Nucleic acid carriers, nucleic acid drugs, and their preparation methods and applications

Abstract

The present invention provides a nucleic acid carrier, a nucleic acid drug, and a preparation method and application thereof. The nucleic acid carrier contains sequences a, b, and c, and the nucleic acid carrier is selected from DNA, RNA, or a DNA-RNA hybrid carrier; sequences a, b, and c self-assemble to form the nucleic acid carrier, and sequences a, b, and c include a backbone sequence including the following core sequences: the a1 sequence shown in SEQ ID NO: 1 or 4, the b1 sequence shown in SEQ ID NO: 2 or 5, and the c1 sequence shown in SEQ ID NO: 3 or 6, or any variant sequences of at least one of the a1 sequence, b1 sequence, and c1 sequence, and the variant sequences include insertions, deletions, or substitutions of at least one base; the DNA-RNA hybrid carrier is a carrier self-assembled from a combination of the sequence of the DNA carrier and the sequence of the RNA carrier. This carrier has high delivery efficiency, a more stable delivery system, and is also simpler and more efficient in the preparation process.

Description

Technical Field

[0001] The present invention relates to the field of nucleic acid drugs, and in particular to a nucleic acid vector, a nucleic acid drug, and a preparation method and application thereof. Background Art

[0002] Single-stranded or double-stranded RNA drugs with a small molecular weight (the number of nucleotides usually does not exceed 100) are called "oligonucleotide drugs". Oligonucleotide drugs are a new drug category that is completely different from small molecule drugs and antibody drugs. Their drug composition is a nucleotide sequence, and their drug mechanism is to act on mRNA and inhibit the expression of target proteins through gene silencing (that is, oligonucleotide drugs act on the stage after gene transcription and before protein translation), thereby achieving the purpose of treating diseases. Oligonucleotide drugs are a strategic frontier area of ​​biopharmaceutical innovation.

[0003] Compared with antibody drugs, oligonucleotide drugs do not require complex protein modification and CMC development (process and quality control) during the research and development stage. The preparation process in the production stage is relatively simple, and does not require large-scale mammalian cell fermentation and protein purification. It has the advantages of rich candidate targets, short research and development cycle, long-lasting efficacy, and high clinical development success rate. Oligonucleotide drugs treat at the post-transcriptional level and can achieve breakthroughs in special protein targets that are difficult to drug. It is expected to overcome diseases that have no drug treatment, including genetic diseases and other difficult-to-treat diseases; it has great potential to develop therapeutic drugs for "untargetable" and "undruggable" diseases, and is expected to form the third wave of modern new drugs after small molecule drugs and antibody drugs.

[0004] However, the following disadvantages of oligonucleotide drugs are key factors that restrict the development of oligonucleotide drugs: on the one hand, oligonucleotide drugs are too fragile and easily degraded by nucleases in the body, and chemical modification is difficult to support; on the other hand, oligonucleotide drugs generally have immunotoxicity and are very likely to cause serious side effects to the human body. Therefore, the delivery of oligonucleotide drugs and the combined application of oligonucleotide drugs are still a major bottleneck that needs to be broken through in this field.

[0005] Currently, in addition to the two clinically validated delivery technologies of LNP (lipid nanoparticles) and GalNAc, there are also reports of other delivery methods. For example, the PNP (peptide nanoparticles) delivery technology developed by Sirnaomics, as well as the GalAhead and GalNAc-PDoV technologies. PNP belongs to the same category of organic nanoparticle delivery as LNP, but allows a single PNP to load multiple siRNAs and can be used to develop multi-target nucleic acid drugs; the latter two have similar effects, which is equivalent to being able to deliver more than one siRNA on the basis of GalNAc. Such delivery systems are mainly targeted at siRNA drugs, and the delivery systems for other types of oligonucleotide drugs still face challenges. Therefore, the efficiency, drug type, and reliability of nucleic acid drug delivery still need to be further improved. Summary of the Invention

[0006] The main object of the present invention is to provide a nucleic acid carrier, a nucleic acid drug, and their preparation methods and applications, so as to solve the problem of low delivery efficiency of various oligonucleic acid drugs in the prior art, especially the problem of difficulty in simultaneously delivering multiple oligonucleotide drugs.

[0007] To achieve the above object, according to one aspect of the present invention, a nucleic acid carrier is provided. The nucleic acid carrier includes sequence a, sequence b, and sequence c. The nucleic acid carrier is selected from a DNA carrier, an RNA carrier, or a DNA-RNA hybrid carrier; sequence a, sequence b, and sequence c self-assemble to form the nucleic acid carrier. Among them, sequence a, sequence b, and sequence c include a vector backbone sequence, and the vector backbone sequence includes the following core sequences: sequence a1, sequence b1, and sequence c1, or any variant sequences of at least one of sequence a1, sequence b1, and sequence c1. The variant sequences include insertions, deletions, or substitutions of at least one base; in the DNA carrier, sequence a1 is SEQ ID NO:1, sequence b1 is SEQ ID NO:2, and sequence c1 is SEQ ID NO:3; in the RNA carrier, sequence a1 is SEQ ID NO:4, sequence b1 is SEQ ID NO:5, and sequence c1 is SEQ ID NO:6; among them, the DNA-RNA hybrid carrier is a carrier self-assembled from a combination of the sequences of the DNA carrier and the sequences of the RNA carrier; SEQ ID NO:1: ACGAGCGTTCCG; SEQ ID NO:2: CGGTTCGCCG; SEQ ID NO:3: CGGCCATAGCCGT; SEQ ID NO:4: ACGAGCGUUCCG; SEQ ID NO:5: CGGUUCGCCG; SEQ ID NO:6: CGGCCAUAGCCGU.

[0008] Furthermore, the vector backbone sequence further includes a first extension segment and an optional second extension segment, and the first extension segment and the second extension segment are located at the 5'-end and / or 3'-end of any one of the a1 sequence, b1 sequence, and c1 sequence; preferably, the first extension segment and the second extension segment are each independently 1 to 14 nt; preferably, the first extension segment is selected from any one or more of the following DNA extension segments or RNA extension segments corresponding to the DNA extension segments: 1) 5'-end of the a1 sequence: GACGCCC, 3'-end of the c1 sequence: GGGCGTC; 2) 3'-end of the a1 sequence: GGAGAGG, 5'-end of the b1 sequence: CCTCTCC; 3) 3'-end of the b1 sequence: CGAGCC, 5'-end of the c1 sequence: GGCTCG or GGCACG; 4) 5'-end of the a1 sequence: GGCGCCC or GACGCCC, 3'-end of the c1 sequence: GGGCGCC; 5) 3'-end of the a1 sequence: GGAG, 5'-end of the b1 sequence: CTCC; 6) 3'-end of the b1 sequence: CCAGCC, 5'-end of the c1 sequence: GGCACG or GGCTCG; preferably, the second extension segment is selected from any one or more of the following DNA extension segments or RNA extension segments corresponding to the DNA extension segments: 1) 5'-end of the a1 sequence: C or GC, 3'-end of the c1 sequence: GC or GCT; 2) 3'-end of the a1 sequence: AG, AGC or AGCT, 5'-end of the b1 sequence: GCT or CT; 3) 3'-end of the b1 sequence: GC, GCG or GCGT, 5'-end of the c1 sequence: GC or CGC; 4) 3'-end of the a1 sequence: C, AGGCC, AGGCCT or AGGAG, 5'-end of the b1 sequence: G, GGCCT or CTCCT; 5) 3'-end of the b1 sequence: GCC or GCCT, 5'-end of the c1 sequence: GGC.

[0009] Furthermore, the nucleic acid vector further includes, such as, single-stranded bonding bridge sequences and / or transition sequences. Among them, the single-stranded bonding bridge sequences are selected from any one or more of the following: 1) Located at the 3' end of the backbone sequence of sequence a: SEQ ID NO:7: TGTAGCACGGTGGC or its complementary sequence SEQ ID NO:8: GCCACCGTGCTACA; 2) Located at the 3' end of the backbone sequence of sequence b: SEQ ID NO:9: TCGGCGCGGCCGTG or its complementary sequence SEQ ID NO:10: CACGGCCGCGCCGA; 3) Located at the 3' end of the backbone sequence of sequence c: SEQ ID NO:11: TGCTGCTGCTGCTG or its complementary sequence SEQ ID NO:12: CAGCAGCAGCAGCA; Among them, the transition sequence is a sequence formed by consecutive n U, T or A, where n is a natural number from 2 to 8, preferably 3 - 6, or a sequence randomly composed of A, U, T, C and / or G. The transition sequence is located at the 5' end or 3' end of the core sequence; Preferably, the sequences a, b and c in the nucleic acid vector are as follows:

[0010] Sequence a is: SEQ ID NO:15: GACGCCCACGAGCGTTCCGGGAGAGG TGTAGCACGGTGGC, Among them, the underlined part is the single-stranded linking bridge sequence;

[0011] Sequence b is: SEQ ID NO:16: CCTCTCCCGGTTCGCCGCGAGCC TCGGCGCGGCCGTG, Among them, the underlined part is the single-stranded linking bridge sequence;

[0012] Sequence c is: SEQ ID NO:17: GGCTCGCGGCCATAGCCGTGGGCGTC TGCTGCTGCTGCTG, Among them, the underlined part is the single-stranded linking bridge sequence; or

[0013] The sequences a, b and c in the nucleic acid vector are as follows:

[0014] Sequence a is: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC;

[0015] Sequence b is: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG;

[0016] Sequence c is:

[0017] SEQ ID NO:20:CAGCAGCAGCAGCACGCGGCTCGCGGCCATAGCCGTGGGCGTCGC, the underlined part is the single-stranded linker sequence.

