Hydrogenophaga neptunium and applications thereof

By screening and applying Betella hygroscopici Y10 to degrade ammonia nitrogen and nitrite nitrogen in water under specific conditions, the problem of water quality deterioration in aquaculture has been solved, achieving the effects of water quality improvement and biological health.

CN116814461BActive Publication Date: 2026-07-28GUANGDONG OCEAN UNIVERSITY +2
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
GUANGDONG OCEAN UNIVERSITY
Filing Date
2023-02-21
Publication Date
2026-07-28

AI Technical Summary

Technical Problem

High-density intensive farming in aquaculture has led to the deterioration of aquaculture water quality, serious nitrogen and phosphorus pollution, and the overuse of antibiotics, which affects the aquatic environment and human health. Therefore, it is necessary to safely and efficiently regulate the aquaculture water environment.

Method used

Bacteroides natans Y10 was screened out to degrade NH4+-N and NO2--N in water under specific temperature, salinity, pH and carbon-nitrogen ratio conditions, and was applied as a biological denitrifying bacterium for water quality control in aquaculture.

Benefits of technology

It effectively degrades ammonia nitrogen and nitrite nitrogen, improves water quality, promotes the healthy growth of aquaculture organisms, enhances immunity, reduces antibiotic use, and improves the economic benefits of aquaculture.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116814461B_ABST
    Figure CN116814461B_ABST
Patent Text Reader

Abstract

The application discloses a Cobetia marina strain and application thereof, the Cobetita marina Y10 is preserved in Guangdong Microbial Culture Collection Center (GDMCC), the preservation date is September 7, 2022, and the preservation number is GDMCC No:62673, the strain is isolated and screened from water sample in shrimp biological floc culture pond of Donghai Island Biological Research Base of Guangdong Ocean University, and has the functions of strong NH4 + -N and NO2 ‑ The strain has the functions of heterotrophic nitrification and facultative denitrification, as biological treatment for precise water quality regulation of aquaculture, relies on safe and efficient degradation of harmful substances in water, and has important significance for promoting green and healthy aquaculture and increasing economic benefits of aquaculture.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of environmental and aquaculture technology, specifically relating to a strain of Betella marinei and its applications. Background Technology

[0002] Over the past three decades, China's aquaculture industry has maintained a stable growth trend, with the total national aquatic product output reaching 66.9029 million tons in 2021. This has played a vital role in promoting the country's economic development. However, while annual production has increased, the contradiction between the increasingly competitive aquaculture industry and the unbalanced and insufficient development of aquaculture water ecosystems has become increasingly prominent. High-density intensive development has led to the deterioration of aquaculture water quality, with increased levels of harmful substances such as inorganic nitrogen damaging farmed organisms. In order to promote the normal growth of farmed organisms, antibiotics and other drugs have been overused, which can only solve the existing problems temporarily, but brings about a vicious cycle that affects human health and the aquaculture water environment. Therefore, safe, efficient, and precise regulation of the aquaculture water environment is a prerequisite for the sustainable development of the aquaculture industry.

[0003] Using denitrifying bacteria screened from the aquaculture environment to improve the aquaculture water environment will not harm the cultured organisms, will not cause secondary pollution, and will easily become the dominant strains in the water. They have a significant effect on degrading nitrogen and phosphorus pollution in aquaculture water, and can adjust the intestinal microbial diversity of cultured organisms, promote growth and enhance immunity. Therefore, isolating and screening heterotrophic high-efficiency denitrifying strains from the aquaculture environment has become a new research hotspot. Summary of the Invention

[0004] In view of this, the main objective of the present invention is to provide a strain of Bettyella hymexil and its applications.

[0005] To achieve the above objectives, the technical solution of the present invention is implemented as follows:

[0006] This invention provides a strain of Betella hygrophytes, which was deposited on September 7, 2022, with accession number GDMCC No:62673, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC).

[0007] In the above scheme, the strain was named *Hydrocarbabetes hygrophytes* Y10, which belongs to the category of biological denitrifying bacteria.

[0008] The above-mentioned scheme involves the degradation of NH4 in water by Betella hygroscopica. + -N and NO2 - Applications of -N.

[0009] In the above scheme, the water body is an ammonia nitrogen-nitrification medium and a nitrite-denitrification medium.

