Xenotransplantation donor pig without FNDC1 gene expression and preparation method thereof

Knocking out the FNDC1 gene of pigs through the CRISPR-Cas9 system solves the problem of immune rejection in xenografts, extends the survival time of xenograft donors, and improves the success rate of xenografts.

CN116889215BActive Publication Date: 2025-08-22CHONGQING JITANG BIOTECHNOLOGY RES INST CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310844016.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-07-11
Publication Date
2025-08-22
Estimated Expiration
2043-07-11

AI Technical Summary

Technical Problem

There is a severe immune rejection reaction in existing xenografts, which affects the long-term survival of pig tissues or organs after implantation, mainly caused by unknown risk factors caused by the FNDC1 gene.

Method used

The FNDC1 gene of pigs was knocked out or silenced by the CRISPR-Cas9 gene editing system, making it non-expressed in donor tissues and organs, reducing the binding ability to human recipients' IgG and IgM, and improving resistance to human complement-mediated cytotoxicity.

Benefits of technology

It effectively extends the survival time of donor tissues and organs after xenograft, reduces the risk of immune rejection, and improves the feasibility of xenograft.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116889215B_ABST
    Figure CN116889215B_ABST
Patent Text Reader

Abstract

The present invention provides a xenotransplantation donor pig that does not express the FNDC1 gene and a preparation method thereof. The FNDC1 gene can cause the risk of xenogeneic immune rejection. The FNDC1 gene is also knocked out using the CRISPR / Cas9 system, and it is verified that the lack of FNDC1 gene expression can effectively reduce the binding ability of the donor pig's organs, tissues and / or cells with the recipient's IgG and IgM, improve the ability of the donor pig's organs, tissues and / or cells to resist the recipient's complement-mediated cytotoxicity, and prolong the survival time of the recipient of the donor pig's organs, tissues and / or pig cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application belongs to the field of animal genetic engineering, and specifically relates to a xenotransplantation donor pig that does not express the FNDC1 gene and a preparation method thereof. Background Art

[0002] Xenotransplantation of organs, tissues, and cells from donors of different species can effectively address the shortage of human donors. Advantages of xenotransplantation over autologous and allogeneic transplantation include predictable, non-emergency supply, production in a controlled environment, and availability for characterization and research prior to transplantation. As documented in numerous literatures, among xenotransplantation donor animal models, pigs have been the focus of most research in the field of xenotransplantation because they share many anatomical and physiological characteristics with humans. Pigs also have a relatively short gestation period, can be bred in a pathogen-free environment, and may not present the same ethical issues associated with animals not typically used as a food source. However, current research suggests that immune rejection reactions are significantly more severe when pig organs are transplanted into humans than with autologous and allogeneic transplants due to the presence of numerous unknown risk factors for immune rejection that affect the long-term survival of pig tissues or organs after implantation, including the presence of foreign genes that may cause rejection.

[0003] Current research on the FNDC1 gene is as follows: FNDC1 (Fibronectin Type III Domain Containing 1) is an important extracellular matrix protein that regulates cell proliferation, migration, and apoptosis. Within the inflammatory microenvironment of tumor cells, it contributes to tumor metastasis and spread. Downregulation of FNDC1 inhibits cancer cell proliferation, colony formation, migration, and invasion. FNDC1 is often highly expressed in cancer cells and functions as an oncogene. Silencing FNDC1 reduces the expression of matrix metalloproteinases and epithelial-mesenchymal markers and also inactivates the PI3K / Akt signaling pathway. FNDC1 also participates in angiogenesis in vascular endothelial cells, specifically in regulating the distribution and trafficking of vascular endothelial growth factor receptor 2 (VEFR-2), which has strong tyrosine kinase activity, and is a direct factor influencing angiogenesis. By binding to VEGFR-2, VEGF dimerizes the receptor, directly inhibiting its activity and interfering with the transmission of downstream signaling molecules, thereby inhibiting angiogenesis. FNDC1 is a pathogenic gene of acute otitis media in children and has a certain correlation with hypertension. FNDC1 may be related to inflammation in the body. Summary of the Invention

[0004] Research conducted by the present invention has found that the FNDC1 gene can cause the risk of xenotransplant rejection. FNDC1 gene deficiency can effectively reduce the ability of donor tissues and / or organ cells to bind to recipient IgG and IgM, improve their ability to resist complement-mediated cytotoxicity, and prolong the survival of donor tissues and / or organs after xenotransplantation. According to the present invention, a xenotransplantation donor pig is provided, wherein the organs, tissues, or cells of the donor pig do not express the FNDC1 gene, and the recipient is a human.

[0005] The non-expression of the FNDC1 gene described in the present invention can be achieved by gene knockout, gene knock-in, point mutation, deletion mutation, or a combination thereof.

