Wastewater biochemical treatment device and method based on online proliferation of microorganisms

Abstract

The application discloses a wastewater biochemical treatment device and method based on online proliferation of microorganisms, and the device comprises an AO tank, a secondary sedimentation tank connected to the outlet end of the AO tank through a pipeline, a base liquid conditioning tank connected to the outlet end of the A tank of the AO tank, a biological proliferation tank connected to the outlet end of the base liquid conditioning tank, a water outlet tank connected to the outlet end of the biological proliferation tank, and the outlet end of the water outlet tank being communicated with the water inlet end of the O tank of the AO tank, and the outlet end of the water outlet tank being further connected to the inlet end of the base liquid conditioning tank through a pipeline, and the biological proliferation tank being connected with a bacterial population adding device, and further comprising a device room for installing the device and an intelligent control system for controlling the device. The application selects and constructs a high-efficiency anti-reverse-degradation functional bacterial population, and adopts an online proliferation device of the functional bacterial population to continuously maintain the concentration and activity of the functional bacterial population in the indigenous bacterial population of a biochemical system, and stably improves the treatment efficiency of a biochemical unit.

Description

Technical Field

[0001] This invention relates to the field of wastewater treatment technology, and in particular to a wastewater biochemical treatment device and method based on online microbial proliferation. Background Technology

[0002] Wastewater from chemical industrial parks is characterized by high biotoxicity, low biodegradability, complex composition, and the presence of multiple sources of organic pollutants, making it one of the most difficult types of wastewater to treat. Currently, the main problems facing the treatment of wastewater from chemical industrial parks include: high cost of physicochemical methods and severe secondary pollution; inhibition of the physiological and biochemical activity of microorganisms in the biochemical system by multiple sources of organic pollutants; and dysbiosis of the microbial community in the biochemical system, resulting in low degradation efficiency and poor process stability in the A / O process. While traditional bioaugmentation technology using engineered bacteria can rapidly improve the degradation efficiency of the biochemical system, the engineered bacteria quickly die off due to their natural disadvantage in competing with the native bacteria in the wastewater, thus affecting the degradation effect. Summary of the Invention

[0003] Based on the technical problems existing in the background technology, the present invention proposes a wastewater biochemical treatment device and method based on online microbial proliferation, which screens and constructs highly efficient stress-resistant and degradation-resistant functional bacterial communities, and uses an online proliferation device for functional bacterial communities to continuously maintain the concentration and activity of functional bacterial communities in the indigenous bacterial communities of the biochemical system, thereby steadily improving the treatment efficiency of the biochemical unit.

[0004] The wastewater biochemical treatment device based on online microbial proliferation proposed in this invention includes an AO tank, the outlet of which is connected to a secondary sedimentation tank via a pipeline, the outlet of the A tank of the AO tank is connected to a base liquid conditioning tank, the outlet of the base liquid conditioning tank is connected to a biological proliferation tank, the outlet of the biological proliferation tank is connected to an effluent tank, the outlet of the effluent tank is connected to the inlet of the O tank of the AO tank, and the outlet of the effluent tank is also connected to the inlet of the base liquid conditioning tank via a pipeline. The biological proliferation tank is connected to a microbial dosing device. The device also includes an equipment room for installing the equipment and an intelligent control system for controlling the equipment.

[0005] Preferably, the base liquid conditioning tank is connected to an inlet and an outlet valve. A grid device for supplementing carbon sources for microorganisms is installed inside the base liquid conditioning tank. Sliding rails are slidably connected to both sides of the grid device. The sliding rails are fixedly connected to the base liquid conditioning tank. A lifting bolt is installed at the upper end of the grid device. The grid device can be lifted into / out of the base liquid conditioning tank by a crane. A cover plate is also installed at the upper end of the base liquid conditioning tank.

[0006] Preferably, the base liquid conditioning tank is connected to a water distribution pipe, the upper end of which has several through holes, and the water distribution pipe is located below the grid device.

