A composition, kit for detecting and application of the same of sub-rare gomphidius roseus
By combining LAMP amplification and the CRISPR/Cas12a system, specific CrRNA and ssDNA probes were designed, solving the sensitivity and specificity problems in the detection of Russula subnigricans. This enabled rapid and accurate mushroom detection, suitable for on-site testing of mushrooms and processed products.
Patent Information
- Application Number
- CN202310868081.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-17
- Publication Date
- 2025-10-21
- Estimated Expiration
- 2043-07-17
AI Technical Summary
Existing methods for detecting Russula subnigricans suffer from low sensitivity and poor specificity, and are easily affected by aerosol contamination, making it difficult to quickly and accurately identify in the general population, especially after mushroom processing, where morphological identification is challenging.
By combining LAMP amplification technology with the CRISPR/Cas12a system, specific CrRNA and ssDNA probes were designed. After LAMP amplification, they were added to the CRISPR/Cas12a reaction solution, and the cleavage action of the Cas12a enzyme was used to achieve rapid and visualized detection.
It achieves highly specific and ultra-high sensitivity detection of Russula subnigricans, with a detection limit of up to fg. It can achieve rapid on-site detection within 50 minutes without large instruments, and is suitable for the detection of mushrooms and processed products.
Smart Images

Figure CN116875724B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of food safety detection, and in particular relates to a composition, a kit and applications thereof for detecting Russula subspecies. Background Art
[0002] As the only highly toxic and lethal mushroom species in the Russula genus, Russula subsparsely girdle exhibits rhabdomyolysis, leading to a high mortality rate. Its appearance and genetic relationships are very similar to those of edible species such as Russula densely girdle and Russula sparsely girdle, making it easy to cause poisoning through accidental harvesting and ingestion. Therefore, establishing a highly sensitive and specific method for accurately identifying Russula subsparsely girdle is of great practical significance for preventing poisoning.
[0003] Currently, identification methods for Russula subsparsely girdle mainly include morphological and molecular methods. Morphological identification relies on the morphological characteristics of Russula subsparsely girdle, requiring sufficient experience and expertise. Accurate identification is difficult for the general public, and once the mushroom has been processed, it is difficult to distinguish based on morphology. Molecular biological identification techniques have only been reported in a few cases for the identification of Russula subsparsely girdle. Zhang Yizhe et al. developed a fluorescence quantitative PCR method for the identification of Russula subsparsely girdle based on the Taqman-MGB probe method. This method requires a laboratory equipped with a fluorescence quantitative PCR instrument. Long Pan et al. developed a detection and identification method for Russula subsparsely girdle using loop-mediated isothermal amplification (LAMP) technology with a sensitivity of 500 fg / μL. However, LAMP reactions are prone to aerosol contamination, leading to false positives and negatively impacting the accuracy of test results. Therefore, the development of a highly specific and sensitive detection and identification method is urgently needed to address the technical challenges currently associated with emergency response to Russula subsparsely girdle poisoning. Summary of the Invention
[0004] In view of this, the object of the present invention is to provide a composition, a kit and its application that are highly specific, highly sensitive and capable of rapidly detecting Russula subsparsely.
[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0006] The present invention provides a composition for detecting Russula subsparsely covered. The composition comprises a LAMP amplification primer set, crRNA and an ssDNA probe; the LAMP amplification primer set comprises an outer primer, an inner primer and a loop primer; the nucleotide sequences of the outer primers are respectively shown as SEQ ID NO.1 and SEQ ID NO.2; the nucleotide sequences of the inner primers are respectively shown as SEQ ID NO.3 and SEQ ID NO.4; the nucleotide sequences of the loop primers are respectively shown as SEQ ID NO.5 and SEQ ID NO.6; the nucleotide sequence of the crRNA is shown as SEQ ID NO.7; and the nucleotide sequence of the ssDNA probe is TTATT.
[0007] Preferably, the ssDNA probe is modified with both a fluorescent group and a quenching group.