[0010] In the above scheme, the NH4 is removed at a temperature of 20–40°C. +-N and NO2 - -N.

[0011] In the above scheme, NH4 is removed at a salinity of 20–40‰. + -N and NO2 - -N.

[0012] In the above scheme, NH4 is removed at a pH of 6.5–9.0. + -N and NO2 - -N.

[0013] In the above scheme, NH4 is removed at a carbon-to-nitrogen ratio (C / N) of 5–20. + -N and NO2 - -N.

[0014] Compared with existing technologies, the *Berateella hygroscopica* strain of this invention can effectively degrade ammonia nitrogen and nitrite nitrogen, improve water quality, and promote environmentally friendly aquaculture. This bacterium, used as a biological treatment for precise water quality control in aquaculture, relies on the safe and efficient degradation of harmful substances in the water by microorganisms, which is of great significance for promoting green and healthy aquaculture and increasing its economic benefits. Attached Figure Description

[0015] The accompanying drawings, which are included to provide a further understanding of the invention and form part of this invention, illustrate exemplary embodiments of the invention and, together with their descriptions, serve to explain the invention and do not constitute an undue limitation thereof. In the drawings:

[0016] Figure 1 This invention provides a schematic diagram of the external morphology of a strain of Betella hygrophytes.

[0017] Figure 2 This invention provides a schematic diagram of the hemolysis test results of a strain of Betella hygroscopica.

[0018] Figure 3 This diagram illustrates the safety immersion test results of a strain of Betella hygrophytes in an embodiment of the present invention.

[0019] Figure 4 A phylogenetic tree diagram of the 16S rDNA gene sequence of a strain of Betella hymexil is provided for embodiments of the present invention.

[0020] Figure 5 This diagram illustrates the PCR amplification results of different functional genes of a strain of Betella hygroscopica, as provided in this embodiment of the invention.

[0021] Figure 6 This invention provides a schematic diagram illustrating the denitrification effect of a strain of Betella hygrophytes under different conditions. Detailed Implementation

[0022] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0023] This invention provides a strain of Betella hymexil. The strain was deposited on September 7, 2022, with accession number GDMCC No:62673, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at 5th Floor, No. 59, Courtyard 100, Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province.

[0024] The *Hydrocotyle* species possesses both heterotrophic nitrification and aerobic denitrification capabilities.

[0025] The strain was named *Hydrobryophyte Y10* and belongs to the class of biological denitrifying bacteria.

[0026] The *Hydrocobetorella* species degrades NH4 in water. + -N and NO2 - Applications of -N.

[0027] The water body is an ammonia nitrogen-nitrification medium and a nitrite-denitrification medium.

[0028] The *Hydrocotyle* bacteria remove NH4 at a temperature of 20–40°C. + -N and NO2 - -N.

[0029] The *Hydrobryophyte* strain removes NH4 at a salinity of 20–40‰. + -N and NO2 - -N.

[0030] The *Betternia hygrophytes* strain removes NH4 at pH 6.5–9.0. + -N and NO2 - -N.

[0031] The *Hydrocobetorella* species removes NH4 at a carbon-to-nitrogen ratio (C / N) of 5–20. + -N and NO2 - -N.

[0032] For clarity, the following examples will be used to provide a detailed description.

[0033] In this invention, NH4 + -N and NO2 - The method for determining -N is based on Lei Yanzhi's "Chemical Experiments in Aquaculture Water Environment": NH4 + The determination method for -N is Nessler's reagent spectrophotometry, NO2 - The method for determining -N is the diazo-azo method.

[0034] All culture media prepared in the experiment were sterilized in an autoclave at 121°C for 30 minutes before use. The culture media used in this invention are as follows:

[0035] Ammonia nitrogen-nitrification liquid medium: ammonium sulfate 0.096g, glucose 0.5g, sodium succinate 0.5g, dipotassium hydrogen phosphate 0.01g, potassium dihydrogen phosphate 0.01g, and 1000mL of filtered seawater; the ammonium sulfate is added through a 0.22μm sterile filter membrane after the medium has cooled. The ammonia nitrogen-nitrification solid medium is the liquid medium with 20g of agar powder added.