[0007] Preferably, the sliding rail is provided with a water outlet weir plate on one side, the height of the water outlet weir plate is lower than the sliding rail, and a plurality of through holes are formed in the sliding rail, the water outlet weir plate and the base liquid conditioning tank form a flow guide cavity, and the water outlet pipe valve is communicated with the flow guide cavity.

[0008] Preferably, the biological proliferation tank comprises a shell, the inside of the shell is horizontally separated into a flow guide area, an aeration area and a reflux area in sequence, the flow guide area is connected with a water inlet pipe, the aeration area is provided with an aeration disc and elastic filler, the elastic filler is located above the aeration disc, the reflux area is further provided with an inclined reflux inclined plate at the lower end communicated with the aeration area, and the reflux area is further connected with a water outlet pipe; the shell is communicated with an air pipe on one side; and the shell is provided with a handrail on the top.

[0009] Preferably, a flow guide wall is arranged between the flow guide area and the aeration area, and the lower end of the flow guide wall is opened to communicate the flow guide area and the aeration area.

[0010] Preferably, a water outlet weir plate is arranged between the aeration area and the reflux area, and the upper end and the lower end of the water outlet weir plate are both opened to communicate the aeration area and the reflux area and form a reflux channel, and the inclined reflux inclined plate is arranged at the lower end opening of the water outlet weir plate.

[0011] The treatment method of the above-mentioned wastewater biochemical treatment device based on online microorganism proliferation provided by the application is as follows:

[0012] S1: performing metagenome sequencing on wastewater to determine the microbial flora in the wastewater;

[0013] S2: taking the effluent of the A tank of the AO tank as a culture medium liquid for domestication and solidification of the microbial flora, and conveying the culture medium liquid to a base liquid conditioning tank for conditioning;

[0014] S3: conveying the conditioned base liquid from the base liquid conditioning tank to the microorganism proliferation tank, and adding the microbial flora to the microorganism proliferation tank to domesticate and solidify the microbial flora, and performing biochemical treatment on the wastewater by the microbial flora;

[0015] S4: conveying the wastewater treated by the biochemical treatment to the O tank of the AO tank through the water outlet tank, and then conveying the wastewater to the secondary sedimentation tank, and the wastewater treated by the secondary sedimentation tank can enter the next process.

[0016] Preferably, the solid conditioning agent for base liquid conditioning in S2 is mixed by poly-3-hydroxyvalerate, fumaric acid and malic acid in a mass ratio of 4-8:1-3:1.

[0017] The application has the following beneficial technical effects:

[0018] (1) The wastewater treatment method of the present application is suitable for solving the problem of low sludge concentration and poor degradation effect in the biochemical system of the built or newly built chemical industry park comprehensive wastewater treatment project. Based on the research and development of the ecological synthesis of microorganisms in the biochemical tank of the comprehensive wastewater of the chemical industry park, the functional microbial population of the high-efficiency degradation of the organic pollutants of the comprehensive wastewater of the chemical industry park is constructed and introduced into the aerobic section of the A / O process of the biological unit of the comprehensive wastewater of the chemical industry park to redesign the biological system, so as to achieve the high-efficiency biological removal of the organic pollutants.

[0019] (2) The grid device of the present application is connected with the sliding track in the base fluid conditioning tank, and the device can be separated from the base fluid conditioning tank by the crane, which facilitates the filling of the solid carbon source in the grid device; the outlet weir plate is arranged on one side of the sliding track, the height of the outlet weir plate is lower than the sliding track, and the sliding track is provided with a through hole, the wastewater in the base fluid conditioning tank flows into the flow guide cavity through the through hole which is higher than the outlet weir plate, so as to avoid the problem of pipeline blockage caused by the solid particles entering the flow guide cavity; the water inlet is connected with a water distribution pipe, a plurality of through holes are formed in the upper end of the water distribution pipe, and the water distribution pipe is located below the grid device, so as to improve the dissolution efficiency of the solid carbon source.