[0008] Preferably, the molar concentration ratio of the outer primer, inner primer and loop primer is 3:32:16, and the molar concentration ratio of the crRNA and ssDNA probe is 6:25.
[0009] The present invention also provides a kit for detecting Russula subspecies, which comprises the above-mentioned composition.
[0010] Preferably, the kit further comprises LAMP reaction buffer, dNTPs, Bst DNA polymerase, LbCas12a enzyme, CRISPR reaction buffer and MgSO4 solution.
[0011] Preferably, the LAMP reaction buffer comprises 20 mM Tris-HCl, 10 mM (NH 4 ) 2 SO 4 , 50 mM KCl, 2 mM MgSO 4 solution and 0.1% Tween 20.
[0012] Preferably, the molar concentration ratio of the crRNA and the LbCas12a enzyme is 6:2.
[0013] The present invention also provides an application of the composition or the kit in detecting Russula subsparsely.
[0014] The present invention also provides an application of the composition or the kit in preparing and detecting Russula subsparsely covered products.
[0015] The present invention also provides a method for detecting Russula substantiverum, comprising the following steps: extracting DNA of a sample to be tested; mixing the DNA with a LAMP reaction mixture, adding paraffin oil, centrifuging, and performing LAMP amplification at 62°C for 40 minutes; after the amplification, adding a CRISPR / Cas12a reaction solution, incubating at 37°C for 10-20 minutes, and the appearance of green fluorescence under ultraviolet light irradiation or an S-shaped curve by real-time fluorescence PCR indicates that the sample to be tested contains Russula substantiverum; the LAMP reaction mixture contains the LAMP amplification primer set in the above-mentioned composition; and the CRISPR / Cas12a reaction solution contains the crRNA and ssDNA probes in the above-mentioned composition.
[0016] Beneficial effects of the present invention:
[0017] The present invention combines the LAMP method with CRISPR / Cas12a technology, and the composition designed to detect Russula subsparsely girdle has the advantages of high specificity (capable of accurately identifying Russula subsparsely girdle and avoiding nonspecific amplification), ultra-high sensitivity (the detection limit can reach the fg level (1fg / μL DNA), and the mixed mushroom sample can be detected to 0.01%, which is 2 orders of magnitude higher than the sensitivity of existing detection methods) and the ability to quickly detect Russula subsparsely girdle. The detection process conditions are mild, and there is no need for high-temperature pre-denaturation of the DNA double strands. The detection process only takes 50 minutes. The test results do not require the aid of large instruments, and can be visualized with a portable ultraviolet light device such as an ultraviolet flashlight, which is suitable for rapid on-site detection.
[0018] The composition, kit and detection method of the present invention are suitable for the detection of Russula subspecies in samples such as mushrooms and processed products (mushroom residues, soup, etc.), providing technical support for emergency treatment of foodborne mushroom poisoning. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 Screening results for six LAMP primer sets for Russula subspecies. (a) to (f) correspond to the real-time LAMP amplification curves of primer sets 1 to 6, respectively. The red curve represents Russula subspecies, and the green curves represent other mushroom species.
[0020] Figure 2 The results of the screening of crRNA specific to Russula subspecies are shown in Figure 2, where (a) and (b) are the visible fluorescence image under ultraviolet light and the fluorescence intensity value at the reaction endpoint collected by a real-time fluorescence instrument, respectively.
[0021] Figure 3 The optimization results of the LAMP-CRISPR / Cas12a detection method of the present invention are shown in Figure 2, where (a) is the Mg content in the system. 2+(b) The fluorescence intensity quantification value of the reaction endpoint of the final concentration; (b) The visible fluorescence results of the CRISPR / Cas12a system under UV irradiation after different cleavage times at 37°C;
[0022] Figure 4 The results of the specificity validation of the LAMP-CRISPR / Cas12a detection method for Russula subsparsely glabrous. (a) and (b) are the visible fluorescence image under UV irradiation and the fluorescence intensity value at the reaction endpoint collected by a real-time fluorescence instrument, respectively. Sequence number 1 is a ddH2O blank control, sequence number 24 is for Russula subsparsely glabrous, and sequences numbers 2-23 correspond to other mushroom species including Russula densely glabrous and Russula sparsely glabrous.