[0036] The nitrite-denitrification liquid medium uses 0.1g of sodium nitrite instead of ammonium sulfate, with other components the same as the ammonia-nitrification liquid medium. The nitrite-denitrification solid medium is the liquid medium with 20g of agar powder added.

[0037] 2216E liquid culture medium (g / L): peptone 5.0, yeast extract 1.0, ferric citrate 0.1, sodium chloride 19.45, magnesium chloride 5.98, sodium sulfate 3.24, calcium chloride 1.8, potassium chloride 0.55, sodium carbonate 0.16, potassium bromide 0.08, strontium chloride 0.034, boric acid 0.022, sodium silicate 0.004, sodium fluoride 0.0024, ammonium nitrate 0.0016, disodium hydrogen phosphate 0.008; prepared by dissolving 36.4g of sample in 1L of pure water. This culture medium was purchased from Qingdao High-tech Park Haibo Biotechnology Co., Ltd.

[0038] 2216E solid medium (g / L): peptone 5.0, yeast extract 1.0, ferric citrate 0.1, sodium chloride 19.45.

[0039] Magnesium chloride 5.98, sodium sulfate 3.24, calcium chloride 1.8, potassium chloride 0.55, sodium carbonate 0.16, potassium bromide 0.08, strontium chloride 0.034, boric acid 0.022, sodium silicate 0.004, sodium fluoride 0.0024, ammonium nitrate 0.0016, disodium hydrogen phosphate 0.008, agar 15.0. 52.4g of sample was dissolved in 1L of distilled water with 2g of technical agar powder.

[0040] Blood agar plates: purchased from Beijing Luqiao Technology Co., Ltd.

[0041] MHA culture medium: purchased from Qingdao High-tech Park Haibo Biotechnology Co., Ltd.

[0042] Example 1: Isolation and Screening of Strains

[0043] The *Bebrillatoria marinei* Y10 strain screened in this invention was obtained from water samples isolated and purified from shrimp biofloc culture ponds at the Donghai Island Biological Research Base of Guangdong Ocean University. The steps are as follows:

[0044] Enrichment culture: Take water samples at a 1:10 ratio and add them to 250 mL Erlenmeyer flasks containing 90 mL of ammonia nitrogen-nitrification liquid medium and nitrite-denitrification liquid medium, respectively. Each sample has three parallel groups. Place them in a shaker for enrichment culture at 28℃ and 180 rpm. Replace half of the enrichment culture medium with fresh medium every day. The culture time is 2-3 days.

[0045] Separation and purification: The enriched culture medium was diluted with sterile PBS to a concentration of 10. -2 -10 -7 Concentration gradients were established, and then 0.1 mL of the diluted solution was spread onto ammonia-nitrification and nitrite-denitrification solid media, respectively. The media were incubated upside down at 28°C in a constant temperature biochemical incubator for 2-3 days until colonies appeared. Colonies with varying morphologies were selected for streak purification, and single strains were screened and added to glycerol solution for preservation, then stored at -80°C.

[0046] Re-screening of nitrogen removal performance: Activated strains preserved for breeding were inoculated into ammonia-nitrification liquid medium and nitrite-denitrification liquid medium. A control group was set up. Each experimental group consisted of three replicates, cultured in a shaker at 28℃ and 160 rpm for 48 h. After culture, the cultures were centrifuged at 10000 rpm for 5 min, and the supernatant was used to determine the nitrogen removal performance of the strains at 24 h and 48 h. + -N and NO2 - Based on the denitrification performance of -N, strains with good denitrification effects were selected. Among them, *Betterella hygroscopici* Y10 showed good denitrification performance, reducing NH4+ by 24 hours. + -N and NO2 - The degradation rates of -N were 73.78±0.80% and 78.26±0.66%, respectively, and the NH4+ degradation rates after 48 hours were... + -N and NO2 - The -N degradation rates were 80.04.56±0.56% and 83.03±0.58%, respectively, so Betella hygrophytes Y10 was used for subsequent experiments.

[0047] Example 2: Identification of the strain

[0048] (1) Morphological identification

[0049] Through the above-described isolation and screening process, this invention yielded a heterotrophic nitrifying-aerobic denitrifying strain, Y10, with excellent nitrogen removal performance. On solid 2216E plates, the colonies of this strain after 24 hours are pale yellow, smooth, raised, with intact edges, viscous, moist, and easily picked up (e.g., ...). Figure 1 (As shown).