[0020] (3) The present application sets the aeration disc in the aeration zone, and sets the inclined plate at the bottom of the reflux zone, under the synergistic effect of the aeration disc and the inclined plate, the bacteria liquid in the device is uniformly mixed, the formation and settlement of the agglomerates or sludge are avoided to the greatest extent, the outlet pipe is connected with the sewage biochemical unit, the functional microbial population is continuously supplied to the biochemical unit, so as to effectively improve the energy efficiency of the removal of the sewage pollutants (COD, total nitrogen, nitrate nitrogen and ammonia nitrogen, etc.). BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 The structure diagram of the wastewater biochemical treatment device based on online proliferation of microorganisms is provided in the present application;

[0022] Figure 2 The structure diagram of the base fluid conditioning tank is provided in the present application;

[0023] Figure 3 The structure diagram of the biological proliferation tank is provided in the present application.

[0024] In the figure: 1-AO tank, 2-secondary sedimentation tank, 3-liquid conditioning tank, 31-hanging bolt, 32-sliding rail, 33-water inlet, 34-water distribution pipe, 35-water outlet valve, 36-grid device, 37-water outlet weir plate, 38-cover plate, 39-crane, 4-bacterial population adding device, 5-biological proliferation tank, 51-housing, 52-water inlet pipe, 53-flow guide area, 54-flow guide wall, 55-elastic filler, 56-aeration disc, 57-aeration area, 58-backflow inclined plate, 59-backflow area, 510-air pipe, 511-water outlet pipe, 512-water outlet weir plate, 513-railing, 6-water outlet tank, 7-intelligent control system, 8-equipment room. DETAILED DESCRIPTION

[0025] The application will be further described below in combination with specific examples.

[0026] Example 1

[0027] Referring to Figure 1 , the wastewater biochemical treatment device based on online proliferation of microorganisms provided by the application comprises an AO tank 1, the outlet end of the AO tank 1 is connected with a secondary sedimentation tank 2 through a pipeline, the A tank outlet end of the AO tank 1 is connected with a base liquid conditioning tank 3, the outlet end of the base liquid conditioning tank 3 is connected with a biological proliferation tank 5, the outlet end of the biological proliferation tank 5 is connected with a water outlet tank 6, the outlet end of the water outlet tank 6 is communicated with the O tank water inlet end of the AO tank 1, the outlet end of the water outlet tank 6 is also connected with the inlet end of the base liquid conditioning tank 3 through a pipeline, the biological proliferation tank 5 is connected with a bacterial population adding device 4, and the device further comprises an equipment room 8 for installing equipment and an intelligent control system 7 for controlling the equipment.

[0028] The wastewater treatment method of the application is suitable for solving the problems of low sludge concentration and poor degradation effect in the biochemical system of the comprehensive wastewater treatment project of the built or newly built chemical industry park. Based on the research and development of the ecological synthesis of microorganisms in the biochemical tank of the comprehensive wastewater of the chemical industry park, the functional bacterial population for efficient degradation of organic pollutants of the comprehensive wastewater of the chemical industry park is constructed and introduced into the aerobic section of the A / O process of the biological unit of the comprehensive wastewater of the chemical industry park to redesign the biological system, so as to achieve efficient biological removal of organic pollutants.

[0029] Referring to Figure 2, specifically, the base fluid conditioning tank 3 is connected with the water inlet 33 and the water outlet pipe valve 35, the grid device 36 for supplementing carbon source of microorganism is arranged in the base fluid conditioning tank 3, the grid device 36 is slidably connected with the sliding rail 32 on both sides, the sliding rail 32 is fixedly connected with the base fluid conditioning tank, and the upper end of the grid device 36 is provided with the lifting bolt 31; the grid device 36 is lifted away from / put into the base fluid conditioning tank 3 by the crane 39, and the upper end of the base fluid conditioning tank 3 is also provided with the cover plate 38; the base fluid conditioning tank 3 is connected with the water distribution pipe 34, a plurality of through holes are formed in the upper end of the water distribution pipe 34, and the water distribution pipe 34 is located below the grid device 36; the sliding rail 32 is provided with the water outlet weir plate 37 on one side, the height of the water outlet weir plate 37 is lower than that of the sliding rail 32, a plurality of through holes are formed in the sliding rail 32, the water outlet weir plate 37 and the base fluid conditioning tank 3 form a flow guide cavity, and the water outlet pipe valve 35 communicates with the flow guide cavity.

