (AIMS, China) according to the manufacturer's instructions. Figure 4 (B). The results showed that NLRP3 is palmitoylated ( Figure 3 (B) Since S-palmitoylation can control protein stability and transport, BMDM cells were subsequently treated with different concentrations (0, 50, 100, and 150 μM) of the S-palmitoylation inhibitor 2-bromopalmitate (2BP) for 24 h, and with 100 μM 2BP for 0, 8, 16, and 24 h, respectively, to investigate whether palmitoylation affects NLRP3 protein levels. The results showed that 2BP reduced NLRP3 protein levels in a dose- and time-dependent manner. Figure 3 (C and D in the middle).

[0082] PPT1 was initially described as being located within the lysosomal lumen, but recent studies have shown that its biological function is related to its extralysosomal location. To further investigate whether PPT1 can regulate NLRP3 palmitoylation, the inventors performed immunofluorescence staining on the locations of LAMP1 (representing lysosomes), PPT1, and NLRP3 in macrophages, with the cell nuclei stained with Hoechst dye. The immunofluorescence staining results showed that PPT1 and NLRP3 have common localizations both within the lysosomal lumen and in extralysosomal regions. Figure 3 (E). Furthermore, immunoprecipitation (IP) and Western blot analysis were used to detect the association between endogenous NLRP3 and PPT1 in macrophages. The immunoprecipitation assay demonstrated an interaction between PPT1 and NLRP3. Figure 3 (F and G). ABE and immunoblotting were used to analyze NLRP3 palmitoylation in PPTI-knockdown BMDM, revealing that PPT1 deficiency increased NLRP3 palmitoylation (F and G). Figure 3 (H).

[0083] Based on predictive analysis of palmitoylation sites, cysteine ​​residues at positions 6, 405, 783, 784, 834, 835, 840, and 841 of NLRP3 were identified as potential palmitoylation sites, which are conserved in other species. Consistent with the highest predicted score for cysteine ​​residue C6, the C6A mutation in NLRP3 largely cancels its palmitoylation, and PPT1 deficiency no longer increases its palmitoylation, indicating that C6 is the major palmitoylation site of NLRP3. Figure 3 I and Figure 4 (C). Subsequently, it was found that phenylpyruvic acid treatment could increase the palmitoylation of NLRP3 (C). Figure 3 (J). Furthermore, BMDM was treated with 400 μM phenylpyruvate and transfected with PPT1 WT or PPT1 MUT plasmids for 24 h. ABE assay and Western blotting were used to analyze the NLRP3 palmitoylation level in BMDM. The results showed that PPT1 MUT plasmid transfection reversed the phenylpyruvate-induced increase in NLRP3 palmitoylation, while PPT1 WT transfection could not reverse the increase in NLRP3 palmitoylation. Figure 3 (K). Furthermore, BMDMs were treated sequentially with 400 μM phenylpyruvate, 100 or 0 μM 2BP, and then transfected with PPT1 MUT plasmid (with a control of no transfection). ABE assay and Western blot analysis were used to determine the NLRP3 palmitoylation level in the specified cells. The results showed that phenylpyruvate treatment did not increase NLRP3 expression levels in the presence of 2BP, which prevents palmitoylation. Figure 3 (Middle L).

[0084] In summary, phenylpyruvic acid can increase palmitoylation of NLRP3 by binding to and inhibiting PPT1 activity.

[0085] Example 4: Phenyruvate stabilizes NLRP3 protein and promotes inflammasome activation to trigger a pro-inflammatory macrophage phenotype.

[0086] Previous studies have shown that S-palmitoylation is essential for the protein stability of immune effectors, such as NOD2 and PD-L1. Therefore, this study investigated whether the increased level of phenylpyruvate-induced NLRP3 palmitoylation affects its protein stability.