[0023] Figure 5 The sensitivity validation results of the LAMP-CRISPR / Cas12a detection method for Russula subsparsely gilled are shown in Figure 1. (a) and (b) are the visible fluorescence image under UV irradiation and the fluorescence intensity value of the reaction endpoint collected by the real-time fluorescence instrument, respectively. From left to right in the figure, the concentrations of the Russula subsparsely gilled DNA template are as follows: 10~10 -7 ng / μL and ddH2O (NTC);
[0024] Figure 6 This figure shows the practical application of the LAMP-CRISPR / Cas12a rapid detection method for Russula subsparsea. (a) and (b) are the visible fluorescence image under ultraviolet light irradiation and the fluorescence intensity value of the reaction endpoint collected by a real-time fluorescence instrument, respectively. From left to right in the figure, the addition amounts of Russula subsparsea in the mixture are: 100%, 50%, 25%, 10%, 1%, 0.1%, 0.01% and 0. The group with an addition amount of 0 indicates that no Russula subsparsea was added, and ddH2O was added. DETAILED DESCRIPTION
[0025] The present invention provides a composition for detecting Russula subsparsely covered. The composition comprises a LAMP amplification primer set, crRNA and an ssDNA probe; the LAMP amplification primer set comprises an outer primer, an inner primer and a loop primer; the nucleotide sequences of the outer primers are respectively shown as SEQ ID NO.1 and SEQ ID NO.2; the nucleotide sequences of the inner primers are respectively shown as SEQ ID NO.3 and SEQ ID NO.4; the nucleotide sequences of the loop primers are respectively shown as SEQ ID NO.5 and SEQ ID NO.6; the nucleotide sequence of the crRNA is shown as SEQ ID NO.7; and the nucleotide sequence of the ssDNA probe is TTATT.
[0026] The present invention combines the LAMP method with CRISPR / Cas12a technology. When target DNA appears, crRNA recognizes the target sequence by base complementary pairing under the guidance of the PAM site. The Cas12a protein accurately locates the target sequence through the guidance of crRNA to form a crRNA-Cas12a-dsDNA ternary complex. At this time, the Cas enzyme cuts the double-stranded target DNA at different positions downstream of the PAM site, and its trans-cleavage effect is activated, and ssDNA can be cut indiscriminately. By adding ssDNA fluorescent probes to the system, the above nucleic acid diagnosis results can be visualized. In the present invention, the ssDNA probe is preferably modified with a fluorescent group and a quencher group at the same time. The fluorescent group preferably includes FAM, and the quencher group preferably includes BHQ1. The ssDNA probe of the present invention is preferably (FAM)-TTATT-(BHQ1). In the present invention, the molar concentration ratio of the outer primer, inner primer and loop primer is preferably 3:32:16, and the molar concentration ratio of the crRNA and ssDNA probe is preferably 6:25.
[0027] The present invention also provides a kit for detecting Russula subspecies, which comprises the above-mentioned composition.
[0028] In the present invention, the kit preferably further includes LAMP reaction buffer, dNTPs, Bst DNA polymerase, LbCas12a enzyme, CRISPR reaction buffer and MgSO4 solution, and more preferably further includes positive quality control, negative quality control, paraffin oil and nuclease-free water, the positive quality control is preferably a plasmid containing a specific gene fragment of Subsparse Russula, the nucleotide sequence of the specific gene fragment of Subsparse Russula is shown in SEQ ID NO.38, and the negative quality control is preferably a plasmid that does not contain a specific gene fragment of Subsparse Russula. In the present invention, the LAMP reaction buffer preferably includes 20mMTris-HCl, 10mM (NH4)2SO4, 50mM KCl, 2mM MgSO4 solution and 0.1% Tween 20, and the molar concentration ratio of the CrRNA and LbCas12a enzyme is preferably 6:2. The present invention is not particularly limited to the specific sources of the above-mentioned raw materials, and conventional commercially available products in this field can be used.