[0030] The grid device of the present application is slidably connected with the sliding rail in the base fluid conditioning tank, the device can be separated from the base fluid conditioning tank by the crane, the filling of the solid carbon source in the grid device is facilitated, the water outlet weir plate is arranged on one side of the sliding rail, the height of the water outlet weir plate is lower than that of the sliding rail, and a plurality of through holes are formed in the sliding rail, the wastewater in the base fluid conditioning tank flows into the flow guide cavity through the through holes higher than the water outlet weir plate, and the problem that the solid particles enter the flow guide cavity and cause pipeline blockage is avoided, the water inlet is connected with the water distribution pipe, a plurality of through holes are formed in the upper end of the water distribution pipe, and the water distribution pipe is located below the grid device, so that the dissolution efficiency of the solid carbon source is improved.

[0031] Referring to Figure 3 , specifically, the biological proliferation tank 5 comprises a shell 51, the inside of the shell 51 is horizontally separated into a flow guide area 53, an aeration area 57 and a reflux area 59 in sequence, the flow guide area 53 is connected with a water inlet pipe 52, the aeration area 57 is provided with an aeration disc 56 and an elastic filler 55, the elastic filler 55 is located above the aeration disc 56, the reflux area 59 is further connected with a water outlet pipe 511, and the reflux area 59 is provided with an inclined reflux inclined plate 58 at the lower end communicating portion of the aeration area 57; one side of the shell 51 is communicated with an air pipe 510; the top of the shell 51 is provided with a handrail 513; a flow guide wall 54 is arranged between the flow guide area 53 and the aeration area 57, and the lower end of the flow guide wall 54 is opened to communicate the flow guide area 53 and the aeration area 57; a water outlet weir plate 512 is arranged between the aeration area 57 and the reflux area 59, and the upper end and the lower end of the water outlet weir plate 512 are both opened to communicate the aeration area 57 and the reflux area 59 and form a reflux channel, and the inclined reflux inclined plate 58 is arranged at the lower end opening of the water outlet weir plate 512.

[0032] The present application is characterized in that an aeration disc is arranged in the aeration zone, and an inclined plate is arranged at the bottom of the reflux zone, and the bacteria liquid in the device is uniformly mixed under the synergistic action of the aeration disc and the inclined plate, so that the formation and settlement of agglomerates or sludge are avoided to the greatest extent, the effluent pipe is connected to the sewage biochemical unit, and the function bacteria group is continuously supplied to the biochemical unit, so that the energy efficiency of removing sewage pollutants (COD, total nitrogen, nitrate nitrogen and ammonia nitrogen, etc.) is effectively improved.

[0033] Example 2

[0034] The treatment method of the above-mentioned wastewater biochemical treatment device based on online proliferation of microorganisms according to the present application is as follows:

[0035] 1. Composition characteristics of indigenous microorganism group of biochemical unit in chemical industry park

[0036] The wastewater of the aerobic biochemical unit in a chemical industry park is subjected to metagenomic sequencing by using an Illumina sequencing platform, and the indigenous microorganism group of the biochemical unit in the chemical industry park mainly includes 60% Proteobacteria (Proteobacteria), 18% Planctomycetes (Planctomycetes), 6% Nitrospirae (Nitrospirae) and 4% Acidobacteria (Acidobacteria);

[0037] 2. Domestication and solidification of function bacteria group

[0038] The domestication and solidification of the bacteria group are carried out in the proliferation device. The effluent of the biochemical system A pool in the chemical industry park is used as the base liquid, and the base liquid is conditioned by using a solid conditioner; the conditioned base liquid is used for domestication and solidification of the function bacteria, and the specific steps are as follows:

[0039] (1) The effluent of the biochemical system A pool in the chemical industry park is used as the culture medium for domestication and solidification of the bacteria group. The effluent of the biochemical system A pool is pumped into the conditioning zone of the proliferation device, and the conditioning zone is composed of a water distribution zone, a solid filler zone and an effluent zone. The A pool effluent is uniformly distributed by the bottom water distribution pipe, and then rises into the solid filler zone and the effluent zone in turn to complete the conditioning of the base liquid.