[0006] The non-expression of the FNDC1 gene described in the present invention can be achieved by gene silencing.

[0007] The gene knockout described in the present invention is achieved by the CRISPR-Cas9 gene knockout system. The system includes an FNDC1 gene knockout vector, including vector one and vector two. The vector one is connected to sgRNA A1, and the specific targeting sequence of the sgRNA1 is TATGTCGTCACAGTCTGTGC; the vector two is connected to sgRNA2, and the specific targeting sequence of the sgRNA2 is CACAGTGCGC TACCGAGAGA.

[0008] The method for constructing the FNDC1 gene knockout vector of the present invention is as follows:

[0009] The nucleotide sequence of the gene encoding the synthesized sgRNA1 is shown in SEQ ID NO. 1, and its complementary strand is shown in SEQ ID NO. 2. The single-stranded sgRNA DNA sequences are then annealed to form sgRNA1 oligonucleotide chains; the oligonucleotides are then ligated into the PX330 plasmid vector;

[0010] The nucleotide sequence of the gene encoding the synthesized sgRNA2 is shown in SEQ ID NO.3, and its complementary chain is shown in SEQ ID NO.4. The single-stranded sgRNA DNA sequence is then annealed to form an sgRNA2 oligonucleotide chain; the oligonucleotide is then ligated into the PX330 plasmid vector.

[0011] The FNDC1 gene knockout vector of the present invention is introduced into transformed cells, and the transformed cells are used to prepare donor pigs for xenotransplantation. The FNDC1 gene is not expressed in the organs, tissues or cells of the donor pigs.

[0012] The present invention also provides a method for preparing a xenotransplantation donor, comprising transplanting the transformed cells into a denuclearized egg cell to form a nuclear transplanted egg, and then transplanting the nuclear transplanted egg into the fallopian tube of a surrogate mother.

[0013] The present invention also provides a method for delaying, reducing or preventing rejection, separation or adverse reactions to xenotransplanted organs or tissues in human recipients, wherein the method comprises genetically modifying the FNDC1 gene of the donor pig tissue or organ so that the FNDC1 gene is not expressed in the donor pig or the donor pig tissue or organ.

[0014] The xenotransplantation donor organ of the present invention includes liver, lung, kidney or skin.

[0015] The xenotransplant donor tissue of the present invention includes nerves.

[0016] The present invention also provides a transformed cell, which is used to prepare the above-mentioned xenotransplantation donor, and the transformed cell is introduced with an FNDC1 gene knockout vector.

[0017] The beneficial effects are as follows:

[0018] The present invention discovers for the first time that the FNDC1 gene can cause the risk of xenotransplant rejection. Based on this, a xenotransplant donor is provided in which the FNDC1 gene is not expressed in the xenotransplant donor through gene knockout or gene silencing. The FNDC1 gene deficiency can effectively reduce the binding ability of donor tissue and / or organ cells to human recipient IgG and IgM, improve the ability of donor tissue and / or organ cells to resist complement-mediated cytotoxicity of the human recipient, and prolong the survival time of the donor tissue and / or organ after xenotransplantation.

[0019] The present invention also uses the CRISPR / Cas9 system to design dual sgRNA to knock out the FNDC1 gene. The obtained gene knockout cell line can be used as a donor for somatic cell nuclear transplantation. It is verified that after FNDC1 knockout, the binding ability of pig kidney cells to human IgG and IgM can be effectively reduced, and the ability of pig kidney cells to resist human complement-mediated cytotoxicity can be improved, providing a favorable research tool for in-depth exploration of the biological function of the FNDC1 gene.

[0020] Knockout of the risk factor FNDC1 gene identified in the present invention increases the probability of xenogeneic cell survival and further improves the feasibility of xenotransplantation. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the identification diagram of positive clone cells with FNDC1 gene knockout;

[0022] Figure 2This is a graph showing the cell survival of wild pig kidney cells and FNDC1 knockout pig kidney cells after incubation with human serum;

[0023] Figure 3 This is a graph showing the binding ability of wild pig kidney cells and FNDC1 knockout pig kidney cells to human IgG and IgM. DETAILED DESCRIPTION

[0024] The present invention is further described by way of examples below, which do not limit the present invention in any way. Without departing from the technical solution of the present invention, any modification or alteration of the present invention that can be easily implemented by a person skilled in the art will fall within the scope of the claims of the present invention.

[0025] Example 1: Construction of FNDC1 gene knockout vector.

[0026] FNDC1 gene knockout in porcine kidney cells was achieved using the CRISPR / Cas9 system, using sgRNAs including sgRNA1 and sgRNA2. The DNA sequence of sgRNA1 is shown in SEQ ID NO: 1, and the DNA sequence of its complementary strand is shown in SEQ ID NO: 2; the DNA sequence of sgRNA2 is shown in SEQ ID NO: 3, and the DNA sequence of its complementary strand is shown in SEQ ID NO: 4.