[0050] (2) Physiological and biochemical identification

[0051] After activating Betella hygrophytes Y10, three replicates were set up for each group. Physiological and biochemical assays were performed on the bacteria in accordance with Bergey's Manual of Bacteriological Identification. The results of the physiological and biochemical assays are shown in Table 1.

[0052] Table 1. Identification results of physiological and biochemical characteristics of strain Y10

[0053]

[0054] Note: "+" indicates a positive result, and "-" indicates a negative result.

[0055] (3) Molecular biological identification

[0056] Using the Tiangen Bacterial Genomic DNA Extraction Kit, activated Betty's genomic DNA was extracted as a template for PCR amplification. Universal primers for bacterial 16S rDNA were used. The PCR amplification reaction system (35L) consisted of: 4L template DNA; 0.7L forward primer 27F; 0.7L reverse primer 1492R; 17.5L MasterMiX; and finally, 12.1L ddH2O was added to bring the total volume to 35L. The PCR amplification conditions were: ① 94℃ for 3 min; ② 94℃ for 30 s; ③ 55℃ for 30 s; ④ 72℃ for 1 min; (with ②-④ for 33 cycles) ⑤ 72℃ for 5 min. After amplification, the products were detected by 1% agarose gel electrophoresis and then sent to Shanghai Bioengineering Co., Ltd. for sequencing. The sequencing results were then subjected to BLAST alignment analysis on NCBI (http: / / www.ncbi.nlm.nih.gov / BLAST / Blast.cgi) to determine the species and taxonomic position of the strains. A phylogenetic tree was constructed using the neighbor-joining method in MEGA 5.0 software (e.g., Figure 4 (As shown).

[0057] (4) Identification of Betella hyacinthiae Y10 and construction of its phylogenetic tree

[0058] The 16S rDNA sequence of strain Y10 was amplified by PCR and sequenced, yielding a DNA sequence of approximately 1444 bp. After BLAST alignment analysis in the NCBI database, strains with high similarity to Y10 were selected for phylogenetic tree construction. The results showed that strain Y10 clustered with *Cobetia marina* HNS031 (JN128265.1) with a homology of 99.86%. Strain Y10 was identified as *Cobetia marina*. The sequence of Y10 is as follows:

[0059]

[0060] TCCATGAAGTCGGAATCGCTAGTAATCGTGGATCAGAATGCCACGGTGAATACGTTCCCGGGCCTTGT

[0061] ACACACCGCCCGTCACACCATGGGAGTGGACTGCACCAGAAGTGGTTAGCCTAACCTTCGGGAGGGCG

[0062] ATCACCACGGTGGTTAAAGG

[0063] Example 3: Safety evaluation of Betella hyopneumoniae Y10

[0064] (1) Hemolysis test: Inoculate the activated strain on blood agar plates and incubate at 28°C for about 48 hours. The presence or absence of a hemolysis zone indicates whether the strain is hemolytic. If there is no hemolysis zone, it means that the bacterium is not pathogenic.

[0065] (2) Safety Immersion Test

[0066] Healthy Litopenaeus vannamei shrimp (average weight 0.86±0.19g, average body length 3.57±0.23cm) were selected from the Biological Research Base of Guangdong Ocean University and stocked in 60L white tanks, with 20 shrimp per tank. They were temporarily housed for one week before the experiment, during which time they were fed normally daily, with approximately 90% water exchanged. The formal experimental period was 14 days. A culture of Betella hyopneumoniae Y10 in the logarithmic growth phase was centrifuged at 10000rpm for 5 minutes, the supernatant was discarded, and the shrimp were rinsed with sterile PBS, repeated three times. The immersion concentration in the water was set to 10. 5 CFU / mL and 10 6 CFU / mL, with three replicates for each of the control and experimental groups. During the rearing period, the shrimp were fed normally and their survival was observed. The water was changed every three days, and the corresponding concentration of bacterial solution was added after each water change.

[0067] (3) Drug sensitivity test: The drug sensitivity test was carried out using the KB paper disc method. 100L of activated bacteria solution was evenly spread on MHA medium, and then the drug sensitivity disc was attached to the surface of the medium. After 24 hours, the diameter of the inhibition zone was measured with a ruler to determine the sensitivity of each drug.