[0040] The solid conditioner is filled in the grid device, and the filling volume of the solid conditioner is related to the conditioning water volume. The effective contact time of the wastewater and the solid conditioner is required to be 2h. The composition of the solid conditioner is poly-3-hydroxyvalerate, fumaric acid and malic acid (mass fraction 3:1:0.5); when the consumption of the slow-release solid nutrient exceeds 50%, the solid nutrient is supplemented to the filler layer in time.

[0041] (2) Domestication and solidification of function bacteria group

[0042] The base liquid after conditioning is transported from the base liquid conditioning tank to the biological proliferation tank, which is composed of a flow guide area, a bottom aeration system, a filler area, a water outlet area and a water outlet circulating pump. At the same time, the microbial flora is added to the biological proliferation tank for domestication and solidification of the microbial flora, and biochemical treatment of the wastewater is carried out through the microbial flora; after the base liquid fills 3 / 5 of the effective tank volume of the biological proliferation area, the water inlet is stopped, and the aeration device and the circulating pump are started; the first adding amount of the bacterial liquid is 2 / 5 of the effective volume of the biological proliferation tank.

[0043] The control conditions for domestication of the functional flora are as follows: continuous aeration for 72 hours, the dissolved oxygen in the multiplication tank is controlled at 3-4 mg / L, and the dissolved oxygen concentration is controlled through the DO online instrument and the frequency conversion interlocking of the aeration fan; the set flow of the water outlet circulating pump is set according to the mixed liquid in the biological multiplication area, which is circulated once every 2 hours.

[0044] The control conditions for solidification of the functional bacteria are as follows: the reaction conditions are controlled by the PLC system of the equipment. The aeration of the multiplication device is operated intermittently for 96 hours, and the start and stop of the aeration fan is controlled according to 6 hours of aeration and 6 hours of stop. The dissolved oxygen is controlled at 4-6 mg / L during aeration, and the dissolved oxygen concentration is controlled through the DO online instrument and the frequency conversion interlocking of the aeration fan; the flow of the circulating pump is set according to the mixed liquid in the biological multiplication area, which is circulated once every 12 hours.

[0045] The height of the filler area is 2 / 3 of the effective height of the biological proliferation area, and the bottom of the filler area is provided with a gas-water mixing area with a height of not less than 0.8 meters. The filler is a vertical elastic filler made of PP material, and the filler parameters are as follows: Φ150 mm, H=1800 mm, arrangement spacing 150 mm, and the fillers are uniformly distributed in the entire filler area. The aeration system is composed of a disc type nano aerator, an aeration fan and a matching pipe valve.

[0046] (3) Online biological proliferation and adding

[0047] After the domestication and solidification of the flora in the proliferation device are completed, the water inlet lifting pump of the biological proliferation tank is started, and the water inlet is taken from the biochemical system A tank. After the water inlet enters the conditioning area through the bottom water distribution pipe, the water outlet after conditioning flows into the flow guide area by itself, uniformly distributes through the filler area from the flow guide area, enters the water outlet area, and the mixed liquid in the water outlet area is lifted into the water inlet end of the biochemical system aerobic tank by the water outlet lifting pump. The flow rates of the water inlet lifting pump and the water outlet lifting pump are consistent, and the pump flow rate is determined according to the treatment scale of the park comprehensive wastewater biochemical system and the organic matter concentration of the water inlet.

[0048] The supplementing period of the flora culture liquid is fed back by the daily operation data monitoring of the biochemical system, mainly monitoring the sludge concentration and the effluent COD of the biochemical system, and supporting regular monitoring of the change of the microbial community in the aerobic tank of the biochemical system, to construct the relationship curve between the activity decline of the combined functional flora and the sludge concentration and the effluent COD of the biochemical system.