[0018] Furthermore, any one of the following groups is selected as the backbone sequence for self-assembling into a nucleic acid vector:

[0019] 1) Sequence a: SEQ ID NO:21: GCGACGCCCACGAGCGTTCCGGGAGAGGAG,

[0020] Sequence b: SEQ ID NO:22: CTCCTCTCCCGGTTCGCCGCGAGCCGCG,

[0021] Sequence c: SEQ ID NO:23: CGCGGCACGCGGCCATAGCCGTGGGCGTCGC;

[0022] 2) Sequence a: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT,

[0023] Sequence b: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG,

[0024] Sequence c: SEQ ID NO:23: CGCGGCACGCGGCCATAGCCGTGGGCGTCGC;

[0025] 3) Sequence a: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT,

[0026] Sequence b: SEQ ID NO:25: GCTCCTCTCCCGGTTCGCCGCGAGCCGCGT,

[0027] Sequence c: SEQ ID NO:26: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGCT;

[0028] 4) Sequence a: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT,

[0029] Sequence b: SEQ ID NO:25: GCTCCTCTCCCGGTTCGCCGCGAGCCGCGT,

[0030] c sequence: SEQ ID NO:27: CGCGGCACGCGGCCATAGCCGTGGGCGTCGCT;

[0031] 5) a sequence: SEQ ID NO:28: GACGCCCACGAGCGTTCCGGGAGAGG,

[0032] b sequence: SEQ ID NO:29: CCTCTCCCGGTTCGCCGCGAGCC,

[0033] c sequence: SEQ ID NO:30: GGCTCGCGGCCATAGCCGTGGGCGTC;

[0034] 6) a sequence: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC,

[0035] b sequence: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG,

[0036] c sequence: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC;

[0037] 7) a sequence: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT,

[0038] b sequence: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG,

[0039] c sequence: SEQ ID NO:26: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGCT;

[0040] 8) a sequence: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT,

[0041] b sequence: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG,

[0042] c sequence: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC;

[0043] 9) Sequence a: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT,

[0044] Sequence b: SEQ ID NO:25: GCTCCTCTCCCGGTTCGCCGCGAGCCGCGT,

[0045] Sequence c: SEQ ID NO:26: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGCT;

[0046] 10) Sequence a: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT,

[0047] Sequence b: SEQ ID NO:25: GCTCCTCTCCCGGTTCGCCGCGAGCCGCGT,

[0048] Sequence c: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC;

[0049] 11) Sequence a: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC;

[0050] Sequence b: SEQ ID NO:25: GCTCCTCTCCCGGTTCGCCGCGAGCCGCGT;

[0051] Sequence c: SEQ ID NO:26: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGCT;

[0052] 12) Sequence a: SEQ ID NO:32: CGACGCCCACGAGCGTTCCGGGAGAGGAGC;

[0053] Sequence b: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG;

[0054] Sequence c: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC;

[0055] 13) Sequence a: SEQ ID NO:33: GCGGCGCCCACGAGCGTTCCGGGAGC;

[0056] b sequence: SEQ ID NO:34: GCTCCCGGTTCGCCGCCAGCCGCC;

[0057] c sequence: SEQ ID NO:35: GGCGGCAGGCGGCCATAGCCGTGGGCGCCGC;

[0058] 14) a sequence: SEQ ID NO:36: GCGGCGCCCACGAGCGTTCCGGGAGAGGCC;

[0059] b sequence: SEQ ID NO:37: GGCCTCTCCCGGTTCGCCGCCAGCCGCC;

[0060] c sequence: SEQ ID NO:38: GGCGGCTGGCGGCCATAGCCGTGGGCGCCGC;

[0061] 15) a sequence: SEQ ID NO:39: GCGGCGCCCACGAGCGTTCCGGGAGAGGCCT;

[0062] b sequence: SEQ ID NO:40: GGCCTCTCCCGGTTCGCCGCCAGCCGCCT;

[0063] c sequence: SEQ ID NO:41: GGCGGCTGGCGGCCATAGCCGTGGGCGCCGCT;

[0064] 16) a sequence: SEQ ID NO:42: GCGGCGCCCACGAGCGUUCCGGGAGAGGCC;

[0065] b sequence: SEQ ID NO:43: GGCCUCUCCCGGUUCGCCGCCAGCCGCC;

[0066] c sequence: SEQ ID NO:44: GGCGGCUGGCGGCCAUAGCCGUGGGCGCCGC;

[0067] 17) a sequence: SEQ ID NO:45: CGACGCCCACGAGCGTTCCGGGAGAGGAG;

[0068] b sequence: SEQ ID NO:46: CTCCTCTCCCGGTTCGCCGCCAGCCGCC;

[0069] c sequence: SEQ ID NO:35: GGCGGCAGGCGGCCATAGCCGTGGGCGCCGC;

[0070] 18) a sequence: SEQ ID NO:36: GCGGCGCCCACGAGCGTTCCGGGAGAGGCC;

[0071] b sequence: SEQ ID NO:43: GGCCUCUCCCGGUUCGCCGCCAGCCGCC;

[0072] c sequence: SEQ ID NO:44: GGCGGCUGGCGGCCAUAGCCGUGGGCGCCGC;

[0073] 19) a sequence: SEQ ID NO:36: GCGGCGCCCACGAGCGTTCCGGGAGAGGCC;

[0074] b sequence: SEQ ID NO:40: GGCCTCTCCCGGTTCGCCGCCAGCCGCCT;

[0075] c sequence: SEQ ID NO:38: GGCGGCTGGCGGCCATAGCCGTGGGCGCCGC;

[0076] 20) a sequence: SEQ ID NO:36: GCGGCGCCCACGAGCGTTCCGGGAGAGGCC;

[0077] b sequence: SEQ ID NO:40: GGCCTCTCCCGGTTCGCCGCCAGCCGCCT;

[0078] c sequence: SEQ ID NO:41: GGCGGCTGGCGGCCATAGCCGTGGGCGCCGCT;

[0079] 21) a sequence: SEQ ID NO:36: GCGGCGCCCACGAGCGTTCCGGGAGAGGCC;

[0080] b sequence: SEQ ID NO:37: GGCCTCTCCCGGTTCGCCGCCAGCCGCC;

[0081] c sequence: SEQ ID NO:44: GGCGGCUGGCGGCCAUAGCCGUGGGCGCCGC;

[0082] 22) Sequence a: SEQ ID NO:33: GCGGCGCCCACGAGCGTTCCGGGAGC;

[0083] Sequence b: SEQ ID NO:46: CTCCTCTCCCGGTTCGCCGCCAGCCGCC;

[0084] Sequence c: SEQ ID NO:35: GGCGGCAGGCGGCCATAGCCGTGGGCGCCGC;

[0085] 23) Sequence a: SEQ ID NO:47: GCGGCGCCCACGAGCGTTCCGGGAGAGGAG;

[0086] Sequence b: SEQ ID NO:46: CTCCTCTCCCGGTTCGCCGCCAGCCGCC;

[0087] Sequence c: SEQ ID NO:35: GGCGGCAGGCGGCCATAGCCGTGGGCGCCGC;

[0088] 24) Sequence a: SEQ ID NO:48: CGCCCACGAGCGTTCCGGGAGA;

[0089] Sequence b: SEQ ID NO:49: TCTCCCGGTTCGCCGCGAG;

[0090] Sequence c: SEQ ID NO:50: CTCGCGGCCATAGCCGTGGGCG;

[0091] 25) Sequence a: SEQ ID NO:51: UCGCCCACGAGCGUUCCGGGAGA;

[0092] Sequence b: SEQ ID NO:52: UCUCCCGGUUCGCCGCGAG;

[0093] Sequence c: SEQ ID NO:53: UCUCGCGGCCAUAGCCGUGGGCG;

[0094] 26) Sequence a: SEQ ID NO:54: GCGCCCACGAGCGTTCCGGGAGAGC;

[0095] Sequence b: SEQ ID NO:55: CCCUGCTCTCCCGGTTCGCCGCCAGCCGCC;

[0096] c sequence: SEQ ID NO:56: GGCGGCAGGCGGCCATAGCCGTGGGCGC.