[0027] Two sgRNA sequences targeting the porcine FNDC1 gene (NCBI accession number: 100154276) were designed.

[0028] sgRNA-F1 sequence: 5-CACCTATGTCGTCACAGTCTGTGC-3; SEQ ID NO: 1 sgRNA-R1 sequence: 5-AAACGCACAGACTGTGACGACATA-3; SEQ ID NO: 2sgRNA-F2 sequence: 5-CACCCACAGTGCGCTACCGAGAGA-3; SEQ ID NO: 3sgRNA-R2 sequence: 5-AAACTCTCTCGGTAGCGCACTGTG-3. SEQ ID NO: 4

[0029] The synthesis steps of the designed sgRNA sequence are as follows: the DNA sequences of the four single-stranded sgRNAs are annealed to form two oligonucleotide chains of sgRNAs targeting different sites of the porcine FNDC1 gene; then the oligonucleotides are connected into the PX330 plasmid vector to obtain the FNDC1 gene knockout vector.

[0030] Example 2: Preparation of FNDC1 gene knockout pig kidney cells.

[0031] After sequencing and verifying the constructed sgRNA expression vector, the target plasmid was extracted and ethanol precipitated. The purified sgRNA expression vector at a certain concentration was introduced into pig kidney cells via electroporation. After 12 hours of culture, the medium was changed. After 72 hours, the genome of each group of cells was extracted. Cell clones were obtained by limiting dilution. PCR reactions were then performed using specific primers. The PCR products were analyzed by agarose gel electrophoresis or sequencing. The sgRNA cleavage status of the cells was evaluated by sequencing peak analysis to obtain positive pure and knockout clones. Figure 1 .

[0032] Example 3: Detecting the resistance of FNDC1 knockout pig kidney cells to human complement-mediated cytotoxicity.

[0033] When the confluence of wild-type and FNDC1 knockout pig kidney cells reached approximately 70%, human serum was diluted in DMEM at a ratio of 1:3 and incubated with the cells. After 45 minutes, the supernatant was discarded, the cells were washed twice with PBS, and then stained with PI propidium iodide for 10 minutes. Cell death was then detected by flow cytometry. Figure 2 : Compared with PK cells, after incubation with 75% serum, FNDC1 gene knockout cells can significantly reduce the toxicity of human serum to pig cells.

[0034] Example 4: Detecting the binding ability of FNDC1 knockout pig kidney cells to human IgG and IgM.

[0035] Wild-type and FNDC1 knockout pig kidney cells were trypsinized and placed in a 1.5 mL centrifuge tube. The cells were washed twice with PBS. Human serum inactivated at 56°C for 1 hour was diluted 1:4 with PBS and incubated with the cells at room temperature. After 30 minutes, the cells were washed twice with PBS and fluorescently labeled human IgG or IgM antibodies were added at a dilution of 1:200 and incubated at room temperature for 30 minutes. After washing with PBS, the binding capacity of FNDC1 knockout pig kidney cells to human IgG and IgM was detected by flow cytometry. Figure 3 Compared with PK cells, FNDC1 knockout cells showed significantly reduced binding to human IgG or IgM.

[0036] The above examples show that knocking out the FNDC1 gene can effectively reduce the binding ability of pig kidney cells to human IgG and IgM, and improve the ability of pig kidney cells to resist human complement-mediated cytotoxicity.

[0037] The present invention also verifies the resistance of FNDC1 gene knockout pig lung cells and pig liver cells to human complement-mediated cytotoxicity and the ability to bind to human IgG and IgM through examples, and obtains the same conclusion as the pig kidney cell experiment.

[0038] The present invention also verifies through examples the resistance of FNDC1 gene-silenced pig kidney cells to human complement-mediated cytotoxicity and their ability to bind to human IgG and IgM, and obtains the same experimental conclusions as the gene knockout method.

[0039] The present invention also obtains transgenic pigs through the preparation method of transgenic pigs for xenotransplantation, transplants pig kidney, lung or liver cells with FNDC1 gene knockout into denuclearized oocytes to form cell nucleus transplanted eggs, and transplants the obtained cell nucleus transplanted eggs into the oviduct of a surrogate pig, and the pregnant sows give birth to transgenic piglets for xenotransplantation. The piglets are used as donor animals for xenotransplantation of organs and cells between species.

[0040] Therefore, the transgenic cloned pigs of the present invention can be used as donor animals for organ and cell transplantation between different species.