[0068] (4) Results

[0069] In the hemolysis test, the strain did not exhibit hemolytic activity, indicating that the strain does not possess potential pathogenicity (e.g., Figure 2 As shown), in the safety assessment soaking of Litopenaeus vannamei, the survival rate of the shrimp was higher than 93.33%, and there was no significant difference compared with the control group (e.g., ...). Figure 3As shown in the figure, this indicates that *Bebrilia oleracea* Y10 does not pose a threat to *Litopenaeus vannamei*. Drug sensitivity testing results show that *Bebrilia oleracea* Y10 is resistant to oxacillin, penicillin G, clarithromycin, vancomycin, clindamycin, tetracycline, minocycline, nitrofurantoin, and piperacillin; moderately sensitive to erythromycin, chloramphenicol, and trimethoprim-sulfamethoxazole; and highly sensitive to other antibiotics. This indicates that *Bebrilia oleracea* Y10 does not have strong drug resistance factors and is suitable for use in aquaculture, showing great development potential.

[0070] Table 2. Results of antimicrobial susceptibility testing for Betty's Y10.

[0071]

[0072] Note: Susceptible (S), Intermediate (I), Resistant (R) Example 4: PCR amplification of the denitrification gene of *Berateella helicobacter* Y10 denitrifying bacterium.

[0073] To determine whether Betella marinei Y10 possesses nitrification and denitrification genes, primers were designed using Primer 5.0 software and referenced the whole genome sequences of similar strains to conduct PCR amplification experiments of functional genes, further investigating the denitrification mechanism of strain Y10. Primer information for denitrification genes is shown in Table 3.

[0074] DNA was extracted from *Betterlia hygroscopica* Y10 using the Tiangen Bacterial Genomic DNA Extraction Kit, according to the manufacturer's instructions. PCR reaction conditions were: denaturation at 94℃ for 5 min; 35 cycles: denaturation at 94℃ for 30 s, annealing for 30 s, extension at 72℃ for 1 min; and extension at 72℃ for 7 min. The annealing temperatures for the denitrification genes amoA, hao, nxrB, nasA, napA, napB, nirK, norB, and nirS were 40℃, 54℃, 58℃, 55℃, 56℃, 60℃, 57℃, 68℃, and 55℃, respectively. PCR products were electrophoresed on a 1% agarose gel. After UV excitation, the bands were observed, and images were captured and saved using a gel imaging system.

[0075] Nine biological denitrification-related genes were amplified by PCR, such as Figure 5 As shown, three gene fragments, amoA, napA, and nirK, were amplified in *Betteria hygroscopica* Y10. Among them, amoA is a key functional gene in the nitrification process, while napA and nirK are key functional genes in the denitrification process. In particular, NAP is also considered a biomarker for aerobic denitrifying bacteria. These results indicate that *Betteria hygroscopica* Y10 has a complete nitrification and denitrification pathway.

[0076] Table 3 Primers for the Y10 denitrification gene of *Hydrobryophyte*

[0077]

[0078]

[0079] Example 5: Denitrification effect of *Hydrocotyle hygrophytes* Y10 under different conditions

[0080] To investigate the optimal denitrification effect of *Bryophyte Y10* under different temperature, salinity, pH, and C / N conditions, six different gradients of influencing factors were set for each condition, with three replicates per group. Temperature was controlled by a temperature-controlled incubator, salinity by adding pure water or NaCl, pH by adding HCl and NaOH, and C / N by adding glucose. Except for the set influencing factors, the other experimental conditions were: temperature 30℃, salinity 30‰, pH 7.5, and C / N 10.

[0081] Before the experiment, *Betterella hyopneumoniae* Y10 was activated with Liquid 2216E at a ratio of 1:100 and cultured in a shaker at 30°C until the logarithmic growth phase. The supernatant was discarded after centrifugation at 10,000 rpm for 5 min, and the culture was rinsed three times with sterile PBS. 1% of the bacterial culture was added to 100 mL of ammonia-nitrification liquid medium and nitrite-denitrification liquid medium. After culturing for 24 h, the supernatant was collected after centrifugation at 10,000 rpm for 5 min to determine NH4+. + -N and NO2 - -N concentration.

