Adenovirus rapid detection method based on One-Tube RPA-CRISPR / Cas12a

Abstract

The present invention discloses a rapid adenovirus detection method based on One-Tube RPA-CRISPR / Cas12a. Specifically disclosed is a primer pair for detecting adenovirus, which is a primer Ade-F1 (SEQ ID No.2) and a primer Ade-R4 (SEQ ID No.9) for specifically amplifying adenovirus detection target gene (SEQ ID No.1). The present invention also discloses related compositions, kits and detection methods. The method for detecting adenovirus of the present invention has a minimum detection limit of 100 copies / mL, is accurate, sensitive, convenient and rapid, can quickly detect adenovirus, does not require expensive and bulky instruments and long reaction time, greatly saves costs, and provides reliable and effective technical guarantees for the prevention and control of diseases caused by adenovirus infection, and has broad application prospects in the field of on-site instant detection.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a rapid adenovirus detection method based on One-Tube RPA-CRISPR / Cas12a. Background Art

[0002] Adenovirus (AdV) is a non-enveloped double-stranded DNA virus. Human adenovirus (HAdV) is a member of the mammalian AdV genus. Currently, 7 subgroups (HAdV-A to HAdV-G) have been discovered, including 69 serotypes and more than 70 genotypes. It usually causes mild infections of the upper and lower respiratory tracts, gastrointestinal tracts, and conjunctiva. When the symptoms are severe or in certain circumstances (immunocompromised patients), hemorrhagic cystitis, hepatitis, hemorrhagic colitis, pancreatitis, nephritis or encephalitis may occur, and the mortality rate may exceed 50%. Due to the lack of humoral immunity, young children are the age group with a high incidence of HAdV infection, and the probability of infection is higher in healthy children or adults (especially recruits) in closed or crowded environments. Therefore, the ability to quickly diagnose adenovirus infection in the early stages is an important means to effectively treat patients and reduce mortality.

[0003] Nucleic acid detection technology is increasingly favored by major hospitals and diagnostic laboratories due to its advantages of good specificity and high sensitivity. However, a series of nucleic acid detection technologies based on the principle of polymerase chain reaction (PCR) are limited by the variable temperature control module, which usually makes the instrument bulky and inconvenient to carry to the clinical edge and epidemic area, or it is difficult to popularize to remote areas due to its expensive equipment price. Recombinase polymerase amplification (RPA) technology is a technology that amplifies specific fragments of target DNA under constant temperature conditions of 37 to 42°C by catalysis of recombinase and polymerase. It has become the preferred amplification technology for field diagnosis because of its rapidity, simplicity and isotherm. In addition, in vitro diagnostic technologies (DETECTR and SHERLOCK) developed based on Cas12a and Cas13a in the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas (CRISPR associated) system have been proven to be effective in detecting pathogenic microorganisms with good specificity and reliability. Because Cas12a-crRNA can recognize single-stranded or double-stranded DNA, it does not need to convert the substrate DNA into RNA, which eliminates the transcription step. Therefore, the CRISPR / Cas12a technology based on pre-RPA amplification will be simpler to use for nucleic acid detection of DNA viruses.

[0004] The traditional two-step RPA-CRISPR / Cas12a detection technology involves the transfer of preamplicons and multiple manual operations, which complicates the testing process and poses a risk of aerosol contamination during the transfer of amplified products. The detection method of adding target DNA, RPA reagents, and CRISPR reagents to one tube in advance can reduce aerosol contamination caused by secondary opening of the lid and has no effect on sensitivity. The detection can be completed by maintaining the temperature at a constant level for a period of time, which is more convenient and quicker. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to accurately, sensitively, conveniently and quickly detect adenovirus. The technical problem to be solved is not limited to the described technical subject matter, and those skilled in the art can clearly understand other technical subjects not mentioned in this article through the following description.

[0006] In order to solve the above technical problems, the present invention first provides a primer pair for detecting adenovirus, wherein the primer pair can be a pair of primers for specifically amplifying adenovirus detection target gene, and the nucleotide sequence of the adenovirus detection target gene can be SEQ ID No.1.