[0097] Furthermore, at least one of the bases, riboses, and phosphate esters in the a sequence, b sequence, and c sequence has at least one modifiable site, and any modifiable site has at least one of the following modifications: -F, methyl, amino, disulfide, carbonyl, carboxyl, mercapto, aldehyde, and thio; preferably, the partial phosphate backbone in the a sequence, b sequence, and c sequence has a thio modification; preferably, when the nucleic acid carrier is an RNA carrier or a DNA-RNA hybrid carrier, C and U in the RNA-form sequence in the nucleic acid carrier have a 2'-F substitution modification, and A and G have a 2'-OMe modification.

[0098] In the second aspect of the present application, a nucleic acid drug is provided. The nucleic acid drug includes any of the foregoing nucleic acid carriers and a bioactive substance attached to the nucleic acid carrier. The bioactive substance includes an oligonucleotide effector molecule and a targeting molecule for targeted delivery of the oligonucleotide molecule. Among them, the oligonucleotide effector molecule is selected from at least one of the following: nucleic acid immune stimulant, nucleic acid aptamer, siRNA, miRNA, and ASO; and when the oligonucleotide effector molecule includes a nucleic acid aptamer, the targeting molecule includes at least a nucleic acid aptamer; when the oligonucleotide effector molecule does not include a nucleic acid aptamer, the targeting molecule includes at least a small molecule compound with a targeting effect.

[0099] Furthermore, the nucleic acid immune stimulant includes one or more of CpG2006, CpG2006 variant, CpG1826, CpG2216, CpG2395, CpG-ODNT7, and CpG-BYZD.

[0100] Preferably, the sequence of CpG2006 is:

[0101] SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT or

[0102] SEQ ID NO:58: UCGUCGUUUUGUCGUUUUGUCGUU;

[0103] Preferably, the sequence of the CpG2006 variant is: GTCGTT;

[0104] Preferably, the sequence of CpG1826 is: SEQ ID NO:59: TCCATGACGTTCCTGACG;

[0105] Preferably, the sequence of CpG2216 is: SEQ ID NO:60: GGGGGACGATCGTCGGGGGG;

[0106] Preferably, the sequence of CpG2395 is: SEQ ID NO:61: TCGTCGTTTTCGGCGCGCGCCG;

[0107] Preferably, the sequence of CpG-ODNT7 is: SEQ ID NO:62: TCGTCGTCGTCGTCGTCGTCG or SEQ ID NO:63: TCGTCGTCGTCGTCGTCGTCGTCG;

[0108] Preferably, the sequence of CpG-BYZD is: AGCGAA.

[0109] Furthermore, the siRNA includes siRNA of any one or more of the following molecules: ASAP1, ATAD2, CD24, CD47, EGFR, HBV, HSP, HS70, PD-L1, PAPP-1, Survivin, TAP, TIM-3, TGF-β1, and VEGF-C.

[0110] Preferably, the siRNA of ASAP1 is selected from any one of the following: i) sense strand: SEQ ID NO:64: AUUUGCUUCCAUAAUAUCAUU, antisense strand: SEQ ID NO:65: UGAUAUUAUGGAAGCAAAUUU; ii) sense strand: SEQ ID NO:66: UUAGGUUUGGGGUUGGAUCUU, antisense strand: SEQ ID NO:67: GAUCCAACCCCAAACCUAAUU.

[0111] Preferably, the antisense strand of the siRNA of ATAD2 is SEQ ID NO:68: GCGUCGAAGUUGUAGGAUUUU, and the sense strand is: SEQ ID NO:69: AAUCCUACAACUUCGACGCUU.

[0112] Preferably, the sense strand of the siRNA of CD24 is SEQ ID NO:70: UGUUUACAUUGUUGAGGUAUU, and the antisense strand is SEQ ID NO:71: UACCUCAACAAUGUAAACUUU.

[0113] Preferably, the siRNA of CD47 is selected from any one of the following: i) sense strand: SEQ ID NO:72: GGUGAUUACCCAGAGAUAUTT, antisense strand: SEQ ID NO:73: AUAUCUCUGGGUAAUCACCTT; ii) sense strand: SEQID NO:74: UGGUGAAAGAGGUCAUUCCUU, antisense strand: SEQ ID NO:75: GGAAUGACCUCUUUCACCAUU; iii) sense strand: SEQ ID NO:76: GGAAUGACCUCUUUCACCATT, antisense strand: SEQ ID NO:77: UGGUGAAAGAGGUCAUUCCTT; iv) sense strand: SEQ ID NO:78: GGUGAUUACCCAGAGAUAUUU, antisense strand: SEQID NO:79: AUAUCUCUGGGUAAUCACCUU.

[0114] Preferably, the siRNA of EGFR is selected from any one of the following: i) sense strand: SEQ ID NO:80: GGCUGGUUAUGUCCUCAUUUU, antisense strand: SEQ ID NO:81: AAUGAGGACAUAACCAGCCUU; ii) sense strand: SEQID NO:82: CCUUAGCAGUCUUAUCUAAUU, antisense strand: SEQ ID NO:83: UUAGAUAAGACUGCUAAGGUU; iii) sense strand: SEQ ID NO:84: UGCCUUAGCAGUCUUAUCUAAUU, antisense strand: SEQ ID NO:85: UUAGAUAAGACUGCUAAGGCAUU; iv) sense strand: SEQ ID NO:86: UGCCUUAGCAGUCUUAUCUAAUUUU, antisense strand: SEQ ID NO:87: AAUUAGAUAAGACUGCUAAGGCAUU.

[0115] Preferably, the sense strand of the siRNA of HBV is: SEQ ID NO:88: GGACUUCUCUCAAUUUUCUUU, and the antisense strand is: SEQ ID NO:89: AGAAAAUUGAGAGAAGUCCUU.

[0116] Preferably, the sense strand of the siRNA of HSP is: SEQ ID NO:90: CGCAGAACACCGUGUUCGAUU, and the antisense strand is: SEQ ID NO:91: UCGAACACGGUGUUCUGCGUU.

[0117] Preferably, the sense strand of the siRNA of HS70 is: SEQ ID NO:92: GGCCAACAAGAUCACCAUCUU, and the antisense strand is: SEQ ID NO:93: GAUGGUGAUCUUGUUGGCCUU.

[0118] Preferably, the siRNA of PD-L1 is selected from any one of the following: i) sense strand: SEQ ID NO:94: CCAGCACACUGAGAAUCAAUU, antisense strand: SEQ ID NO:95: UUGAUUCUCAGUGUGCUGGUU; ii) sense strand: SEQID NO:96: AGACGUAAGCAGUGUUGAATT, antisense strand: SEQ ID NO:97: UUCAACACUGCUUACGUCUTT.

[0119] Preferably, the siRNA of PAPP-1 is: sense strand: SEQ ID NO:98: GAGGAAGGUAUCAACAAAUTT, antisense strand: SEQ ID NO:99: AUUUGUUGAUACCUUCCUCTT.

[0120] Preferably, the siRNA of Survivin is selected from any one of the following: i) sense strand: SEQ ID NO:100: GCAGGUUCCUUAUCUGUCACAUU, antisense strand: SEQ ID NO:101: UGUGACAGAUAAGGAACCUGCUU; ii) sense strand: SEQ ID NO:102: GGAAUUGGAAGGCUGGGAACCUU, antisense strand: SEQ ID NO:103: GGUUCCCAGCCUUCCAAUUCCUU; iii) sense strand: SEQ ID NO:104: UGCAGGUUCCUUAUCUGUCATT, antisense strand: SEQ ID NO:105: UGACAGAUAAGGAACCUGCTT; iv) sense strand: SEQ ID NO:106: CUGCAGGUUCCUUAUCUGUCACAUU, antisense strand: SEQ ID NO:107: UGUGACAGAUAAGGAACCUGCAGUU.

[0121] Preferably, the siRNA of TAP is selected from any one of the following: i) sense strand: SEQ ID NO: 108: GCUGCACACGGUUCAGAAUUU, antisense strand: SEQ ID NO: 109: AUUCUGAACCGUGUGCAGCUU; ii) sense strand: SEQ ID NO: 110: CAGGAUGAGUUACUUGAAAUU, antisense strand: SEQ ID NO: 111: UUUCAAGUAACUCAUCCUGUU.

