SNP molecular markers linked to carotenoid content in tetraploid rose and their application

Abstract

The present invention relates to the technical field of molecular markers, and in particular to SNP molecular markers linked to carotenoid content in tetraploid roses and applications thereof. A molecular marker closely linked to the formation and accumulation of rose carotenoids is obtained, and the nucleotide sequence of the SNP marker is shown in SEQ ID NO.1; the polymorphic site is located at the 101st position of the sequence shown in SEQ ID NO.1, and the polymorphism is A / G. According to the molecular marker sequence information, the target trait can be screened in the seedling stage, effectively shortening the traditional hybrid breeding years, and achieving accurate and efficient molecular breeding of rose color. Through molecular marker-assisted breeding, the carotenoid content in rose petals can be effectively increased, the cultivation of new yellow / orange rose varieties can be promoted, and natural derivative products such as plant essential oils and new food raw materials that meet public demand and have market potential can be developed, and the efficient transformation of multiple tissues of flowers and the innovative application of diversified products can be promoted.

Description

Technical Field

[0001] The invention relates to the technical field of molecular markers, in particular to a SNP molecular marker linked to carotenoid content in a tetraploid rose and an application thereof. Background Art

[0002] Modern rose (Rosa spp.) belongs to the Rosaceae family, Rosa genus, and is one of the most important ornamental plants at home and abroad. It is widely used in cut flowers, potted flowers and landscaping. Flower color is one of the most important traits of ornamental plants, and it is of great significance to improve the ornamental quality and economic value of flowers. The presentation of flower color is affected by factors such as petal tissue structure, pigments and metal ions, among which the type and concentration of pigments have the greatest impact. The types of pigments that form flower color mainly include flavonoids, carotenoids and alkaloids, among which carotenoids are a class of natural terpenoid compounds with antioxidant capacity, and more than 750 species are currently known. In addition, because it is an important additive ingredient in the production of food, cosmetics, health products and other industries, it has high economic value and has attracted widespread attention.

[0003] Research on the formation and genetic mechanism of carotenoids in rose petals is still relatively lacking, and only stays at the level of pigment composition and metabolism. Wan et al. (2018) identified the types and contents of flavonoids and carotenoids in the petals of the yellow rose variety 'Sun City', and identified a total of 19 flavonols and 16 carotenoids, some of which were found for the first time in the petals of rose plants. Subsequent studies used rose varieties of different colors as materials to further analyze the contribution of flavonoids and carotenoids to the formation of different rose colors (Wan et al., 2019).

[0004] The construction of genetic linkage maps is a basic work. Through the drawing of maps, it can provide guidance and assistance for multiple downstream links, such as precise positioning and cloning of genes, analysis of functional gene structure and verification of functions. In the 1990s, with the development of DNA molecular marker technology and the proposal of the "pseudo-testcross" theory, the research on genetic map construction has made great progress in diploid and tetraploid populations of the genus Rosa. For example, the diploid Hw population (Crespel et al., 2002), the Spain population (Dugo et al., 2005) and the WOB population (Shupert et al., 2007); the tetraploid rose K5 population is used to study branch thorn density, petal number, powdery mildew resistance and anthocyanin metabolism (Koning-Boucoiran et al., 2012; Carvalho et al., 2015; Koning-Boucoiran et al., 2015; Bourke et al., 2016; Gitonga et al., 2016).

[0005] Modern rose breeding and production are mainly carried out at the tetraploid level. Although some studies have found that the QTL positioning of diploids is consistent with the research on tetraploids to a certain extent, it is also found that some important QTL loci are found in diploids, but not at the tetraploid level. The difference in ploidy results in low conversion efficiency of research results based on diploid maps. Therefore, with the rapid development of sequencing technology and analysis methods, QTL positioning research at the tetraploid level is more helpful for the production and application of roses.

[0006] Flower color is a complex quantitative trait. The regulatory mechanisms of different genes on anthocyanin synthesis vary from species to species. Some can work alone, while others need to interact to produce dimers or trimers for co-regulation. Although modern roses have a variety of flower colors, the genetic mechanism of their formation is still unclear, and research on carotenoids is even more lacking, making it more difficult to breed yellow / orange rose varieties. The synthesis process of pigments in plants is relatively complex, and it is not enough to study the regulatory effects of only a single gene or a few genes. It is an effective way to locate related sites at the population level and clarify their contribution to the phenotype. It is very necessary to explore SNP molecular markers linked to the carotenoid content of tetraploid roses. Summary of the invention

[0007] The invention provides a tetraploid rose carotenoid content-linked SNP molecular marker and application thereof.