[0041] The vectors of the present invention may contain primer sequences, for example, a CAG promoter. Furthermore, any promoter capable of mammalian expression, such as the EF1α promoter, which is generally considered equivalent to the CAG promoter, may also be used. Furthermore, mammalian tissue-specific promoters, such as the ICAM2 promoter, may be used to express foreign genes using the CAG promoter as one type of gene expression promoter.

[0042] In the present invention, "transgenic" refers to the process of introducing DNA into a host and making it replicable as an extrachromosomal factor or through chromosomal integration. Transgenic includes any method for introducing nucleic acid molecules into an organism, cell, tissue or organ. It can be carried out by selecting appropriate standard techniques known in the relevant field according to the host cell, for example, including electroporation, calcium phosphate precipitation, calcium chloride precipitation, microinjection, polyethylene glycol method, DEAE-dextran method, cationic liposome method and lithium acetate-dimethyl sulfoxide method, but not limited to these. In order to distinguish the transformation of eukaryotic cells by plasmid or non-plasmid naked DNA from the transformation meaning of tumorization of cells, it is also called "transfection", which has the same meaning in the present invention.

[0043] The present invention provides a method for preparing a transgenic pig for xenotransplantation and a transgenic cloned pig for xenotransplantation produced by the method, comprising the steps of transplanting the transformed cell into a denuclearized oocyte to form a nucleus-transplanted egg; and transplanting the nucleus-transplanted egg into the oviduct of a surrogate mother.

[0044] In the present invention, "nuclear transplantation" refers to a gene manipulation technique that artificially combines the nuclear DNA of other cells with cells without nuclei to form the same traits, and methods known in the technical field to which the present invention belongs can be used.

[0045] In the present invention, "nuclear transplanted oocyte" refers to an oocyte into which a donor cell has been introduced or fused.

[0046] In the present invention, the "enucleated oocyte" refers to an oocyte from which the nucleus has been removed.

[0047] In the present invention, the term "organ" refers to a collection of tissues connected in a structural unit to perform a common function. An organ can be a solid organ. A solid organ is an internal organ with a fixed tissue consistency that is neither hollow (such as gastrointestinal organs) nor liquid (such as blood). Examples of solid organs include the heart, kidney, liver, lung, pancreas, spleen, and adrenal gland.

[0048] In the present invention, the term "tissue" refers to the cellular organization level intermediate between cells and organs. Tissue is a population of similar cells from the same origin that perform a specific function together. Organs are then formed by the functional aggregation of multiple tissues. Examples of tissues considered by the present invention include, but are not limited to, connective tissue, muscle tissue, neural tissue, epithelial tissue, and mineralized tissue. Blood, bones, tendons, ligaments, fat, and cellulite are examples of connective tissue, which can also be divided into fibrous connective tissue, skeletal connective tissue, and fluid connective tissue. Muscle tissue is divided into three different categories: visceral or smooth muscle, which is found in the inner walls of organs; skeletal muscle, which is usually attached to bones and produces large-scale movements; and cardiac muscle, which is found in the heart and contracts to pump blood through the organism. Cells containing central nervous system and peripheral nerve cells are classified as neural (or nerve) tissue. In the central nervous system, neural tissue forms the brain and spinal cord. In the peripheral nervous system, neural tissue forms cranial nerves and spinal nerves, including motor neurons.

[0049] As used herein, the terms "transformation" and "transfection" refer to the process by which exogenous nucleic acid is transferred or introduced into a host cell. A "transformed" cell is one that has been transfected, transformed, or transduced with an exogenous nucleic acid. Such cells include the subject's primary cell and its progeny.

[0050] The present invention will be described in detail below by way of examples. The following examples are only provided to illustrate the present invention, and the present invention is not limited to the following examples.

Claims

1. A method for preparing transgenic donor pigs for xenotransplantation, characterized in that: The method comprises transplanting the transformed cells into a denuclearized oocyte to form a nuclear transplanted egg, and transplanting the nuclear transplanted egg into the oviduct of a surrogate mother; The transformed cells are introduced with FNDC1 Gene knockout vectors, transformed cells are used to prepare donor pigs for xenotransplantation; The donor pig FNDC1 Gene not expressed; The FNDC1 The gene knockout vector includes vector 1 and vector 2; the vector 1 is connected to sgRNA1, whose specific targeting sequence is TATGTCGTCACAGTCTGTGC; the vector 2 is connected to sgRNA2, whose specific targeting sequence is CACAGTGCGCTACCGAGAGA; The FNDC1 Gene non-expression is achieved by gene knockout, gene knock-in, point mutation, deletion mutation, or a combination thereof, or by gene silencing; The recipient of the organs, tissues or cells of the xenotransplantation donor pig is a human.

Citation Information

Patent Citations

  • Method for constructing chicken model for transgenosis and production exogenous protein

    CN101352157A

  • Method for constructing heterogeneous organ transplantation base donor pigs

    CN110373390A