[0029] The present invention also provides an application of the composition or the kit in detecting Russula sparsely populated or preparing a product for detecting Russula sparsely populated.
[0030] The present invention also provides a method for detecting Russula substantiverum, comprising the following steps: extracting DNA of a sample to be tested; mixing the DNA with a LAMP reaction mixture, adding paraffin oil, centrifuging, and performing LAMP amplification at 62°C for 40 minutes; after the amplification, adding a CRISPR / Cas12a reaction solution, incubating at 37°C for 10-20 minutes, and the appearance of green fluorescence under ultraviolet light or an S-shaped curve by real-time fluorescence PCR indicates that the sample to be tested contains Russula substantiverum; the LAMP reaction mixture contains the LAMP amplification primer set in the above-mentioned composition; and the CRISPR / Cas12a reaction solution contains the crRNA and ssDNA probes in the above-mentioned composition.
[0031] The present invention does not specifically limit the method for extracting the DNA of the sample to be tested; any conventional DNA extraction method in the art can be used. In the present invention, the LAMP reaction mixture preferably includes (based on 12.5 μL): 1.75 μL of 10 mM dNTPs, 1.25 μL of 10× LAMP reaction buffer, 0.5 μL of 100 mM MgSO4 solution, 0.5 μL of Bst DNA polymerase, 4.3 μL of a LAMP amplification primer set, 1 to 100 ng of the DNA template to be tested, and nuclease-free water to make up to 12.5 μL.
[0032] The present invention adds paraffin oil to seal before LAMP amplification, can prevent the reaction solution from evaporating and amplified product from overflowing and causing aerosol contamination, and the added volume of the paraffin oil is preferably equal to the liquid volume after mixing with DNA and LAMP reaction mixture. After LAMP amplification is completed, it is preferred to add CRISPR / Cas12a reaction solution after cooling, and the CRISPR / Cas12a reaction solution preferably includes (in 20 μL): 1 × CRISPR / Cas12a reaction buffer 2 μL, 2.5 μM CrRNA 4.8 μL, 1 μM LbCas12a enzyme 4 μL, 10 μM ssDNA 5 μL, 100mM MgSO 41.2 μL, plus nuclease-free water to be supplemented to 20 μL. The present invention is not particularly limited for the specific source of each of the above-mentioned raw materials, and conventional commercially available products in this area can be used.
[0033] The method for detecting Russula subspecies, which combines LAMP with CRISPR / Cas12a technology, can greatly amplify the detection signal and increase the detection sensitivity by orders of magnitude. In addition, due to the specific cleavage effect of crRNA, it can perform a secondary cleavage of the target DNA, significantly improving the detection specificity of the method and avoiding the false positive problem caused by aerosol contamination.
[0034] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0035] In the following examples, unless otherwise specified, all methods are conventional.
[0036] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.
[0037] All designed sequences in the examples of the present invention were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0038] The main instruments and equipment used in the following examples are as follows: 96E multi-sample cryo-grinding instrument (Shanghai Wanbo Biotechnology Co., Ltd.), 5424r high-speed refrigerated centrifuge (Eppendorf, Germany), Nanodrop 2000c ultra-micro spectrophotometer (Thermo Scientific, USA), HWS-12 constant temperature water bath (Shanghai Shenggong Biotechnology Service Co., Ltd.), 96 fluorescence quantitative PCR instrument (Roche, Switzerland) and portable UV flashlight (Shenzhen Shenhuo Lighting Co., Ltd.).