[0007] Furthermore, the primer pair may consist of primer Ade-F1 and primer Ade-R4, wherein primer Ade-F1 may be a single-stranded DNA molecule shown in SEQ ID No.2; and primer Ade-R4 may be a single-stranded DNA molecule shown in SEQ ID No.9.

[0008] The present invention also provides a composition for detecting adenovirus, which may include the primer pair and crRNA, the sequence of the crRNA may consist of an anchor sequence and a guide sequence, and the guide sequence may be positions 22-45 of SEQ ID No.12.

[0009] In the above composition, the nucleotide sequence of the crRNA may be SEQ ID No.12.

[0010] Furthermore, the composition may also include a probe (named exoRPA-P), and the nucleotide sequence of the probe exoRPA-P may be SEQ ID No.10.

[0011] Furthermore, the 31st base T of the probe (SEQ ID No. 10) can be labeled with FAM, the 33rd base G can be replaced with tetrahydrofuran (THF), and the 34th base T can be labeled with the quencher group BHQ1.

[0012] Furthermore, the 3' end of the probe exoRPA-P may be labeled with C3-spacer.

[0013] In the above composition, the composition may further include ssDNA and / or Cas12a protein, and the ssDNA may be a reporter molecule with a fluorescent group and a quenching group modified at both ends, respectively.

[0014] Furthermore, the nucleotide sequence of the ssDNA may be SEQ ID No.11.

[0015] Furthermore, the 5' end of the ssDNA may be labeled with a fluorescent group, and the 3' end may be labeled with a quenching group.

[0016] Furthermore, the fluorescent group can be selected from at least one of FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, TAMRA, LC RED640, LC RED705, Quasar705 or Texas Red.

[0017] Furthermore, the quenching group can be selected from at least one of TAMRA, BHQ1, BHQ2, BHQ3, MGB, and Dabcy1.

[0018] Furthermore, the 5' end of the ssDNA may be labeled with FAM, and the 3' end may be labeled with BHQ1.

[0019] The present invention also provides a kit for detecting adenovirus, which may include the primer pair, or any composition described herein.

[0020] Furthermore, the kit may be a kit for detecting adenovirus based on One-Tube RPA-CRISPR / Cas12a technology: the kit may include an RPA amplification reagent and a CRISPR / Cas12a detection reagent, wherein the RPA amplification reagent may include the primer pair described in the present invention (such as primer Ade-F1 and primer Ade-R4); the CRISPR / Cas12a detection reagent may include the ssDNA, Cas12a protein and the crRNA shown in SEQ ID No.12.

[0021] Furthermore, the kit may also include a recombinant vector carrying an adenovirus detection target gene (SEQ ID No. 1) (as a positive reference plasmid).

[0022] The recombinant vector carrying the adenovirus detection target gene (SEQ ID No. 1) can specifically be the recombinant vector pUC57-Ade, and the pUC57-Ade is a recombinant vector obtained by cloning a DNA fragment whose nucleotide sequence is SEQ ID No. 1 in the sequence list into a pUC57 vector.

[0023] Furthermore, the kit may also include a nucleic acid extraction reagent, which is used to extract nucleic acid from a biological sample (test sample) from a subject.

[0024] The various reagent components of the kit may be present in separate containers, or may be pre-combined in whole or in part into a reagent mixture.

[0025] The crRNA and / or probes described herein are also within the scope of protection of the present invention.

[0026] The present invention also provides the adenovirus detection target gene, the primer pair, the crRNA, the probe, any of the compositions described herein, or the kit in any of the following uses:

[0027] A1) Use in detecting adenovirus or preparing a product for detecting adenovirus;

[0028] A2) Use in diagnosing or assisting in the diagnosis of diseases caused by adenovirus infection or in the preparation of products for diagnosing or assisting in the diagnosis of diseases caused by adenovirus infection;

[0029] A3) Use in screening diseases caused by adenovirus infection or in preparing products for screening diseases caused by adenovirus infection.

[0030] The product described herein may be a reagent, a test kit, a chip, a test paper or a test card.

[0031] The diseases caused by adenovirus infection include, but are not limited to, respiratory tract infection, gastrointestinal tract infection, urinary tract infection, conjunctival infection, encephalitis, and myocarditis.

[0032] The adenovirus includes seven subgroups of human adenovirus (HAdV-A to HAdV-G).