[0049] The online biological proliferation and dosing control system is based on sludge concentration, effluent COD data collection and microbial community change analysis input, to establish data relationship curve and microbial activity evaluation model, thereby guiding the complementation cycle of functional microbial flora.

[0050] The microbial samples after the operation of the microbial activation integrated equipment for 10, 30 and 60 days are subjected to high-throughput sequencing analysis. Proteobacteria (Proteobacteria), Planctomycetes (Planctomycetes), Nitrospirae (Nitrospirae) and Acidobacteria (Acidobacteria) are always the dominant flora in the reaction system, so it can be concluded that the indigenous microorganisms in the aerobic biochemical unit always become the dominant flora in the system during the whole reaction process, ensuring the stable operation of the system reaction. At the same time, the total bacterial count in the samples after 10, 30 and 60 days of the wastewater in the aerobic biochemical unit is compared. The total bacterial count (16S rRNA, primer Eub338-F, ACTCCTACGGGAGGCAGCAG; Eub518-R ATTACCGCGGCTGCTGG) measured by quantitative PCR is 2.3×10 5 , 3.6×10 6 and 1.1×10 7 in the wastewater in the aerobic biochemical unit, and 3.2×10 6 , 3.6×10 6 and 1.1×10 7 in the reaction system, indicating that the bacterial count is greatly expanded through the online proliferation of the system, thereby improving the pollutant removal capacity.

[0051] 3. Wastewater post-treatment

[0052] The wastewater after biochemical treatment is transported to the O tank of the AO tank through the effluent tank, and then transported to the secondary sedimentation tank. The wastewater treated by the secondary sedimentation tank can enter the next process.

[0053] In the continuous operation stage, the influent lift pump and the effluent lift pump are started at the same time, and the flow rate of the pump is set to 1% to 3% of the water treatment capacity of the supporting biochemical system. In the normal operation stage, the dissolved oxygen concentration in the biological proliferation tank is controlled to be 2 to 6 mg / L. The dissolved oxygen concentration control is realized through the interlocking of the DO online instrument and the frequency conversion of the aeration fan. The effluent circulating pump is closed. In the normal operation stage, the influent and effluent COD of the supporting biochemical system are analyzed daily, and the change trend of the treatment effect is paid attention to. The concentration of the complemented functional flora in the biological proliferation tank and the concentration of the complemented functional flora in the supporting biochemical system are monitored once a week.

[0054] In the later operation and maintenance stage, in addition to the regular maintenance of moving and static equipment, the following operation parameters should be paid attention to: when the slow-release solid nutrients in the filler layer of the water inlet pool are consumed by more than 50%, the solid nutrients should be supplemented to the filler layer in time; when the effluent COD of the matching biochemical system increases significantly or the concentration of the syntrophic functional bacteria group monitored decreases significantly, the water inlet lifting pump and the water outlet lifting pump should be stopped, and the bacteria liquid adding pump should be started to supplement the fermentation liquid of the syntrophic functional bacteria group. After the completion of the supplementation of the fermentation liquid of the syntrophic functional bacteria group, the equipment is controlled according to the operation parameters in the domestication and solidification stage of the syntrophic functional bacteria group, and finally the water inlet lifting pump and the water outlet lifting pump are started to enter the normal operation stage.