[0122] Preferably, the sense strand of the siRNA of TIM-3 is: SEQ ID NO: 112: GUGCUCAGGACUGAUGAAATT, antisense strand: SEQ ID NO: 113: UUUCAUCAGUCCUGAGCACTT.

[0123] Preferably, the siRNA of TGF-β1 is selected from any one of the following: i) sense strand: SEQ ID NO: 114: GUCAACUGUGGAGCAACACUU, antisense strand: SEQ ID NO: 115: GUGUUGCUCCACAGUUGACUU; ii) sense strand: SEQ ID NO: 116: GCAACAACGCCAUCUAUGATT, antisense strand: SEQ ID NO: 117: UCAUAGAUGGCGUUGUUGCTT.

[0124] Preferably, the siRNA of VEGF-C is selected from any one of the following: i) sense strand: SEQ ID NO: 118: GCAAGACGUUGUUUGAAAUUAUU, antisense strand: SEQ ID NO: 119: UAAUUUCAAACAACGUCUUGCUU; ii) sense strand: SEQ ID NO: 120: CAGCAAGACGUUGUUUGAAAUUAUU, antisense strand: SEQ ID NO: 121: UAAUUUCAAACAACGUCUUGCUGUU; iii) sense strand: SEQ ID NO: 122: CAGGAUGGUAAAGACUACAUU, antisense strand: SEQ ID NO: 123: UGUAGUCUUUACCAUCCUGUU.

[0125] Preferably, the ASO includes one or more of A-miR21, A-miR-10a, A-miR-30c and AmiR1306, and the miRNA includes one or more of miR-34, miR-542, miR-126 and miR-122.

[0126] Preferably, A-miR21 is selected from any one of the following DNA or RNA forms:

[0127] i) GATAAGCT;

[0128] ii) SEQ ID NO:124: GTCAACATCAGTCTGATAAGCTA;

[0129] iii) SEQ ID NO:125: TCAACATCAGTCTGATAAGCTA.

[0130] iv) Replace T in i) or ii) with U;

[0131] Preferably, A-miR-10a is ACAGGGTA;

[0132] Preferably, A-miR-30c is SEQ ID NO:126: GCTGAGAGTGTAGGATGTTTACA;

[0133] Preferably, the sequence of miR-34 is: TGTGACAG;

[0134] Preferably, the sequence of miR-542 is: TGGCAGTGT;

[0135] Preferably, the sequence of miR-126 is: UCGUACC; or UCGUACCG; or CGTACCG or GTCGTT;

[0136] Preferably, the sequence of miR-122 is: GGAAGTGT;

[0137] Preferably, the sequence of AmiR1306 is: SEQ ID NO:127: CATCACCACCAGAGCCAACGTC.

[0138] Furthermore, the aptamer includes an aptamer in the form of DNA or an aptamer in the form of RNA; preferably, the aptamer in the form of DNA includes at least one of the following aptamers: A1, A15, AS1411, AFP, ATP, Act-12c, A18, BAF7-1, C-MetSL-1, CH6, CA2, CRAC Orail target, CEA, CEA-18, CEA-T84, CSC1, CSC13, CD40, CD16a, CD19, CD3-4, CD44, CD12, CD20, CD24, CD24A-2, CD33, CD38, CD105, CD117, CD63, CD123, EGFR, EpCAM, EcR, FAP, GPC1, GPC3, GSK836, HBsAg, Her2, Her3, HMGA2, H2, IFN-γ, IL-4Ra, IL-17, LZH8, MUC1, M5, M7, M1, N5, N-G-Dua, NKG2D_#-20-N-15, NSE, SARS-CoV-2-N15, SARS-CoV-2-N48, SARS-CoV-2-N58, SARS-CoV-2-N61, OX40, PSMA, PDGFRβ, PDGF, PD-L1, PD1, PTK-7, ProGRP-48, SF, TBA15, TBA29, TIMC-d, TRRA4, TFRA3, TTA1, TLS9a, TGF-βII, TNF-α, TNF, T1, Vap7, VEGF121, VEGF-V7t1, VCAM-1, VCAM-12d, AX02, AX104, PL-45, EP166, AGC, Karpas299, SW620, MDA-MB-231, MCF-7 and PC-3; the aptamer in the form of RNA includes at least one of the following aptamers: A15, AS1411, BCMA, CTLA-4, CCL1, CEA, CD4-3, CD28, CD44, IL-4RA, EGFR, EpCAM, FGF2, FGF5, Her2, Her3, LAG-3, MUC1, MRP1, OX40, PSMA, PDGFRβ, TFRA4, TFRA3, TTA1, TIM3, TIMC-11, VEGF, VEGF165 and 4-1BB.

[0139] Preferably, the aptamer is selected from aptamers of at least one of the following sequences:

[0140] The A1 aptamer is:

[0141] SEQ ID NO:128: GGTTGCATGCCGTGGGGAGGGGGGTGGGTTTTATAGCGTACTCAG;

[0142] The A15 aptamer is: SEQ ID NO:129: CCCTCCTACATAGGG or SEQ ID NO:130: CCCUCCUACAUAGGG;

[0143] The AS1411 aptamer is:

[0144] 1) SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG; or

[0145] 2) SEQ ID NO:132: GGUGGUGGUGGUUGUGGUGGUGGUGG; or

[0146] 3) SEQ ID NO:133: AUUCUGAACCGUGUGCAGCACCACGCUGCACACGGUUCAGAAUACACA;

[0147] The AFP aptamer is:

[0148] SEQ ID NO:134:

[0149] GGCAGGAAGACAAACAAGCTTGGCGGCGGGAAGGTGTTTAAATTCCCGGGTCTGCGTGGTCTGTGGTGCTGT;

[0150] The ATP aptamer is: SEQ ID NO:135: ACCTGGGGAGTATTGGGGAGGAAGG, or SEQ ID NO:136: GGGAGGACGATGCGGAGGAAGGGTAGG;

[0151] The Act-12c aptamer is:

[0152] SEQ ID NO:137: CGGGGAAAGTCACGGGGGGTTTCAGATGTTCTGATCGGTGTGGAG; The A18 aptamer is: SEQ ID NO:138: CCAGATAGTCCCTGG;

[0153] The BAF aptamer is: SEQ ID NO:139: GATAACGGGCACGAATTCGGAGTG;

[0154] The BCMA aptamer is:

[0155] SEQ ID NO:140: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUAC;

[0156] The CTLA-4 aptamer is: 1) SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU; or 2) SEQ ID NO:142: TCCCTACGGCGCTAACGATGGTGAAAATGGGCCTAGGGTGGACGGTGCCACCGTGCTACAAC;

[0157] The C-Met-SL1 aptamer is:

[0158] SEQ ID NO:143: ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT;

[0159] The CH6 aptamer is:

[0160] SEQ ID NO:144: AGTCTGTTGGACCGAATCCCGTGGACGCACCCTTTGGACG;

[0161] The CA2 aptamer is: SEQ ID NO:145: CCCACGTCTGCGCTTAGCTCCTGGGCCTGGATGGGC; The CCL1 aptamer is:

[0162] SEQ ID NO:146: UGACUCCUCUGACAGCCUAAUUUCUCCCGAUUACCCUG;

[0163] The CRAC Orail target aptamer is:

[0164] SEQ ID NO:147: CCAGTAGCCATACCGGTTTGTGGATGGGGTGTATGCGAGT;

[0165] The CEA aptamer is:

[0166] 1) SEQ ID NO:148: CTAGGATCCCCACTCACCATCTCTCAGCTTGCTTCCTAGC; or

[0167] 2) SEQ ID NO:149: CUAGGAUCCCCACUCACCAUCUCUCAGCUUGCUUCCUAGC; or

[0168] 3) SEQ ID NO:150: TTAACTTATTCGACCATA; or

[0169] 4) SEQ ID NO:151: TCGCGCGAGTCGTCTGGGGAACCATCGAGTTACACCGACCTTCTATGTGCGGCCCCCCGC ATCGTCCTCCC;

[0170] The CSC1 aptamer is:

[0171] SEQ ID NO:152: ACCTTGGCTGTCGTGTTGTAGGTGGTTTGCTGCGGTGGGCTCAAGAAGAAAGCGCAAAG AGGTCAGTGGTCAGAGCGT;

[0172] The CSC13 aptamer is:

[0173] SEQ ID NO:153: ACCTTGGCTGTCGTGTTGTGGGGTGTCGTATCTTTCGTGTCTTATTATTTTCTAGGTGGAG GTCAGTGGTCAGAGCGT;

[0174] The CD40 aptamer is:

[0175] 1) SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG;