[0033] The present invention also provides a method for detecting adenovirus, which may include using the primer pair, any composition described herein, or the kit to detect a sample to be tested, and determining whether the sample to be tested contains adenovirus or whether the sample to be tested is adenovirus based on the test result. The purpose of the method is non-disease diagnosis.

[0034] Furthermore, the method may include the following steps:

[0035] B1) extracting DNA from the sample to be tested;

[0036] B2) using the sample DNA to be tested as a template, performing RPA amplification using the primer pair to obtain an RPA amplification product;

[0037] B3) detecting the RPA amplification product in one tube using a CRISPR / Cas12a detection system;

[0038] The CRISPR / Cas12a detection system includes the crRNA shown in SEQ ID No.12.

[0039] Furthermore, the primer pair consists of primer Ade-F1 (SEQ ID No. 2) and primer Ade-R4 (SEQ ID No. 9).

[0040] Furthermore, the reaction system of the RPA amplification may include: freeze-dried reaction microspheres, RPA upstream primer Ade-F1, RPA downstream primer Ade-R4, Primer Free Rehydration buffer, MgOAc, and template DNA.

[0041] Furthermore, the reaction system (40 μL) of the RPA amplification may be: 1 freeze-dried reaction microsphere, 2.1 μL of RPA upstream primer Ade-F1 (10 μM), 2.1 μL of RPA downstream primer Ade-R4 (10 μM), 22.8 μL of Primer Free Rehydration buffer, 3 μL of MgOAc (280 mM), and 10 μL of template DNA.

[0042] Furthermore, the reaction conditions of the RPA amplification may be: 39° C., 20 min (1200 s), and recording the reaction fluorescence value for 10 min.

[0043] Furthermore, the CRISPR / Cas12a detection system may include: Cas12a protein, NEBuffer, RNaseinhibitor, ssDNA and crRNA (SEQ ID No.12).

[0044] Furthermore, the CRISPR / Cas12a detection system (10 μL) can be: Cas12a protein (1 μM) 2.5 μL, NEBuffer 3.1 μL, RNase inhibitor (40 U / μL) 0.65 μL, ssDNA (10 μM) 2.5 μL, crRNA (SEQ ID No. 12) (20 μM) 1.25 μL.

[0045] Furthermore, the CRISPR / Cas12a detection reaction conditions are: 39° C., reaction time 10 min (600 s).

[0046] In one embodiment of the present invention, the method for detecting adenovirus can be: prepare the above-mentioned RPA amplification reaction system (40 μL), and place all the reaction solutions at the bottom of the reaction unit tube. Prepare the CRISPR / Cas12a detection system, and place the configured CRISPR / Cas12a detection system on the tube cover of the reaction unit. Place the reaction unit in the Genie II rapid nucleic acid amplification detection system at 39°C, amplify for 20 minutes (1200 seconds), take out and centrifuge briefly to mix, shake the CRISPR / Cas12a detection system on the tube cover to the bottom of the tube and mix with the completed RPA amplification product, and continue to place it in the Genie II rapid nucleic acid amplification detection system at 39°C for 10 minutes (600 seconds).

[0047] The sample to be tested may include a blood sample (such as whole blood, plasma), a tissue sample, a saliva sample, an environmental sample (such as soil, water), etc.

[0048] The purposes of the above-mentioned applications and methods may be disease diagnosis, disease prognosis and / or disease treatment, and their purposes may also be non-disease diagnosis, non-disease prognosis and non-disease treatment purposes; their direct purpose may be to obtain information on intermediate results of disease diagnosis results, disease prognosis results and / or disease treatment results, and their direct purpose may be non-disease diagnosis, non-disease prognosis and / or non-disease treatment purposes.

[0049] The method for detecting adenovirus provided by the present invention can be a non-disease diagnosis and treatment method or a disease diagnosis and treatment method. Among them, the non-disease diagnosis and treatment method can be used to detect whether adenovirus is contained in cells before and after the use of drugs when screening adenovirus prevention and treatment drugs at the cell level.