[0008] The present invention provides a SNP marker related to the carotenoid content of rose petals, wherein the SNP marker contains a nucleotide sequence as shown in SEQ ID NO.5; the polymorphic site is located at the 39th position of the sequence as shown in SEQ ID NO.5;

[0009] SEQ ID NO.5:

[0010] TGATTTTGCTCAACCATTTCATCCATGATCCCCCCCCAA[A / G]TCAAGTGGCAGCAAATTATGCATGTCATTTCTGAAAT.

[0011] Further preferably, the SNP marker contains the nucleotide sequence shown in SEQ ID NO.6; the polymorphic site is located at position 49 of the sequence shown in SEQ ID NO.6;

[0012] SEQ ID NO.6:

[0013] GACTGCAGCTTGATTTTGCTCAACCATTTCATCCATGATCCC CCCCAA[A / G]TCAAGTGGCAGCAAATTATGCATGTCATTTCTGA AATTCAC.

[0014] More preferably, the SNP marker contains the nucleotide sequence shown in SEQ ID NO.7; the polymorphic site is located at position 59 of the sequence shown in SEQ ID NO.7;

[0015] SEQ ID NO.7:

[0016] ATCCGGACTGGACTGCAGCTTGATTTTGCTCAACCATTTCA TCCATGATCCCCCCCCAA[A / G]TCAAGTGGCAGCAAATTATGCATG TCATTTCTGAAATTCACGTATTCC.

[0017] More preferably, the SNP marker contains the nucleotide sequence shown in SEQ ID NO.8; the polymorphic site is located at position 69 of the sequence shown in SEQ ID NO.8;

[0018] SEQ ID NO.8:

[0019] TTTTGTTCAAATCCGGACTGGACTGCAGCTTGATTTTGCTC AACCATTTCATCCATGATCCCCCCCCAA[A / G]TCAAGTGGCAGCA AATTATGCATGTCATTTCTGAAATTCACGTATTCCATTCA.

[0020] The nucleotide sequence of the SNP marker is shown in SEQ ID NO.1; the polymorphic site is located at the 101st position of the sequence shown in SEQ ID NO.1, and the polymorphism is A / G.

[0021] According to the SNP markers, rose petals corresponding to the AA genotype do not contain carotenoids; rose petals corresponding to the GA genotype have a lower carotenoid content; and rose petals corresponding to the GG genotype have a higher carotenoid content.

[0022] The present invention also provides a primer for amplifying the SNP marker.

[0023] According to the primers, it includes: SEQ ID NO.2-4.

[0024] The present invention also provides a detection product containing the primer, and the detection product is a detection reagent, a test kit or a gene chip.

[0025] The present invention also provides the use of the SNP marker, the primer, or the detection product in identifying and / or screening the carotenoid content trait of rose petals.

[0026] According to the application, the rose petals corresponding to the AA genotype do not contain carotenoids; the rose petals corresponding to the GA genotype have a lower carotenoid content; and the rose petals corresponding to the GG genotype have a higher carotenoid content.

[0027] Preferably, the carotenoid content of rose petals of AA genotype is 0 ug / g, the carotenoid content of rose petals of GA genotype is between 0.93 ug / g and 45.21 ug / g, and the carotenoid content of rose petals of GG genotype is between 126.28 ug / g and 467.1 ug / g.

[0028] According to the application, the following steps are included: 1) extracting genomic DNA from rose petals to be tested;

[0029] 2) using the genomic DNA of the rose petals to be tested as a template, and performing a PCR amplification reaction using the primers;

[0030] 3) Analyze the PCR amplification products.

[0031] According to the SNP marker, the primer, the detection product or the application, the rose is a tetraploid rose.

[0032] The present invention also provides the use of the SNP marker, the primer or the gene chip in any of the following:

[0033] (1) Application in detecting or assisting in detecting the carotenoid content in rose petals;

[0034] (2) Application in early prediction of carotenoid content in rose petals;

[0035] (3) Application in rose molecular marker-assisted breeding;

[0036] (4) Application in rose germplasm resource improvement;

[0037] (5) Application in rose genotyping;

[0038] (6) Application in screening carotenoid content in rose petals;

[0039] (7) Promote the cultivation of new yellow or orange rose varieties.

[0040] Beneficial effects of the present invention:

[0041] By obtaining molecular markers that are closely linked to the formation and accumulation of rose carotenoids, target traits can be screened at the seedling stage based on the molecular marker sequence information, effectively shortening the traditional hybrid breeding period and achieving accurate and efficient molecular breeding of rose flower color.

[0042] Through molecular marker-assisted breeding, the carotenoid content in rose petals can be effectively increased, the cultivation of new yellow / orange rose varieties can be promoted, and natural derivative products such as plant essential oils and new food raw materials that meet public demand and have market potential can be developed, which will promote the efficient transformation of multiple tissues of flowers and the innovative application of diversified products. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art.