[0087] BMDMs were treated with CHX (100 μg / mL) for 0, 3, 6, and 9 h, and then collected for Western blot analysis. The results showed that phenylpyruvate treatment significantly improved the protein stability of NLRP3, while transfection with the PPT1 WUT plasmid decreased its stability. Figure 5Previous studies have shown that NLRP3 protein is mainly degraded via the proteasome and lysosome pathways. To determine which degradation pathway of NLRP3 is primarily regulated by palmitoylation modification, the inventors investigated whether the degradation of NLRP3 under phenylpyruvate treatment could be blocked by inhibitors of the proteasome or autophagy degradation pathways. BMDM was treated with the proteasome inhibitor MG132 (10 μM), carfilzomib (100 nM), or the autophagy and autolysosome inhibitors Baf A1 (0.2 μM) or CQ (50 μM) for 8 h. Immunoblotting analysis of NLRP3 protein levels in BMDM showed that the degradation of NLRP3 under phenylpyruvate treatment could be blocked by the autophagy and autolysosome inhibitors Baf A1 (Baf A1) and chloroquine (CQ), but not by the proteasome inhibitors MG132 and carfilzomib (CARF). This indicates that phenylpyruvate treatment can prevent the autophagic degradation of NLRP3. Figure 5 (B)

[0088] Based on the above findings, the 6th cysteine ​​residue at the palmitoylation site of NLRP3 is located in its pyrin domain, which is the binding region of the adaptor protein ASC. This cysteine ​​residue is highly conserved across different species. Figure 5 (C). Given that S-palmitoylation also regulates protein-protein interactions, the inventors treated BMDM cells with 400 μM phenylpyruvate for 4 h, followed by 100 ng / mL LPS for 24 h, and then stimulated with 3 mM ATP for 45 min. Cell lysates were collected for immunoprecipitation and Western blot analysis to determine the interaction between NLRP3 and ASC. The results showed that phenylpyruvate treatment enhanced the interaction between NLRP3 and ASC. Figure 5 In addition, the formation of ASC spots increased significantly after phenylpyruvate treatment, indicating that phenylpyruvate is beneficial to the activation of NLRP3 inflammasome in BMDM induced by ATP treatment. Figure 5 (E).

[0089] BMDM cells were treated with 400 μM phenylpyruvate for 4 h, followed by 100 ng / mL LLPs for 24 h. After transfection with either the PPT1 WT plasmid or the MUT plasmid, the cells were stimulated with 3 mM ATP for 45 min. Immunoblot analysis was performed on the supernatant and cell extracts. ELISA was used to measure the levels of inflammatory factors IL1β, IL18, and TNFα in the supernatant. RT-qPCR was used to detect the mRNA expression levels of Nos, TNF, and IL6. The results showed that transfection with the PPT1 MUT plasmid reversed the release of cleaved caspase-1 and mature IL-1β induced by phenylpyruvate treatment in the supernatant, while the WT plasmid did not. Figure 5(F); Only PPT1 MUT transfection can inhibit phenylpyruvate-induced secretion of IL-1β, IL-18 and tumor necrosis factor-α in culture supernatant. Figure 5 (G~I); phenylpyruvate treatment upregulated M1 characteristic genes Nos, TNF, and IL6 in PPT1 MUT plasmid ( Figure 5 Downregulation following transfection with J-L indicates that phenylpyruvate treatment promotes a pro-inflammatory phenotype in macrophages, which depends on its association with PPT1. In summary, phenylpyruvate promotes a pro-inflammatory phenotype by enhancing NLRP3 protein stability and facilitating inflammasome activation.

[0090] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. A nucleic acid molecule encoding a PPT1 protein with a phenylpyruvate binding site defect containing K229N and G245A, the nucleotide sequence of said nucleic acid molecule being shown in SEQ ID NO:

27.

2. A biomaterial related to the nucleic acid molecule of claim 1, wherein the biomaterial is any one of (a1) to (a3): (a1) An expression cassette containing the nucleic acid molecule of claim 1; (a2) A vector containing the nucleic acid molecule of claim 1 or the expression cassette of (a1); (a3) A cell line containing the nucleic acid molecule of claim 1, the expression cassette of (a1), or the vector of (a2).

3. A product comprising the nucleic acid molecule of claim 1 and / or the biomaterial of claim 2.

Citation Information

Patent Citations

  • Improvements in and relating to Movable Anchors for Motor Ploughs, Cultivators and the like.

    GB113497A