[0050] The present invention first obtains the conserved specific target sequence of adenovirus (SEQ ID No. 1) by screening, and designs corresponding primers, probes and crRNA based on this, screens out ideal RPA amplification primers, establishes an adenovirus detection method based on One-TubeRPA-CRISPR / Cas12a, and develops related kits. The method for detecting adenovirus of the present invention has a minimum detection limit of 100 copies / mL, is accurate, sensitive, convenient and fast, can quickly detect adenovirus without the aid of expensive and bulky instruments and long reaction time, greatly saves costs, and provides reliable and effective technical guarantees for the prevention and control of diseases caused by adenovirus infection, and has broad application prospects in the field of point-of-care testing (POCT). BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 Cross-screening of primers for adenovirus Ade-RPA amplification.

[0052] Figure 2 This is a sensitivity evaluation of the real-time fluorescence RPA detection method for adenovirus. Figure 2 A in the middle is a fluorescence amplification curve for sensitivity evaluation, and the figure is a representative set of 3 repeated experiments; Figure 2 Middle B is an independent repeatability test graph, n=3 independent repeated experiments, t test; ns, not significant, ****, P<0.0001.

[0053] Figure 3 This is a sensitivity evaluation of the adenovirus RPA-CRISPR / Cas12a detection method. Figure 3 A in the middle is a fluorescence amplification curve diagram for sensitivity evaluation, and the figure is a representative set of 6 repeated experiments; Figure 3 Middle B is an independent repeatability test graph, n=6 independent repeated experiments, t test; *, p<0.05; **, P<0.01; ***, P<0.001.

[0054] Figure 4 Evaluation of the specificity of the adenovirus RPA-CRISPR / Cas12a detection method. n = 3 independent repeated experiments, t test; ns, not significant, ***, P < 0.001. DETAILED DESCRIPTION

[0055] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0056] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0057] Example 1. Acquisition of adenovirus target and preparation of positive reference plasmid

[0058] The inventors used Illumina MiSeq (Illumina, San Diego, CA, USA) sequencer to perform de novo sequencing of the whole genome of adenovirus, used FASTX-Toolkit software to perform quality filtering on the original short read sequences obtained by sequencing, and then used SPAdes 3.0 software for assembly. Prokka software was used to annotate the adenovirus genome to generate a GFF3 file, Roary was used to identify the pan-genome sequence of adenovirus, and then Python programming was used to screen the core genome sequence from the pan-genome, and the core genome was screened through the local NCBI nucleic acid database. After extensive and in-depth research, the adenovirus conservative specific target sequence (target gene) was selected to be SEQ ID No. 1, which can specifically detect adenovirus. The adenovirus conserved specific target sequence is as follows: 5'-AGTTAGCGGGATAGGGTTGACCTTGGCGCATGGTCGGAGCCATGTAACCCACAAAGCCAGAGTTGTTGTGTTGGTAGGGTATGGCGACGGCCTTGAAGTCTTTGTAATTGACCTCATCAACCACCTGCCTGCTCATGGGCTGGAAGTTTCTGA AAAATGAATACATGCGATCTTTGTATCCTTCTGGAATGTAGAAGCCCTGATAGCCGATGTTGTAGTTGGCGAGCATCTGTACCAAGAACCAGTCTTTGGTCATGTTGCATTGGGCTACGTTGTAGCCTTCGCCATCCACAGTGCGCTTTATTTCAAATTCGTTGGG-3'(SEQ ID No.1).

[0059] Adenovirus detection target gene positive reference plasmid pUC57-Ade was constructed for the adenovirus detection target gene (SEQ ID No. 1). The plasmid was synthesized by Shanghai Sangon Biotechnology Co., Ltd., and the synthetic plasmid product passed the safety and quality inspection. The concentration of the recombinant positive reference plasmid pUC57-Ade was determined by Qubit 4.0 nucleic acid quantifier, and the copy number concentration (copy number / mL) was converted. The plasmid with known copy number concentration was appropriately diluted for subsequent analysis.

[0060] Plasmid pUC57-Ade is a recombinant vector obtained by cloning a DNA fragment whose nucleotide sequence is SEQ ID No. 1 in the sequence list into a pUC57 vector.