[0044] Figure 1 It is a partial linkage group of the genetic map of the tetraploid rose YS population provided in Example 1 of the present invention.

[0045] Figure 2 This is the QTL positioning result of carotenoid content in the tetraploid rose YS population provided in Example 1 of the present invention.

[0046] Figure 3 It is the main effect QTL and peak molecular marker of total carotenoids in the YS population provided in Example 1 of the present invention.

[0047] Figure 4 This is the typing result of the KASP marker A017029 in the population provided in Example 2 of the present invention. DETAILED DESCRIPTION

[0048] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0049] In the context of the advent of the era of omics big data, it has become an irreversible trend to integrate and analyze various omics data such as genomics, transcriptomics and metabolomics, use molecular biology methods to analyze the synthesis pathways of secondary metabolites, assist modern bioengineering technology to increase the content of related pigments in ornamental plants, and promote the comprehensive utilization of ornamental plant resources as edible and medicinal resources. Modern rose varieties with rich flower colors are good materials for studying the effects of different carotenoid types on rose ornamental and other added values, and artificial populations with good flower color separation will provide the necessary genetic support for this study.

[0050] In this embodiment, the tetraploid ancient rose variety 'Yunzhengxiawei' is used as the female parent and the modern rose variety 'Taiyangcheng' is used as the male parent for hybridization to obtain a tetraploid rose F1 generation hybrid population, which produces a total of 187 offspring, constituting a tetraploid rose YS genetic mapping population. In the established artificial F1 population, markers related to carotenoid traits are located to obtain molecular markers that are closely linked to the formation and accumulation of rose carotenoids. Genotyping is performed based on the tetraploid rose reference genome: genome sequencing and assembly of tetraploid maternal materials are performed to develop a tetraploid level reference genome to assist in accurate typing. Genetic mapping and carotenoid positioning analysis are performed using polyploid mapping software and strategies: polyploid mapping software polymapR is used for analysis, molecular markers are typed in combination with polyploid genetic mapping strategies, and then MSTmap is used to sort and cluster markers to construct a genetic map.

[0051] Example 1 Acquisition of SNP Molecular Markers

[0052] (1) Multi-level trait measurement: Fresh petals of the tetraploid rose YS genetic mapping population were collected and their flower color phenotype values ​​were measured using a colorimeter (NF555, Nippon Denshoku Industries Co. Ltd., Japan); carotenoids were extracted, separated and identified from the mapping population.

[0053] (2) Tetraploid genome typing and SNP development: Assemble the tetraploid maternal genome of the population, align the population resequencing data to the tetraploid reference genome and perform accurate typing. Use BWA software (mem method alignment) to align the filtered high-quality fastq data to the 'Yunzhengxiawei' reference genome, and use samtools software to count the alignment of each sample. Use GATK software to analyze the AD value information in the vcf file and score the allele status of each SNP site. According to the ratio of the reference allele depth (ADref) and the interactive allele depth (ADalt) of each site, the sequencing value is converted into a genotype.

[0054] (3) Constructing genetic maps using polyploid strategy: For the obtained genotype data, co-segregated markers were screened out, and only marker sites with exchange between samples were retained for linkage map construction. According to the segregation ratio and the genotype information of the parents, all SNPs were divided into three data sets. The maternal data set (HA) is the marker that is only segregated in the maternal gametes; the paternal data set (AH) is the marker that is only segregated in the paternal gametes; and the HH data set is the marker that is segregated in both parental gametes. The chi-square test of marker segregation was performed on the three data sets. For the maternal and paternal data sets, the marker segregation ratio should be 1:1, and for the parental heterozygous site data set, the marker segregation ratio should be 1:2:1. The SNP markers that meet the standards are used as the starting data set for the construction of the genetic linkage map (P>1e-10). Three sets of maps were constructed for the maternal (HA), paternal (AH), and parental sites heterozygous (HH).

[0055] (4) Co-localization of multiple traits: Based on the constructed AH, HA and HH maps, QTL analysis was performed using the 24 carotenoid contents measured by the previous research group. The QTL analysis software was WinQTLCart (ver 2.5), and the analysis method was the composite interval mapping method (CIM). Rqtl was combined for auxiliary analysis to increase the accuracy of the results. The LOD threshold was determined after 1000 tests (permutation test) for each trait.

[0056] (5) Screening and verification of SNP markers related to carotenoid content: Based on the detected QTL range, multiple QTL loci with co-localization of carotenoid content were found, and the QTL locus peak marker Tag_1634017 was screened. The marker sequence information was extracted, specific primers were designed according to the typing situation, and KASP marker A017029 was developed for verification (Table 1). The marker sequence and KASP primer information are as follows:

[0057] Table 1 Marker primers and sequence information

[0058]

[0059] Example 2 Application of SNP Molecular Markers

[0060] The SNP marker Tag_1634017 was validated in the population using KASP marker A017029 (Table 2).