[0039] Example 1
[0040] Design of LAMP Primers for Russula subspecies
[0041] According to the sequence information of Russula subsparsely glabrous published in NCBI GenBank, the ITS gene sequence of Russula subsparsely glabrous was downloaded, and homology alignment was performed using DNAMAN to select a highly conserved gene sequence, which is as follows: 5'-CAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAG AACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATTCTCAAACCTTCTTGGTTTTTGGACCAAGATGGCTTTGGACTTTGGAGGCGTTTTGCTGGCTTTGTGAAAAGCCAGCTCCTCTCAA ATGCATTAGTGGGGTCCACTTTGCCGATCCCCAGGCGTGATAAGATGCTTTCTACGTCTTGGGATTTGCTCTGTTCCTCGGGAACCTGCTTTCAAACCGTCTCGTGAGAGACACCGTTCGAGTTTGCTCGGCGCACGAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGG-3'(SEQ IDNO.38).
[0042] Six sets of LAMP primers containing one or two loop primers were designed using the online design platforms Primer Explorer V5 and https: / / lamp.neb.com / #! / , respectively. The specific information is shown in Table 1.
[0043] Table 1 Designed LAMP primers for Russula subspecies
[0044]
[0045] To screen the specificity of the six primer sets listed in Table 1 for LAMP amplification of Russula subspecies, real-time fluorescence LAMP amplification was performed using a LightCycler 96 fluorescence quantitative PCR instrument. A 25 μL reaction system was used: 32 μM each of inner primers FIP and BIP, 3 μM each of outer primers F3 and B3, 16 μM each of loop primers LF and LB, 3.5 μL of 10 mM dNTPs, 2.5 μL of 10× LAMP reaction buffer (20 mM Tris-HCl, 10 mM (NH4)2SO4, 50 mM KCl, 2 mM MgSO4 solution, and 0.1% Tween 20), 1 μL of 100 mM MgSO4 solution, 1 μL of Bst DNA polymerase, 2 μL of 10 μM DNA template to be tested, and 2 μL of 1× fluorescent dye. The mixture was then made up to 25 μL with nuclease-free water. The reaction was incubated at 62°C for 40 min. The results are shown in Figure 2. Figure 1 As shown, primer sets 1, 2, and 3 all showed nonspecific amplification, primer sets 4 and 6 did not show amplification, and only primer set 5 did not show nonspecific amplification and the corresponding amplification curve of Russula subsparsely glabrous was good. Therefore, primer set 5 was a specific LAMP primer for Russula subsparsely glabrous, and no amplification bands were produced for other mushroom species.
[0046] Example 2
[0047] Design and screening of crRNA from Russula subspecies
[0048] According to Example 1, LAMP primers were screened, and the PAM site was determined by searching for a sequence rich in "TTTN" in the target ITS sequence corresponding to primer set 5. The 20 bases after the PAM site were then linked to the universal stem-loop sequence to form a crRNA sequence. A total of 5 crRNAs and 1 ssDNA probe were designed. The specific sequence information is shown in Table 2.
[0049] Table 2 CrRNA sequences and ssDNA sequences designed for Russula subspecies in the present invention
[0050]
[0051] In order to screen which crRNA in Table 2 has the best effect, the following experiment was performed: after the LAMP reaction of primer set 5 in Example 1 was completed, it was immediately placed on ice for cooling, and 20 μL CRISPR / Cas2a reaction solution was added to the tube cap, including 1× CRISPR / Cas12a reaction buffer 2 μL, 2.5 μM CrRNA 4.8 μL, 1 μM LbCas12a enzyme 4 μL, 10 μM ssDNA (FAM-TTATT-BHQ1) 5 μL, 100 mM MgSO4 1.2 μL, and nuclease-free water was added to 20 μL (the final concentration of each raw material was 600 nM crRNA, 2.5 μM ssDNA, 0.2 μM LbCas12a enzyme, 1× CRISPR / Cas12a reaction buffer, 6 mM MgSO4), then the tube cap was tightly closed and centrifuged instantaneously to fully mix the CRISPR / Cas12a reaction system and the LAMP amplification product. After incubation at 37°C for 10 minutes, observe the results by irradiating with a UV flashlight. The fluorescence curve was monitored in real time using a 96-well fluorescent quantitative PCR instrument. The FAM channel was selected and the fluorescence signal was collected every 45 s for 30 cycles.