[0061] Example 2. Design of RPA amplification primers, probes and crRNA

[0062] 1. Design of RPA amplification primers and probes

[0063] A plurality of RPA amplification primers for detecting adenovirus were designed for the adenovirus detection target gene (SEQ ID No. 1), Ade-F1 / Ade-F2 / Ade-F3 / Ade-F4 / Ade-R1 / Ade-R2 / Ade-R3 / Ade-R4 (SEQ ID No. 2 to SEQ ID No. 9), and an RPA fluorescent probe exoR PA-P (SEQ ID No. 10) for specific recognition of the target gene for screening. Real-time fluorescence RPA was used to screen the ideal RPA amplification primers. The designed primer and probe sequences are shown in Table 1.

[0064] 2. Design of crRNA

[0065] The amplified sequence guided by the ideal RPA primer combination was used as the target, TTTN (PAM sequence) was found, and the corresponding crRNA was designed: Ade-crRNA (SEQ ID No. 12). That is, the crRNA spacer sequence was designed at the 3' end of the PAM sequence containing TTTN, and then a segment of the same repeat sequence was added to the 5' end of the spacer sequence. The sequence of crRNA is shown in Table 1.

[0066] Table 1. RPA amplification primers, probes and crRNA

[0067]

[0068]

[0069] Note: The underlined part in the probe exoRPA-P is the labeling group site (the TTGT modification in exoRPA-P is marked as FAM-dT—T—THF—BHQ1-dT, that is, the 31st base T of SEQ ID No.10 is marked with FAM, the 33rd base G is replaced with tetrahydrofuran (THF), and the 34th base T is marked with the quenching group BHQ1); the 3' end of the probe exoRPA-P is marked with C3-spacer. The underlined part in crRNA (22-45th positions of SEQ ID No.12) is the guide sequence (matching the amplification product sequence of the RPA primer pair, used to bind to the target gene), and the previous part (1-21st positions of SEQ ID No.12) is the anchor sequence (used to bind to Cas12a protein). The sequences in Table 1 were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0070] Example 3: Screening of adenovirus RPA amplification primers

[0071] The synthesized primers and probes were diluted from 100 μmol / L stock solution to 10 μmol / L working solution for later use. The adenovirus positive plasmid pUC57-Ade was diluted to 10,000 copies / mL as template DNA. Deionized water was taken as NTC and the reaction was performed according to TwistAmp. TM The real-time fluorescence RPA reaction was performed using the exoKit (Cat. No.: TAEXO02KIT) Quick Guide method.

[0072] The reaction system was 50 μL: 2.1 μL of each RPA primer (10 μM) in Table 1, 0.6 μL of probe (10 μM), and TwistAmp TM 29.5 μL of basic buffer and 10.7 μL of deionized water in the exo Kit were added to the basic reaction unit and mixed thoroughly. 3 μL of 280 mM magnesium acetate (MgOAc) was added to the tube cap. After adding 2 μL of template and mixing thoroughly, the mixture was centrifuged briefly and then quickly placed in the GenieⅡ isothermal amplification fluorescence detection system for RPA reaction. Reaction conditions: 39°C, 20 min (1200 s), and the fluorescence value of the reaction was recorded for 10 min. According to the above reaction conditions, the RPA fluorescent probe exoRPA-P (SEQ ID No. 10) was used to cross-screen the designed RPA primers Ade-F1 / Ade-F2 / Ade-F3 / Ade-F4 / Ade-R1 / Ade-R2 / Ade-R3 / Ade-R4 (SEQ ID No. 2 to SEQ ID No. 9).

[0073] The fluorescence signal of each group of reactions was collected from the GenieⅡ instrument for 10 minutes, and the data was processed and plotted according to the following method: each group of experimental data was normalized and made into an intuitive heat map. The fluorescence signals under the same template DNA concentration were compared. The color depth in the figure corresponded to different normalized values. The darker the color, the closer the normalized value was to 1.00, indicating that the stronger the fluorescence signal of the group, the better the effect. Normalization: (fluorescence signal of each group of reactions - minimum fluorescence signal in the group) / (maximum fluorescence signal in the group).

[0074] The results of cross-screening of adenovirus Ade-RPA amplification primers are as follows Figure 1 As shown, the primer combination Ade-F1 (SEQ ID No. 2) / Ade-R4 (SEQ ID No. 9) has the highest normalized value (the normalized value of the primer combination Ade-F1 / Ade-R4 is 1), and is an ideal RPA amplification primer for Ade.