[0176] 2) SEQ ID NO:155: AGAGACGATGCGGCCAACGAGTAGGCGATAGCGCGTGGCAGAGCGTCGCT;

[0177] 3) SEQ ID NO:156: GCCAACGAGTAGGCGATAGCGCGTGGC;

[0178] The CD16a aptamer is:

[0179] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG;

[0180] The CD19 aptamer is:

[0181] 1) SEQ ID NO:158: TGCGTGTGTAGTGTGTGTCGTTTCTCCTTTTTTTGGTTGCTGCTCTTAGGGATTTGGGCGG; or

[0182] 2) SEQ ID NO:159: TGCGTGTGTAGTGTGTCTGTTCTCCTTTTTTTGGTTGCTGCTCTTAGGGATTTGGGCGG, and the CD4-3 aptamer is:

[0183] SEQ ID NO:161: GGGAGGACGAUGCGGUUUGGGGUUUUCCCGUGCCCCAGACGACUCGCCCGA;

[0184] The CD3-4 aptamer is:

[0185] SEQ ID NO:162: TCTCGGACGCGTGTGGTCGGCCGAGTGGCCCACGGTAGAAGGGTTAGAACTGCTGGTTG GTGAATCTCGCTGCCTGGCCCTAGAGTG;

[0186] The CD44 aptamer is:

[0187] SEQ ID NO:163: CCAAGGCCTGCAAGGGAACCAAGGACACAG;

[0188] The CD12 aptamer is:

[0189] SEQ ID NO:164: GTGGATTGTTGTGTTCTGTTGGTTTTTGTGTTGTC;

[0190] The CD20 aptamer is:

[0191] SEQ ID NO:165: TGCGTGTGTAGTGTGTCTGTTTTTTATCTTCTTTTATCTACTCTTAGGGATTTGGGCGG;

[0192] The CD24 aptamer is:

[0193] SEQ ID NO:166: TATGTGGGTGGGTGGGCGGTTATGCTGAGTCAGCCTTGCT;

[0194] The CD24A-2 aptamer is:

[0195] SEQ ID NO:167: ATCCAGAGTGACGCAGCATATGTGGGTGGGTGGGCGGTTATGCTGAGTCAGCCTTGCTTG GACACGGTGGCTTAGT;

[0196] The CD28 aptamer is:

[0197] SEQ ID NO:168: GGGAGAGAGGAAGAGGGAUGGGGAUUAGACCAUAGGCUCCCAACCCCCCCCGGGAGA GAGGAAGAGGGAUGGGGAUUAGACCAUAGGCUCCCAACCCCCGGG;

[0198] The CD33 aptamer is:

[0199] SEQ ID NO:169: TACCAGTGCGATGCTCAGCACGCTTATAGGGGCTGGACAAAATTCTACCCAGCCTTT;

[0200] The CD38 aptamer is: SEQ ID NO:170: TACGTGAATCTCGTACGATACTCTGTAAGCGT;

[0201] The CD44 aptamer is:

[0202] SEQ ID NO:171: GGGAUGGAUCCAAGCUUACUGGCAUCUGGAUUUGCGCGUGCCAGAAUAAAGAGUAU AACGUGUGAAUGGGAAGCUUCGAUAGGAAUUCGG;

[0203] The CD105 aptamer is:

[0204] SEQ ID NO:172: GATCAGTTTTCCATGCCAGTTGGTATTCCGCGACAGTTTGATCTC;

[0205] The CD117 aptamer is: SEQ ID NO:173: GGGGGCCGGGGCAAGGGGGGGGTACCGTGGTAGGAC;

[0206] The CD63 aptamer is: SEQ ID NO:174: CACCCCACCTCGCTCCCGTGACACTAATGCTA;

[0207] The CD123 aptamer is:

[0208] SEQ ID NO:175: TGCGTGTGTAGTGTGTCTGGGCTACATCGATGAGCTGCCTAGGGTCCCTCTTAGGGATTT GGGCGG;

[0209] The EGFR aptamer is:

[0210] 1) SEQ ID NO:176: GCCTTAGTAACGTGCTTTGATGTCGATTCGACAGGAGGC; or

[0211] 2) SEQ ID NO:177: GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC; or

[0212] 3) SEQ ID NO:178: UGCCGCUAUAAUGCACGGAUUUAAUCGCCGUAGAAAAGCAUGUCAAAGCCGUU;

[0213] The EpCAM aptamer is:

[0214] 1) SEQ ID NO:179: GCGACUGGUUACCCGGUCG; or

[0215] 2) SEQ ID NO:180: CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG; or

[0216] 3) SEQ ID NO:181: GACAAACGGGGGAAGATTTGACGTCGACGAC;

[0217] The EcR aptamer is:

[0218] SEQ ID NO:182: GCAGGTCCACTGCGGGGGTCTATACGTGAGGAAGAAGTGGGCAGGTC;

[0219] The FGF2 aptamer is:

[0220] 1) SEQ ID NO:183: GGGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCCC;

[0221] 2) SEQ ID NO:184: GGGAAACUAGGGCGUUAACGUGACCAGUGUUUCUCGA;

[0222] 3) SEQ ID NO:185: GGGAAACUAGGGCGUUAACGUGACCAGUGUUUCCC;

[0223] The FGF5 aptamer is:

[0224] SEQ ID NO:186: GGGCGACCUCUCCGUACUGACCUACAGAGCGACAUACUAGUGUAUCCAGAUCGCCC; The FAP aptamer is: 1) SEQ ID NO:187: TGGGGGTTGAGGCTAAGCCGA; or

[0225] 2) SEQ ID NO:188: CCGCTCGAGCTAGTCTGACAAAGAGAAACAC;

[0226] The GPC1 aptamer is: SEQ ID NO:189: AACGGAGTGTGGCTAACTCGA;

[0227] The GPC3 aptamer is: SEQ ID NO:190: TAACGCTGACCTTAGCTGCATGGCTTTACATGTTCCA;

[0228] The GSK836 aptamer is: SEQ ID NO:191: GCAGAGGTGAAGCGAAGTCG;

[0229] The HBsAg aptamer is:

[0230] SEQ ID NO:192: CACAGCGAACAGCGGCGGACATAATAGTGCTTACTACGAC;

[0231] The Her2 aptamer is:

[0232] 1) SEQ ID NO:193: AGCCGCGAGGGGAGGGATAGGGTAGGGCGCGGCT; or

[0233] 2) SEQ ID NO:194: AGCCGCGAGGGGAGGGAUAGGGUAGGGCGCGGCU;

[0234] The Her3 aptamer is:

[0235] 1) SEQ ID NO:195:GGGAGCTCAGAATAAACGCTCAAAGGGTCAAGCTGATTACACTTTGTCCACTATTGGGTC CTTCGACATGAGGCCCGGATC; or

[0236] 2) SEQ ID NO:196: GGGAGCTCAGAATAAACGCTCAAGGCTAACAGCACGCAACGGGGGGGAGTAATCGTGTCTGTTCGACATGAGGCCCGGATC; or

[0237] 3) SEQ ID NO:197: CAGCGAAAGUUGCGUAUGGGUCACAUCGCAGGCACAUGUCAUCUGGGCG; or

[0238] 4) SEQ ID NO:198: GAAUUCCGCGUGUGCCAGCGAAAGUUGCGUAUGGGCCACAUCGCAGGCACAUGUCAUCUGGGCGGUCCGUUCGGGAUCC;

[0239] The HMGA2 - aptamer is: SEQ ID NO:199: GGAAAAAATTTTTTAAAAAACCC;

[0240] The H2 - aptamer is:

[0241] SEQ ID NO:200:

[0242] GGGCCGTCGAACACGAGCATGGTGCGTGGACCTAGGATGACCTGAGTACTGTCC;

[0243] The IFN - γ - aptamer is:

[0244] SEQ ID NO:201: CCGCCCAAATCCCTAAGAGAAGACTGTAATGACATCAAACCAGACACACACACTACACACGCA;

[0245] The IL - 4Ra - aptamer (i.e., the CD124 - aptamer) is:

[0246] 1) SEQ ID NO:202: GGAGGACGAUGCGGAAAAAGCAACAGGGUGCUCCAUGCGCAUGGAACCUGCGCGCAGACGACUCGCUGAGGAUCCGAGA; or

[0247] 2) SEQ ID NO:203: AAAAAGCAACAGGGUGCUCCAUGCGCAUGGAACCUGCGCG; The IL - 17 - aptamer:

[0248] 1) SEQ ID NO:204: CTTGGATCACCATAGTCGCTAGTCGAGGCT; or

[0249] 2) SEQ ID NO:205: GCGGCATCCTATCACGCATTGACC

[0250] The LAG-3 aptamer is:

[0251] SEQ ID NO:206: GGGAGAGAGAUAUAAGGGCCUCCUGAUACCCGCUGCUAUCUGGACCGAUCCCAUUAC CAAAUUCUCUCCC;

[0252] The LZH8 aptamer is:

[0253] SEQ ID NO:207: ATCCAGAGTGACGCAGCATATTAGTACGGCTTAACCCCATGGTGGACACGGTGGCTTAGT;

[0254] The MUC1 aptamer is:

[0255] 1) SEQ ID NO:208: GCAGTTGATCCTTTGGATACCCTGG; or

[0256] 2) SEQ ID NO:209: GAAGTGAAAATGACAGAACACAACA; or

[0257] 3) SEQ ID NO:210: AACCGCCCAAATCTCTAAGAGTCGGACTGCAACCTATGCTATCGTTGATGTCTGTCCAAG CAACACAGACACACTACACACACGCACA; or

[0258] 4) SEQ ID NO:211: AATGACAGAACACAACATT; or

[0259] 5) SEQ ID NO:212: GCAGUUGAUCCUUUGGAUACCCUGG;

[0260] The M5 aptamer is:

[0261] SEQ ID NO:213: AGCAGCACAGAGGTCAGATGCTTGGTTCCACCGTACTGACTGTAGTAAAATCTGATCACT CCTATGCGTGCTACCGTGAA;

[0262] The M7 aptamer is:

[0263] SEQ ID NO:214: AGCAGCACAGAGGTCAGATGTAGTCGGTCTTCTTGTTTGAAACTGCTAATTTTGAAAAAA CCTATGCGTGCTACCGTGAA;

[0264] The M1 aptamer is:

[0265] SEQ ID NO:215: AGCAGCACAGAGGTCAGATGATATAACCTTAATAAATAAAATATAAATTATTTAATCTTACC TATGCGTGCTACCGTGAA;

[0266] The MRP1 aptamer is:

[0267] SEQ ID NO:216: GGGAGAAUAGUCAACAAAUCGUUUGGGGCGACUUCUCCUUCCUUUCUCCC;

[0268] The N5 aptamer is: SEQ ID NO:217: GATTGAGTAGATAGTGGTTCTGTACGTAGTGAAAGAGTGG;

[0269] The N-G-Dua aptamer is:

[0270] SEQ ID NO:218: CAAGTTGCTCGTCGCGATACGTTTGGTTGGTGTGGTTGGCAGTATCGCAGGTCCAAGTTG CTCGTCGCGATACAACGGAGTGTGGCTAACTCGA;

[0271] The NKG2D_#-20-N-15 aptamer is:

[0272] SEQ ID NO:219: CAAGTTGCTCGTCGCGATACGTTTGGTTGGTGTGGTTGGCAGTATC;

[0273] The NSE aptamer is: SEQ ID NO:220: TCACACGGACCTCTCTCTACATTAATTGCGCATTTCGTT;

[0274] The SARS-CoV-2-N15 aptamer is:

[0275] SEQ ID NO:221: GCTGGATGTTCATGCTGGCAAAATTCCTTAGGGGCACCGTTACTTTGACACATCCAGC;

[0276] The SARS-CoV-2-N48 aptamer is:

[0277] SEQ ID NO:222: GCTGGATGTCGCTTACGACAATATTCCTTAGGGGCACCGCTACATTGACACATCCAGC;

[0278] The SARS-CoV-2-N58 aptamer is:

[0279] SEQ ID NO:223: GCTGGATGTCACCGGATTGTCGGACATCGGATTGTCTGAGTCATATGACACATCCAGC;

[0280] The SARS-CoV-2-N61 aptamer is:

[0281] SEQ ID NO:224: GCTGGATGTTGACCTTTACAGATCGGATTCTGTGGGGCGTTAAACTGACACATCCAGC;

[0282] The OX40 aptamer is:

[0283] 1) SEQ ID NO:225: GGGAGGACGATGCGGCAGTCTGCATCGTAGGAATCGCCACCGTATACTTTCCCACCAGAC GACTCGCTGAGGATCCGAGA;

[0284] 2) SEQ ID NO:226: GGGAGGACGAUGCGGCAGUCUGCAUCGUAGGAAUCGCCACCGUAUACUUUCCCACCA GACGACUCGCUGAGGAUCCGAGA;

[0285] 3) SEQ ID NO:227: CAGTCTGCATCGTAGGATTAGCCACCGUATCTTTCCCAC;

[0286] 4) SEQ ID NO:228: GGGAGGACGAUGCGGCAGUCUGCAUCGUAGGAAUCGCCACCGUAUACUUUCCCACCA GACGACUCGCUG;

[0287] 5) SEQ ID NO:229: CAGUCUGCAUCGUAGGAAUCGCCACCGUAUACUUUCCCAC;

[0288] 6) SEQ ID NO:230: GGGAUGCGGAAAAAAGAACACUUCCGAUUAGGGCCCACCCUAACGGCCGCAGAC;

[0289] The PSMA aptamer is:

[0290] 1) SEQ ID NO:231: GGGAGGACGATGCGGATCAGCCATGTTTACGTCACTCCT; or

[0291] 2) SEQ ID NO:232: GCGTTTTCGCTTTTGCGTTTTGGGTCATCTGCTTACGATAGCAATGCT; or

[0292] 3) SEQ ID NO:233: GGGAGGACGAUGCGGAUCAGCCAUGUUUACGUCACUCCU; or

[0293] 4) SEQ ID NO:234: GGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUCCC;

[0294] The PDGFRβ aptamer is:

[0295] 1) SEQ ID NO:235: TGTCGTGGGGCATCGAGTAAATGCAATTCGACA; or

[0296] 2) SEQ ID NO:236: UGUCGUGGGGCAUCGAGUAAAUGCAAUUCGACA;

[0297] The PDGF aptamer is:

[0298] SEQ ID NO:237: CAGGCTACGGCACGTAGAGCATCACCATGATCCTG;

[0299] The aptamers of PD-L1 are selected from any one or more of the following:

[0300] 1) SEQ ID NO:238: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGG;

[0301] 2) SEQ ID NO:239: GCCCCAGTTATGCTTTCCCCCTCTGTCTCTTTG;

[0302] 3) SEQ ID NO:240: ATCGCCCGCAGCACCCATTTGTTTTTTTTTG;

[0303] 4) SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT;

[0304] 5) SEQ ID NO:242: TGCCCGCACATCAACTCATTGATAGACAATGCGTCCACTCGGGCA;

[0305] 6) SEQ ID NO:243: TGCCCGCACATCAACTCATTGATAGACAATGCGTCCACTACGGGC;

[0306] 7) SEQ ID NO:244: CGGGCACACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT;

[0307] 8) SEQ ID NO:245: GTTGGTCACATCAACTCATTGATAGACAATGCGTCCACTACCAAC;

[0308] 9) SEQ ID NO:246: GGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCC;

[0309] 10) SEQ ID NO:247: TGGTTGCACATCAACTCATTGATAGACAATGCGTCCACTCAACCA;

[0310] 11) SEQ ID NO:248: TACAGGTTCTGGGGGGTGGGTGGGGAACCTGTT;

[0311] 12) SEQ ID NO:249: CTACGAGACGAACTTATGCGTAATAATGACTGTCGTAG;

[0312] The PD1 aptamer is selected from any one or more of the following:

[0313] 1) SEQ ID NO:250: GACGATAGCGGTGACGGCACAGACGGTACAGTTCCCGTCCCTGCACTACACGTATGCCGCTTCCGTCCGTCGCTC;

[0314] 2) SEQ ID NO:251: GAGCGACGGACGGAAGCGGCATACGTGTAGTGCAGGGACGGGAACTGTACCGTCTGTGCCGTCACCGCTATCGTC;

[0315] 3) SEQ ID NO:252: GGATCCTATGACGCATTGACCCGCTGCCTCTACTGAGGCTGTGTCAGTGTGCGGCTCGGACTGTTGAATTC;

[0316] 4) SEQ ID NO:253: AGCGGTGACGGCACAGACGGTACAGTTCCCGTCCCTGCACTACACGTATGCCGCT;

[0317] 5) SEQ ID NO:254: ACCGACAGTGAAGGACTCAGCGAACTCTCAGACTCGGTTC;

[0318] The PTK-7 aptamer is:

[0319] SEQ ID NO:255: ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA;

[0320] The ProGRP-48 aptamer is:

[0321] SEQ ID NO:256: CATGCGGAGTAGAGCGAGCCCAGATAGTCCCTGGTTATTTCCTTAGG;

[0322] The SF aptamer is:

[0323] SEQ ID NO:257: GATCTCTCTCTGCCCTAAGTCCGCACCCGTGCTTCCCTGT;

[0324] The TBA15 aptamer is: SEQ ID NO:258: GGTTGGTGTGGTTGG;

[0325] The aptamer of TBA29 is: SEQ ID NO:259: AGTCCGTGGTAGGGCAGGTTGGGGTGACT;

[0326] The aptamer of TFRA4 is: SEQ ID NO:260: GCGTGGTACCACGC or SEQ ID NO:261: GCGUGGUACCACGC;

[0327] The aptamer of TFRA3 is:

[0328] 1) SEQ ID NO:262: GCGTGGTCACACGC; or

[0329] 2) SEQ ID NO:263: GCGUGGUCACACGC; or

[0330] 3) SEQ ID NO:264: GCGGCGCCCACGAGCGTTCGCGTGGTCACACGCGTTCCGCCCTCCTACATAGGGCGCATAGCCGTGGGCGCCGC;

[0331] The aptamer of TTA1 is:

[0332] SEQ ID NO:265: CCTGCACTTGGCTTGGATTTCAGAAGGGAGACCC; or

[0333] SEQ ID NO:267: CCUGCACUUGGCTTGGAUUUCAGAAGGGAGACCC;

[0334] The aptamer of TLS9a is:

[0335] SEQ ID NO:268: AGTCCATTTTATTCCTGAATATTTGTTAACCTCATGGAC;

[0336] The aptamer of TGF-β is:

[0337] SEQ ID NO:269: ACATTGCTGCGTGATCGCCTCACATGGGTTTGTCTGGTCGATTTGGAGGTGGTGGGTGGC;

[0338] The aptamer of TIM3 is:

[0339] SEQ ID NO:270: GGGAGAGGACCAGUA-GCCACUAUGGUGUUGGAGCUAGCGG-CAGAGCGUCGCGGUCCCUCCC; or

[0340] SEQ ID NO:271: GGGAGAGGACCAGUA-CUGGUAGUUCUCUGUGCGACUCCUA-CAGAGCGUCGCGGUCC CUCCC;

[0341] The TIMC-d aptamer is:

[0342] SEQ ID NO:272: AAGCAACACUUAGUCGCGAUUGAUACGUGCGCAGUCAU;

[0343] The TIMC-11 aptamer is:

[0344] SEQ ID NO:273: GGAGGACGAUGCGGGGAAGCAACACUUAGUCGCGAUUGAUACGUGCGCAGUCAUCA GACGACUCGCUGAGGAUCCGAGA;

[0345] The TNF-α aptamer is: SEQ ID NO:274: GCGGCCGATAAGGTCTTTCCAAGCGAACGAAAA;

[0346] The TNF aptamer is: SEQ ID NO:275: GCGCCACTACAGGGGAGCTGCCATTCGAATAGGTGGGCCGC;

[0347] The T1 aptamer is:

[0348] SEQ ID NO:276: CGCTCGATAGATCGAGCTTCGCTCGATGTGGTGTTGTGGGGGCTTGTATTGGTCGATCAC GCTCTAGAGCACTG;

[0349] The sequence of the Vap7 aptamer is: SEQ ID NO:277: TGGTGGGGGTGGACGGGCCGGGTAGA;

[0350] The VEGF aptamer is:

[0351] SEQ ID NO:278: AUGCAGUUUGAGAAGUCGCGCAU; or SEQ ID NO:279: GGTGGGGGTGGACGGGCCGGGTAGA;

[0352] The VEGF165 aptamer is: SEQ ID NO:280: CGGAAUCAGUGAAUGCUUAUACAUCCG;

[0353] The VEGF121 aptamer is: SEQ ID NO:281: TGTGGGGGTGGACTGGGTGGGTACC;

[0354] The VEGF-V7t1 aptamer is: SEQ ID NO:282: TGTGGGGGTGGACGGGCCGGGTAGA;

[0355] The VCAM-1 aptamer is:

[0356] SEQ ID NO:283: ATACCAGCTTATTCAATTGGACACGGCAAAGGGGTATAGCCTACCGGACCGTGAACATGG AATGGTGTGCTGCGTGGAGATAGTAAGTGCAATCT; or

[0357] SEQ ID NO:284: GGACACGGCAAAGGGGTATAGCCTACCGGACCGTGAACATGGAATGGTGTGCTGCGTGG;

[0358] The VCAM-12d aptamer is:

[0359] SEQ ID NO:285: AGGGAATCTTGCCTAGGGAGGGAGTAGCGAAAGGGCTCA;

[0360] The 4-1BB aptamer is:

[0361] SEQ ID NO:286: GGGAGAGAGGAAGAGGGAUGGGCGACCGAACGUGCCCUUCAAAGCCGUUCACUAACC AGUGGCAUAACCCAGAGGUCGAUAGUACUGGAUCCCCCC;

[0362] The PL-45 aptamer is:

[0363] SEQ ID NO:287: ACTCATAGGGTTAGGGGCTGCTGGCCAGATACTCAGATGGTAGGGTTACTATGAGC;

[0364] The EP166 aptamer is:

[0365] SEQ ID NO:288: AACAGAGGGACAAACGGGGGAAGATTTGACGTCGACGACA;

[0366] The AGC aptamer is:

[0367] SEQ ID NO:289: CGACCCGGCACAAACCCAGAACCATATACACGATCATTAGTCTCCTGGGCCG;

[0368] The Karpas299 aptamer is:

[0369] SEQ ID NO:290: ATCCAGAGTGACGCAGCACCACCACCGTACAATTTTTTCATTACCTACTCGGC;

[0370] The SW620 aptamer is:

[0371] SEQ ID NO:291:CCCATCAATGTTACGACCCGCTAGGGCTGCTGTGCCATCGGGTAA;

[0372] The MDA-MB-231 aptamer is:

[0373] SEQ ID NO:292: AGAATTCAGTCGGACAGCGAAGTAGTTTTCCTTCTAACCTAAGAACCCGCGGCAGTTTAA TGTAGATGGACGAA;

[0374] The MCF-7 aptamer is:

[0375] SEQ ID NO:293: GCATGGGGTTTCGGCGTTTCGTCTATCTTGTTTCTGTTAGCGTCT;

[0376] The PC-3 aptamer is SEQ ID NO:294: TGCCACTACAGCTGGTTCGGTTTGGTGACTTCGTTCTTCGTTGTGGTGCTTAGTGGC.

[0377] Furthermore, the small molecule compounds with targeting effects are selected from one or more of folic acid, biotin, vitamin B12 and mannose, and the small molecule compounds with targeting effects are located at the 5'-end or 3'-end of at least one of the a sequence, b sequence and c sequence.

[0378] Furthermore, various different oligonucleotide effector molecules are each independently attached to the nucleic acid carrier by any one or more of the following methods: 1) single-stranded adhesive bridge sequence; 2) complementary sequence of the single-stranded adhesive bridge sequence; 3) transition sequence, wherein the single-stranded adhesive bridge sequence and the transition sequence are the single-stranded adhesive bridge sequence and the transition sequence in the nucleic acid carrier of claim 3.

[0379] Further, one or more nucleotide molecules of at least one oligonucleotide effector molecule have modifications selected from at least one of the following: fluorination, methyl, amino, disulfide, carbonyl, carboxyl, mercapto, aldehyde, thio, inverted dT, and locked nucleic acid.

[0380] Further, there is a thio modification in the phosphate backbone between the 5'-terminal nucleotides of the antisense strand and the sense strand of siRNA, and the 3'-end has dTdT modification or UU, or the 3'-end of the antisense strand of siRNA is linked to AA, UU, or a combination of any two nucleotides.

[0381] Further, miRNA has thio modification or locked nucleic acid modification.

[0382] Further, the aptamer has any one or more of the following modifications: thio, 2'-F, or 2'-O-MOE.

[0383] Further, the nucleic acid immune stimulant has thio modification.

[0384] Further, the nucleic acid drug is selected from any one of the following 99 drugs.

[0385] Drug 1): 3*CpG2006-DNA vector, wherein the DNA vector is the 13th group of the nucleic acid vectors with the aforementioned 26 backbone sequences, and 3 CpG2006 are respectively linked to the 5'-ends of the a sequence, b sequence, and c sequence through a spacer sequence;

[0386] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a thio modification in the phosphate backbone between adjacent two nucleotides;

[0387] Preferably, the spacer sequence is TTTTT.