[0052] Filter results such as Figure 2 As shown, (a) is the visual result under ultraviolet light irradiation, and (b) is the quantitative value of the fluorescence intensity at the reaction end point measured by a fluorescence quantitative PCR instrument, indicating that the fluorescence intensity of Cr5 is better than others under the same conditions, and Cr5 is used as the optimal sequence of the present invention.
[0053] Example 3
[0054] Optimization of CRISPR / Cas12a detection system
[0055] (1)Mg 2+ Concentration optimization
[0056] In the case where other components in the reaction system described in Example 2 remain unchanged, the Mg content in the system is 2+ The concentration was optimized and Mg 2+ The final concentration is 6mM. When 20μL of CRISPR / Cas12a system is added, Mg 2+ The concentration in the total system changes, so additional Mg needs to be added 2+ , set the additional addition volume to 0μL, 1μL and 1.2μL, corresponding to the final Mg 2+ The concentrations were 2.31, 5.38, and 6.00 mM to explore the Mg content in CRISPR / Cas12a reactions. 2+The remaining substances in the CRISPR / Cas12a reaction system and the specific experimental method are the same as those in Example 2 (CrRNA is Cr5, and only ultraviolet flashlight illumination is used for observation when observing the results).
[0057] The results are as follows Figure 3 As shown in (a), as Mg 2+ The fluorescence intensity increases with the addition amount. 2+ When the volume is 1.2 μL, the total Mg 2+ When the concentration is 6mM, a stronger fluorescence signal is generated. Finally, Mg in the total system is selected. 2 + The final concentration is 6 mM.
[0058] (2) Optimization of CRISPR / Cas12a reaction time
[0059] When combined with the target, Cas12a will achieve high-efficiency cutting. To explore the shortest reaction time in which color change can be observed, the reaction temperature of CRISPR / Cas12a was set to 37°C, and the reaction time was set to 0-35min. The other experimental conditions were the same as in Example 2 (CrRNA was Cr5, and only ultraviolet flashlight was used for observation). The reaction results were photographed and recorded every 5 minutes to observe the color change. The results are as follows Figure 3 As shown in (b), the CRISPR / Cas12a cleavage time can produce a fluorescent color change that can be distinguished by the naked eye within 10 minutes, and the fluorescence intensity no longer changes after 20 minutes. Therefore, the optimal CRISPR / Cas12a reaction time is 10 minutes.
[0060] Example 4
[0061] A LAMP-CRISPR detection method for Russula subspecies
[0062] (1) Use the CTAB method or a DNA extraction kit to extract the DNA of the sample to be tested.
[0063] (2) LAMP amplification
[0064] The LAMP system for LAMP-CRISPR / Cas12a detection uses a total volume of 12.5 μL, including: 10mM dNTPs 1.75 μL, 10× LAMP reaction buffer (20mM Tris-HCl, 10mM (NH4)2SO4, 50mM KCl, 2mM MgSO4 solution and 0.1% Tween 20) 1.25 μL, 100mM MgSO4 solution 0.5 μL, Bst DNA polymerase 0.5 μL, LAMP amplification primer set (the fifth primer set in Example 1, the molar concentration ratio of the outer primer, inner primer and loop primer is 3:32:16) 4.3 μL, 1-100 ng of the DNA template to be tested, nuclease-free water is added to 12.5 μL, and the same volume of paraffin oil is added above the liquid surface. The LAMP reaction reagent was added to a 0.2 mL PCR tube, vortexed thoroughly, and placed in a 62°C constant temperature water bath for 40 min.