[0075] Example 4: Sensitivity evaluation of adenovirus real-time fluorescence RPA detection method

[0076] Ade-F1 (SEQ ID No. 2) / Ade-R4 (SEQ ID No. 9) screened in Example 3 was used as the RPA primer combination, exoRPA-P (SEQ ID No. 10) was used as the probe, and the adenovirus target gene positive reference plasmid (pUC57-Ade) stock solution was diluted 10 times to 10000 copies / mL, 1000 copies / mL, 500 copies / mL, and 200 copies / mL as template DNA, and deionized water was used as a no-template control (NTC) using TwistAmp TM exo Kit (Cat. No.: TAEXO02KIT) was used for RPA fluorescence amplification. The reaction system was optimized, and the optimized reaction system is shown in Table 2. All reaction solutions were fully mixed, centrifuged briefly, and then quickly placed in the GenieⅡ isothermal amplification fluorescence detection system for RPA reaction. The reaction conditions were 39°C, 20min (1200s). The reaction results are shown in Figure 2 A shows the fluorescence signal-time amplification curve of a representative experiment in three repeated experiments. In order to test the stability of sensitivity, we repeated the experiment three times, and the minimum detection limit could reach 500 copies / mL, and the sensitivity was 10 copies / reaction ( Figure 2 B).

[0077] Table 2. Optimized real-time fluorescence RPA amplification reaction system

[0078]

[0079] Example 5: Sensitivity evaluation of adenovirus detection method based on One-Tube RPA-CRISPR / Cas12a

[0080] The Ade-F1 (SEQ ID No. 2) / Ade-R4 (SEQ ID No. 9) screened in Example 3 was used as the RPA primer combination, and the adenovirus target gene positive reference plasmid (pUC57-Ade) stock solution was diluted 10 times to 10000 copies / mL, 1000 copies / mL, 500 copies / mL, and 100 copies / mL as template DNA, and deionized water was used as a no-template control (NTC). TwistAmp TMBasic Kit (catalog number: TAEXO03KIT) was used for RPA basic amplification. The optimized basic RPA amplification reaction system was: 1 freeze-dried reaction microsphere, 2.1 μL of RPA upstream primer Ade-F1 (10 μM), 2.1 μL of RPA downstream primer Ade-R4 (10 μM), 22.8 μL of Primer Free Rehydration buffer, 3 μL of MgOAc (280 mM), and 10 μL of template DNA. All the above reaction solutions were placed at the bottom of the reaction unit tube for use.

[0081] CRISPR / Cas12a detection: Ade-crRNA (SEQ ID No. 12) was designed in the amplified sequence guided by the ideal RPA primer combination Ade-F1 (SEQ ID No. 2) / Ade-R4 (SEQ ID No. 9) screened in Example 3. The CRISPR / Cas12a reaction system was configured according to Cas12a protein (1 μM) 2.5 μL, NEBuffer 3.1 μL, RNase inhibitor (40U / μL) 0.65 μL, ssDNA (10 μM) 2.5 μL, and crRNA (SEQ ID No. 12) (20 μM) 1.25 μL, and the configured system was placed on the tube cover of the reaction unit.

[0082] Place the reaction unit in the Genie II Rapid Nucleic Acid Amplification Detection System at 39°C and amplify for 20 minutes (1200 seconds). Take it out and centrifuge briefly to mix. Shake the CRISPR / Cas12a reaction system in the tube cap to the bottom of the tube and mix it with the completed RPA amplification product. Continue to place it in the Genie II Rapid Nucleic Acid Amplification Detection System at 39°C and react for 10 minutes (600 seconds).

[0083] GraphPad Prism 7.04 statistical software was used to process the data. The average value of the fluorescence signal value of the no-template control (NTC) group in each group of data was used as the denominator, and the fluorescence value of each group of reactions was used as the numerator. After division, a fold change value was obtained, and the corresponding fold change graph was made according to the grouping. The experimental results are expressed as mean ± standard deviation, and the paired t test was used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates an extremely significant difference, and P < 0.001 (***) indicates an extremely significant difference.