Claims

1. A wastewater biochemical treatment device based on online microbial proliferation, characterized in that, The system includes an AO tank (1), the outlet of which is connected to a secondary sedimentation tank (2) via a pipe, the outlet of the A tank of the AO tank (1) is connected to a base liquid conditioning tank (3), the outlet of the base liquid conditioning tank (3) is connected to a biological propagation tank (5), the outlet of the biological propagation tank (5) is connected to an effluent tank (6), the outlet of the effluent tank (6) is connected to the inlet of the O tank of the AO tank (1), the outlet of the effluent tank (6) is also connected to the inlet of the base liquid conditioning tank (3) via a pipe, the biological propagation tank (5) is connected to a microbial dosing device (4), and also includes an equipment room (8) for installing equipment and an intelligent control system (7) for controlling equipment. The base liquid conditioning tank (3) is connected to an inlet (33) and an outlet valve (35). The base liquid conditioning tank (3) is equipped with a grid device (36) for microbial carbon source supplementation. The grid device (36) is slidably connected to two sides by sliding rails (32). The sliding rails (32) are fixedly connected to the base liquid conditioning tank. The grid device (36) is equipped with a lifting bolt (31) at the upper end. The grid device (36) is lifted away from / into the base liquid conditioning tank (3) by a crane (39). The base liquid conditioning tank (3) is also equipped with a cover plate (38) at the upper end. The solid conditioning agent used for conditioning the base liquid in the base liquid conditioning tank (3) is a mixture of poly(3-hydroxyvalerate), fumaric acid and malic acid in a mass ratio of 4-8:1-3:1; Solid conditioner is filled into the grid device.

2. The wastewater biochemical treatment device based on online microbial proliferation according to claim 1, characterized in that, The inlet (33) of the base liquid conditioning tank (3) is connected to a water distribution pipe (34), and the upper end of the water distribution pipe (34) has several through holes. The water distribution pipe (34) is located below the grid device (36).

3. The wastewater biochemical treatment device based on online microbial proliferation according to claim 1, characterized in that, A water outlet weir plate (37) is provided on one side of the sliding track (32). The height of the water outlet weir plate (37) is lower than that of the sliding track (32), and several through holes are opened on the sliding track (32). The water outlet weir plate (37) and the base liquid conditioning tank (3) form a flow guide cavity, and the water outlet valve (35) is connected to the flow guide cavity.

4. The wastewater biochemical treatment device based on online microbial proliferation according to claim 1, characterized in that, The biological propagation tank (5) includes a shell (51), and the shell (51) is horizontally divided into a flow guiding zone (53), an aeration zone (57) and a return zone (59) in sequence. The flow guiding zone (53) is connected to an inlet pipe (52). The aeration zone (57) is provided with an aeration disc (56) and an elastic packing material (55). The elastic packing material (55) is located above the aeration disc (56). The return zone (59) is connected to the lower end of the aeration zone (57) with an inclined return plate (58). The return zone (59) is also connected to an outlet pipe (511). A ventilation pipe (510) is connected to one side of the shell (51). A railing (513) is provided on the top of the shell (51).

5. The wastewater biochemical treatment device based on online microbial proliferation according to claim 4, characterized in that, A flow guide wall (54) is provided between the flow guide zone (53) and the aeration zone (57), and the lower end of the flow guide wall (54) is open to allow the flow guide zone (53) and the aeration zone (57) to communicate.

6. The wastewater biochemical treatment device based on online microbial proliferation according to claim 4, characterized in that, A weir plate (512) is provided between the aeration zone (57) and the return zone (59). The weir plate (512) has openings at both the upper and lower ends so that the aeration zone (57) and the return zone (59) can be connected to form a return channel. The return inclined plate (58) is provided at the lower opening of the weir plate (512).

7. The treatment method of the wastewater biochemical treatment device based on online microbial proliferation as described in any one of claims 1-6, characterized in that, The steps are as follows: S1: Perform metagenomic sequencing on wastewater to determine the microbial community in the wastewater; S2: The effluent from pool A of AO pool is used as the culture medium for microbial acclimatization and solidification, and is transported to the base liquid conditioning pool for conditioning. S3: The conditioned base liquid is transported from the base liquid conditioning tank to the biological propagation tank. At the same time, the microbial community is added to the biological propagation tank to acclimate and solidify the microbial community, and the wastewater is biochemically treated through the microbial community. S4: The wastewater after biochemical treatment is transported from the effluent tank to the O tank of the AO tank, and then to the secondary sedimentation tank. The wastewater after treatment in the secondary sedimentation tank can then enter the next process.

Images