[0065] (3) CRISPR / Cas12a reaction
[0066] After the LAMP reaction is completed, immediately place it on ice for cooling, add 20 μL CRISPR / Cas2a reaction solution to the tube cap, including 1× CRISPR / Cas12a reaction buffer 2 μL, 2.5 μM CrRNA (Cr5 in Example 2) 4.8 μL, 1 μM LbCas12a enzyme 4 μL, 10 μM ssDNA (FAM-TTATT-BHQ1) 5 μL, 100 mM MgSO4 1.2 μL, add nuclease-free water to 20 μL (the molar concentration ratio of CrRNA and ssDNA probe is 6: 25, and the molar concentration ratio of CrRNA and LbCas12a enzyme is 6: 2), then cover the tube cap tightly, and centrifuge instantaneously to fully mix the CRISPR / Cas12a reaction system with the LAMP amplification product. After incubation at 37 ° C for 10 minutes, observe the results by ultraviolet flashlight illumination. If green fluorescence appears, it indicates that the sample to be tested contains subsparse red mushrooms.
[0067] If it is through The results were observed using a 96 fluorescence quantitative PCR instrument, which monitored the fluorescence curve in real time. The FAM channel was selected and the fluorescence signal was collected every 45 seconds for 30 cycles. If the real-time fluorescence PCR instrument displayed an S-shaped curve, it indicated that the sample contained Russula subsparganium.
[0068] Example 5
[0069] Specificity verification
[0070] Collection and preservation of mushroom samples
[0071] The collected mushroom samples included 23 species of poisonous or edible mushrooms, including sub-sparse-girdle Russula, poisonous Russula, dense-girdle Russula, sparse-girdle black Russula, water chestnut Russula, copper-green Russula and other Amanita and ring-shaped mushrooms. Specifically, they include: sub-sparse-girdle Russula (R.subnigricans), sparse-girdle black Russula (R.nigricans), dense-girdle Russula (R.densifolia), Japanese Russula (R.japonica Hongo), poisonous Russula (R.emetica), copper-green Russula (R.aeruginea), water chestnut Russula (R.vesca), pestle-handled Amanita (A.sinocitrina), small leopard-spotted Amanita (A.parvipantherina), cone-scaled white Amanita (A.virgineoides Bas), gray-folded Amanita (A. griseofolia), checkered Amanita (A. fritillaria), European Amanita (A. oberwinkelerana), A. curtipes, spherical Amanita (A. subglobosa), chicken-fir Amanita (A. caojizong), Java Amanita (A. javanica), leopard Amanita (A. pantherina), A. albidostipes, fleshy brown-scaled ring-shaped mushroom (L. andegavensis), shiitake (L. edodes), and large green-folded umbrella (C. molybdites). After the mushroom samples were collected and dried, they were identified by ITS sequencing and stored at -20℃ for use.
[0072] The above mushroom samples were tested using the method of Example 4, with ddH2O as the blank control, Russula subsparsely girdle as the positive sample, and the other 22 mushroom species as negative samples, including Russula toxicula, Russula densely girdle, Russula sparsely girdle, Russula caltrop, and Russula aeruginosa. The specificity of the LAMP-CRISPR / Cas12a detection method was determined based on the color change and fluorescence signal intensity.
[0073] Test results such as Figure 4 As shown. Figure 4 (a) It can be seen that the reaction tubes corresponding to the ddH2O blank control (No.1) and the other 22 mushroom species (No.2-23) did not change color under UV irradiation, while the reaction tube of Russula subsparsely glabrous (No.24) showed green fluorescence, indicating that LAMP-CRISPR reaction did not occur in the other mushroom species except Russula subsparsely glabrous. Figure 4 (b) is the fluorescence quantification value after amplification of different mushroom species. Only Russula subsparsely glabrous (No. 24) showed a strong fluorescence value, indicating that the method established in the present invention has good specificity.
[0074] Example 6
[0075] Sensitivity analysis
[0076] The genomic DNA of Russula subspecies extracted in Example 5 was diluted in a 10-fold gradient, specifically 10 ng / μL-10 -7 ng / μL, and ddH2O was set as a blank control group. The method of Example 4 was used to detect sample solutions with different dilution ratios, and the sensitivity of the detection method was determined based on the color change and fluorescence signal intensity.