[0061] The marker A017029 was divided into three genotypes in the population ( Figure 4), two homozygous types (AA / GG) and heterozygous type (GA). The carotenoid content of the homozygous AA genotype strain was 0ug / g, the carotenoid content of the heterozygous GA genotype strain was less, ranging from 0.93ug / g to 45.21ug / g, and the carotenoid content of the homozygous GG genotype strain was more, ranging from 126.28ug / g to 467.1ug / g, which was significantly higher than that of the plants of the homozygous AA and heterozygous GA genotypes.

[0062] This indicates that the carotenoid content QTL peak marker Tag_1634017 of the present invention does have the effect of significantly increasing the carotenoid content in rose petals; meanwhile, the KASP molecular marker A017029 of the present invention can be used for tracking and identification of the carotenoid content in rose petals and for auxiliary breeding.

[0063] Table 2. KASP marker typing and phenotype corresponding results

[0064]

[0065]

[0066] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer combination for identifying the carotenoid content in tetraploid rose petals, characterized in that: include: The sequences shown in SEQID NO.2-4.

2. A detection product containing the primer combination according to claim 1, characterized in that: The detection product is a detection reagent, a test kit or a gene chip.

3. Use of the primer combination according to claim 1 or the detection product according to claim 2 in identifying and / or screening the carotenoid content trait of tetraploid rose petals, characterized in that: The tetraploid rose is a hybrid offspring obtained by taking 'Yunzhengxiawei' and 'Taiyangcheng' as parents.

4. Use of a primer combination for detecting the genotype of a polymorphic site in a SNP marker in identifying and / or screening the carotenoid content trait of tetraploid rose petals, characterized in that: The tetraploid rose is a hybrid offspring obtained by taking 'Yunzhengxiawei' and 'Taiyangcheng' as parents; The SNP marker is any one of the following (1)-(5): (1) The nucleotide sequence of the SNP marker is as shown in SEQ ID NO.5, the polymorphic site is located at position 39 of the sequence shown in SEQ ID NO.5, and its base is A or G; (2) The nucleotide sequence of the SNP marker is as shown in SEQ ID NO.6, the polymorphic site is located at the 49th position of the sequence shown in SEQ ID NO.6, and its base is A or G; (3) The nucleotide sequence of the SNP marker is as shown in SEQ ID NO.7, the polymorphic site is located at the 59th position of the sequence shown in SEQ ID NO.7, and its base is A or G; (4) The nucleotide sequence of the SNP marker is as shown in SEQ ID NO.8, the polymorphic site is located at the 69th position of the sequence shown in SEQ ID NO.8, and its base is A or G; (5) The nucleotide sequence of the SNP marker is as shown in SEQ ID NO.

1. The polymorphic site is located at the 101st position of the sequence shown in SEQ ID NO.1, and its base is A or G.

5. The use according to claim 4, characterized in that: The petals of tetraploid roses corresponding to the AA genotype do not contain carotenoids; the carotenoid content of tetraploid rose petals corresponding to the GA genotype is significantly lower than that of tetraploid rose petals corresponding to the GG genotype.

6. The use according to claim 4 or 5, characterized in that: The carotenoid content of tetraploid rose petals corresponding to AA genotype is 0μg / g, the carotenoid content of tetraploid rose petals corresponding to GA genotype is between 0.93μg / g and 45.21μg / g, and the carotenoid content of tetraploid rose petals corresponding to GG genotype is between 126.28μg / g and 467.1μg / g.

7. The use according to claim 4 or 5, characterized in that: The following steps are involved: 1) Extract genomic DNA from petals of tetraploid rose to be tested; 2) using the genomic DNA of the petals of the tetraploid rose to be tested as a template, and performing a PCR amplification reaction using the primer combination, wherein the primer combination includes the sequences shown in SEQ ID NO.2-4; 3) Analyze the PCR amplification products.

8. Use of the primer combination of claim 1, the detection product of claim 2 or the primer combination of claim 4 in any one of the following (1) to (4): (1) Application of molecular markers related to carotenoid content in tetraploid rose petals in breeding; (2) Application in the improvement of tetraploid rose germplasm resources related to carotenoid content in petals; (3) Application in genotyping of tetraploid roses; (4) Application in promoting the breeding of new yellow tetraploid rose varieties or orange tetraploid rose varieties whose flower color is related to the carotenoid content in the petals; The tetraploid rose is a hybrid offspring obtained by taking 'Yunzhengxiawei' and 'Taiyangcheng' as parents.

Images