[0084] The reaction results are as follows Figure 3 As shown, it is a fluorescence signal-time amplification curve of a representative experiment in 6 repeated experiments, and the positive reaction detection time is 5-10 minutes ( Figure 3To test the stability of sensitivity, we repeated the experiment 6 times. The minimum detection limit of the One-Tube RPA-CRISPR / Cas12a assay for adenovirus was 100 copies / mL, and the sensitivity was 1 copy / reaction ( Figure 3 (B).

[0085] Example 6. Specificity evaluation of adenovirus RPA-CRISPR / Cas12a detection method

[0086] In order to evaluate the specificity of the adenovirus RPA-CRISPR / Cas12a detection method, human adenovirus genomic DNA was used as positive template DNA (template concentration of 100fg / μL), canine adenovirus genomic DNA (template concentration of 100pg / μL) and 15 non-adenovirus mixed genomic DNAs were used as specific test template DNAs. The 15 non-adenovirus mixed genomic DNAs are high-concentration (final concentration of not less than 100pg / μL) mixed genomic DNAs composed of purified genomes of Bacillus anthracis, Burkholderia pseudomallei, Burkholderia glanders, Brucella bovis, Bacillus cereus, Bacillus thuringiensis, Francisella tularensis, Salmonella typhimurium, Bacillus subtilis, Brucella melitensis, Escherichia coli, Vibrio vulnificus, Staphylococcus aureus, Vibrio parahaemolyticus, and Staphylococcus epidermidis. Deionized water was used as a negative control (NTC), and the system and method of Example 5 were evaluated.

[0087] The results are as follows Figure 4 As shown in the figure: After three repeated experiments, only human adenovirus DNA was positive, and canine adenovirus DNA, non-adenovirus mixed genomic DNA and NTC had no amplification signal, indicating that the primer pair, crRNA and detection method have good specificity ( Figure 4 ).

[0088] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A primer pair for detecting adenovirus, characterized in that: The primer pair is a pair of primers for specifically amplifying the adenovirus detection target gene, and the nucleotide sequence of the adenovirus detection target gene is SEQ ID No. 1; The primer pair consists of primer Ade-F1 and primer Ade-R4, wherein primer Ade-F1 is a single-stranded DNA molecule shown in SEQ ID No.2; The primer Ade-R4 is a single-stranded DNA molecule shown in SEQ ID No.

9.

2. A composition for detecting adenovirus, characterized in that: The composition comprises the primer pair according to claim 1 and crRNA, the sequence of the crRNA consists of an anchor sequence and a guide sequence, and the guide sequence is positions 22-45 of SEQ ID No.

12.

3. The composition according to claim 2, characterized in that The nucleotide sequence of the crRNA is SEQ ID No.

12.

4. The composition according to claim 2 or 3, characterized in that The composition further comprises a probe, the nucleotide sequence of the probe being SEQ ID No.

10.

5. A kit for detecting adenovirus, characterized in that: The kit comprises the primer pair according to claim 1, or comprises the composition according to any one of claims 2-4.

6. The primer pair according to claim 1, the composition according to any one of claims 2 to 4, or the kit according to claim 5 is used in any of the following: A1) Use in the preparation of products for detecting adenovirus; A2) Use in the preparation of products for diagnosing or assisting in the diagnosis of diseases caused by adenovirus infection; A3) Use in the preparation of products for screening diseases caused by adenovirus infection.

7. A method for detecting adenovirus, characterized in that: The method comprises using the primer pair described in claim 1, the composition described in any one of claims 2-4, or the kit described in claim 5 to detect the sample to be tested, and determining whether the sample to be tested contains adenovirus or whether the sample to be tested is adenovirus based on the test result. The purpose of the method is non-disease diagnosis.

8. The method according to claim 7, characterized in that The method comprises the following steps: B1) Extract DNA from the sample to be tested; B2) using the sample DNA to be tested as a template, and performing RPA amplification using the primer pair of claim 1 to obtain an RPA amplification product; B3) detecting the RPA amplification product in one tube using a CRISPR / Cas12a detection system; The CRISPR / Cas12a detection system includes the crRNA described in claim 2 or 3.

Images