[0077] Test results such as Figure 5 As shown, DNA concentration was 10ng / μL-10 -6 ng / μL, color change and fluorescence value can be observed. When the DNA concentration is diluted to 10 -7 When the concentration of dHO was 0.1 ng / μL and the template was ddH2O, the fluorescence signal was no longer observed and the color no longer changed. No fluorescence signal was generated in the blank, indicating that the detection limit of the LAMP-CRISPR / Cas12a method constructed in the present invention was 1 fg / μL, and the detection sensitivity reached the fg level.
[0078] Example 7
[0079] To verify the applicability of the present invention in actual samples, a situation in which edible mushrooms were mixed with Russula subspecies was simulated. This example simulated the effect of the mushroom mixture and processing on the accuracy of the test results. The specific method is as follows:
[0080] The ground Russula sparsely covered with mushrooms and Lentinus edodes were fully mixed in different mass ratios, with the mass ratios of Russula sparsely covered with mushrooms in the total mixture being 100%, 50%, 25%, 5%, 1%, 0.1%, 0.01% and 0% respectively. 50 mg of mixed mushroom sample was boiled with 1.5 mL of pure water for 15 minutes to simulate the mushroom cooking process. The soup after steaming the mushrooms was directly diluted 10 times, and then the actual sample was measured according to the detection method of Russula sparsely covered with LAMP-CRISPR / Cas12a described in Example 4 to evaluate the applicability of this method in actual samples. The results are as follows: Figure 6 As shown, the method can detect samples containing 0.01% of Russula subsparginea. The results show that the primer set and detection method provided by the present invention can detect trace amounts of Russula subsparginea. Once mushroom poisoning occurs, mushroom fruiting body residue or soup can be collected as samples for detection.
[0081] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. A kit for detecting Russula subsparsely, characterized in that: The kit includes a composition for detecting Russula subsparsely covered, the composition including a LAMP amplification primer set, crRNA and ssDNA probes; the LAMP amplification primer set includes an outer primer, an inner primer and a loop primer; the nucleotide sequences of the outer primers are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively; The nucleotide sequences of the inner primers are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively; the nucleotide sequences of the loop primers are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively; the nucleotide sequence of the crRNA is shown in SEQ ID NO.7; the nucleotide sequence of the ssDNA probe is TTATT; The ssDNA probe is modified with a fluorescent group and a quenching group at the same time; The molar concentration ratio of the outer primer, inner primer and loop primer is 3:32:16, and the molar concentration ratio of the crRNA and ssDNA probe is 6:25; The kit also includes LAMP reaction buffer, dNTPs, BstDNA polymerase, LbCas12a enzyme, CRISPR reaction buffer and MgSO4 solution; The LAMP reaction buffer includes 20mM Tris-HCl, 10mM (NH4)2SO4, 50mM KCl, 2mM MgSO4 solution and 0.1% Tween20; The molar concentration ratio of the crRNA and LbCas12a enzyme is 6:
2.
2. Use of the kit according to claim 1 in detecting Russula subsparsely.
3. Use of the kit according to claim 1 in the preparation and detection of Russula subsparsely covered products.
4. A method for detecting Russula subsparsely covered, characterized in that: The method comprises the following steps: extracting DNA of a sample to be tested, detecting it with the kit according to claim 1, mixing the DNA with a LAMP reaction mixture, adding paraffin oil, centrifuging, and performing LAMP amplification at 62° C. for 40 minutes; after the amplification, adding a CRISPR / Cas12a reaction solution, incubating at 37° C. for 10-20 minutes, and the appearance of green fluorescence under ultraviolet irradiation or an S-shaped curve of real-time fluorescence PCR indicating that the sample to be tested contains Russula subsparsely populated; the LAMP reaction mixture contains the LAMP amplification primer set in the kit according to claim 1; and the CRISPR / Cas12a reaction solution contains the crRNA and ssDNA probes in the kit according to claim 1.
Citation Information
Patent Citations
CrRNA for detecting novel bunyavirus, CRISPR-Cas12a system and application
CN113755646A
Multiple primer group for simultaneously identifying three types of highly toxic mushrooms, kit and detection method
CN116042892A