[0082] (1) Effect of temperature on the denitrification performance of Betella hygrophytes Y10

[0083] Using ammonium sulfate and sodium nitrite as the sole nitrogen sources, different temperature gradients of 15℃, 20℃, 25℃, 30℃, 35℃ and 40℃ were set up to analyze the denitrification effect of Betella hygrophytes Y10.

[0084] from Figure 5 It can be seen that ( Figure 5 The order of the denitrification process is: 1: amoA, 2: hao, 3: nxrB, 4: nasA, 5: napA, 6: napB, 7: nirK, 8: norB, 9: nirS). Within the temperature range of 15–40℃, the denitrification efficiency first increases and then decreases. The optimal culture temperature for the strain is 20–40℃, with the best denitrification efficiency at 30℃. NH4 + -N and NO2 - The degradation rates of -N were 77.92% and 77.89%, respectively.

[0085] (2) Effect of salinity on the denitrification performance of Betella hygrophytes Y10

[0086] like Figure 6 As shown, salinity affects NH4+. + The nitrogen removal performance of -N is significantly affected. Within the salinity range of 5–30‰, the nitrogen removal efficiency increases with increasing salinity, while at salinity of 20–40‰, it is significantly reduced to NH4+. + -N removes optimal culture conditions; salinity affects NO2 - -N denitrification efficiency is less affected; at salinity of 30‰, NH4+... + -N and NO2 - The nitrogen removal efficiency was the best for -N, at 76.1% and 78.22%, respectively.

[0087] (3) Effect of pH on the denitrification performance of Betella hygrophytes Y10

[0088] The effect of pH on the denitrification capacity of Betella helicobacter Y10, such as Figure 6 As shown, the pH range is 6.5–9.0, which is beneficial to NH4+. + -N and NO2 - The nitrogen removal capacity of -N is minimally affected, and the nitrogen reduction effect remains stable. NH4 + The denitrification rate of -N was between 69.08% and 75.52%, and NO2... - The nitrogen removal rate of -N is between 66.28% and 80.10%.

[0089] (4) Effect of C / N ratio on the denitrification performance of Betella hygrophytes Y10

[0090] like Figure 6 As shown, the C / N ratio has a significant impact on the denitrification capacity of Betella marinei Y10. When the C / N ratio is between 0 and 2, NH4+... + -N and NO2 - The removal rate of -N is relatively low; when the C / N ratio is 10, NH4+ removal efficiency is low. + -N and NO2 - The removal rates of -N were the highest, at 81.64% and 77.86%, respectively. NH4+ removal rates were highest when the C / N ratio was between 5 and 20. + -N and NO2 - The denitrification efficiency of -N tends to stabilize. Therefore, it is more appropriate to maintain the C / N ratio of 5 to 20 when culturing Betella hyopneumoniae Y10.

[0091] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention.

Claims

1. A strain of Cobetia marina, characterized by: The strain was named *Hydrocarbabetes hygrophytes* Y10. The preservation date of this strain was September 7, 2022, and the preservation number was GDMCC No:62673. It was deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC).

2. The method of *Betternia hygroscopici* as described in claim 1 for degrading NH4 in water. + -N and NO2 - Applications of -N.

3. The *Betternia hygroscopici* strain according to claim 1 in degrading NH4 in water. + -N and NO2 - The application of -N is characterized by, The water body is an ammonia nitrogen-nitrification medium and a nitrite-denitrification medium.

4. The *Betternia hygroscopici* strain according to claim 1 in degrading NH4+ in water. + -N and NO2 - The application of -N is characterized by, Removal of NH4 at temperatures of 20-40℃ + -N and NO2 - -N.

5. The *Betternia hygroscopici* strain according to claim 1 in degrading NH4 in water. + -N and NO2 - The application of -N is characterized by, Removal of NH4 under salinity conditions of 20-40‰ + -N and NO2 - -N.

6. The *Betternia hygroscopici* strain according to claim 1 in degrading NH4 in water. + -N and NO2 - The application of -N is characterized by, Removal of NH4 under pH conditions of 6.5–9.0 + -N and NO2 - -N.

7. The *Betternia hygroscopici* strain according to claim 1 in degrading NH4 in water. + -N and NO2 - The application of -N is characterized by, Removal of NH4 under conditions with a carbon / nitrogen ratio (C / N) of 5–20 + -N and NO2 - -N.