[0388] Drug 2): 2*CpG1826-2*mannose-DNA vector, wherein the DNA vector is the 1st group of the nucleic acid vectors with the aforementioned 26 backbone sequences, 2 CpG1826 are respectively linked to the 5'-ends of the a sequence and c sequence through a spacer sequence, and 2 mannoses are respectively located at the 5'-end and 3'-end of the b sequence;

[0389] Preferably, the spacer sequence is TTTTT;

[0390] Preferably, the sequence of CpG1826 is: SEQ ID NO:59: TCCATGACGTTCCTGACG, and there is a thio modification in the phosphate backbone between adjacent two nucleotides.

[0391] Drug 3): 2*CpG1826-CD40 aptamer-DNA vector, wherein the DNA vector is the first group of the nucleic acid vectors with the aforementioned 26 backbone sequences, and two CpG1826 are respectively connected to the 5'-ends of the a sequence and the c sequence through a linker sequence, and the CD40 aptamer is connected to the 5'-end of the b sequence through a linker sequence;

[0392] Preferably, the sequence of CpG1826 is: SEQ ID NO:59: TCCATGACGTTCCTGACG, and there is a thiophosphate modification in the phosphodiester backbone between adjacent nucleotides;

[0393] Preferably, the linker sequence is TTTTT;

[0394] Preferably, the sequence of the CD40 aptamer is SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG.

[0395] Drug 4): 2*CpG2006-CD40 aptamer-DNA vector, wherein the DNA vector is the first group of the nucleic acid vectors with the aforementioned 26 backbone sequences, and two CpG2006 are respectively connected to the 5'-ends of the a sequence and the c sequence through a linker sequence, and the CD40 aptamer is connected to the 5'-end of the b sequence through a linker sequence;

[0396] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a thiophosphate modification in the phosphodiester backbone between adjacent nucleotides;

[0397] Preferably, the linker sequence is TTTTT;

[0398] Preferably, the sequence of the CD40 aptamer is SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG.

[0399] Drug 5): 4*CpG2006-CD40 aptamer-DNA vector, wherein the DNA vector is the first group of the nucleic acid vectors with the aforementioned 26 backbone sequences, two CpG2006 are concatenated into a CpG2006 dimer, and two CpG2006 dimers are respectively connected to the 5'-ends of the a sequence and the c sequence, and the CD40 aptamer is connected to the 5'-end of the b sequence through a linker sequence;

[0400] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a thiophosphate modification in the phosphodiester backbone between adjacent nucleotides;

[0401] Preferably, the linker sequence is TTTTT;

[0402] Preferably, the sequence of the CD40 aptamer is SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG.

[0403] Drug 6): 2*CpG1826 - CD40 aptamer - 2*mannose - DNA vector, wherein the DNA vector is the first group of the aforementioned nucleic acid vectors, two CpG1826 are respectively connected to the 5'-ends of the a sequence and the c sequence through a linker sequence, the CD40 aptamer is connected to the 5'-end of the b sequence through a linker sequence, and two mannoses are respectively located at the 3'-ends of the b sequence and the c sequence;

[0404] Preferably, the sequence of CpG1826 is: SEQ ID NO:59: TCCATGACGTTCCTGACG, and there is a thiophosphate modification in the phosphate backbone between adjacent two nucleotides;

[0405] Preferably, the linker sequence is TTTTT;

[0406] Preferably, the sequence of the CD40 aptamer is SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a thiophosphate modification in the phosphate backbone between the first three nucleotides at the 5'-end.

[0407] Drug 7): CpG1826 - CD40 aptamer - mannose - MUC1 aptamer - DNA vector, wherein the DNA vector is the first group of the 26 nucleic acid vectors with backbone sequences, CpG1826 is connected to the 5'-end of the a sequence through a linker sequence, the CD40 aptamer is connected to the 5'-end of the b sequence through a linker sequence, the MUC1 aptamer is connected to the 5'-end of the c sequence through a linker sequence, and mannose is located at the 3'-end of the c sequence;

[0408] Preferably, the sequence of CpG1826 is: SEQ ID NO:59: TCCATGACGTTCCTGACG, and there is a thiophosphate modification in the phosphate backbone between adjacent two nucleotides;

[0409] Preferably, the linker sequence is TTTTT;

[0410] Preferably, the sequence of the CD40 aptamer is SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG;

[0411] Preferably, the sequence of the MUC1 aptamer is: SEQ ID NO:208: GCAGTTGATCCTTTGGATACCCTGG.

[0412] Drug 8) 2*CpG2006-CD40 aptamer-AmiR-21-3*mannose-DNA vector, wherein the DNA vector is the 1) group among the nucleic acid vectors of the aforementioned 26 backbone sequences, 2 CpG2006 are respectively connected to the 5' ends of the a sequence and the c sequence through a linker sequence, the CD40 aptamer is connected to the 5' end of the b sequence through a linker sequence, AmiR-21 is directly connected to the 3' end of the b sequence, and 3 mannoses are respectively connected to the 3' ends of the a sequence, AmiR-21 and the c sequence;

[0413] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent two nucleotides;

[0414] Preferably, the linker sequence is TTTTT;

[0415] Preferably, the sequence of the CD40 aptamer is SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG;

[0416] Preferably, the sequence of AmiR-21 is GATAAGCT, and each position is locked nucleic acid modified.

[0417] Drug 9): 2*CpG2006-CD40 aptamer-CD16a aptamer-CTLA-4 aptamer-DNA vector, wherein the DNA vector is the 2) group among the nucleic acid vectors of the aforementioned 26 backbone sequences, 2 CpG2006 are respectively connected to the 5' ends of the a sequence and the c sequence through a linker sequence, the CD40 aptamer is connected to the 3' end of the b sequence through a linker sequence, the CD16a aptamer is connected to the 5' end of the b sequence through a linker sequence, and the CTLA-4 aptamer is connected to the 3' end of the c sequence through a linker sequence;

[0418] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent two nucleotides;

[0419] Preferably, the linker sequence is TTTTT;

[0420] Preferably, the sequence of the CD16a aptamer is:

[0421] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is a phosphorothioate modification between the first 2 positions at the 5' end;

[0422] Preferably, the sequence of the CD40 aptamer is:

[0423] SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, with a phosphorothioate modification in the phosphate backbone between the last two nucleotides at the 3'-end;

[0424] Preferably, the sequence of the CTLA-4 aptamer is:

[0425] SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, with a phosphorothioate modification in the phosphate backbone between the 2nd and 3rd nucleotides from the 3'-end.

[0426] Drug 10): 2*CpG2006 - CTLA-4 aptamer - PD-L1 aptamer - DNA vector, wherein the DNA vector is the 3rd group of the nucleic acid vectors with the aforementioned 26 backbone sequences, two CpG2006 are concatenated into a CpG2006 dimer, the CpG2006 dimer is connected to the 5'-end of the a sequence through a spacer sequence, the PD-L1 aptamer is connected to the 5'-end of the c sequence through a spacer sequence, and the CTLA-4 aptamer is connected to the 5'-end of the b sequence through a spacer sequence;

[0427] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, with a phosphorothioate modification in the phosphate backbone between adjacent nucleotides;

[0428] Preferably, the sequence of the PD-L1 aptamer is:

[0429] SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end;

[0430] Preferably, the sequence of the CTLA-4 aptamer is:

[0431] SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end;

[0432] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, with a phosphorothioate modification in the phosphate backbone between adjacent nucleotides;

[0433] Preferably, the spacer sequence is TTTTT.

[0434] Drug 11): CpG2006-CD40 aptamer-PD-L1 aptamer-DNA vector, selected from any one of the following structures:

[0435] i) CCPD3: The DNA vector is the 12th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. CpG2006 is linked to the 5' end of the a sequence through a spacer sequence, the PD-L1 aptamer is linked to the 5' end of the c sequence through a spacer sequence, and the CD40 aptamer is linked to the 5' end of the b sequence through a spacer sequence; wherein, in the DNA vector, there is a phosphorothioate modification in the phosphate backbone among the first 3 nucleotides at the 3' ends of the a sequence, the b sequence, and the c sequence.

[0436] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent two nucleotides.

[0437] Preferably, the sequence of the PD-L1 aptamer is:

[0438] SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a phosphorothioate modification in the phosphate backbone among the first 3 adjacent nucleotides at the 5' end.

[0439] Preferably, the sequence of the CD40 aptamer is:

[0440] SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a phosphorothioate modification in the phosphate backbone among the first 3 adjacent nucleotides at the 5' end.

[0441] Preferably, the spacer sequence is TTTTT.

[0442] Or

[0443] ii) CCPD3 variant 1: The DNA vector is the 12th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. CpG2006 is linked to the 5' end of the a sequence through the spacer sequence TTTTT, the CD40 aptamer is linked to the 5' end of the b sequence through the spacer sequence TTTTT; the PD-L1 aptamer is linked to the 5' end of the c sequence through the spacer sequence ATTT, wherein, in the DNA vector, there is a phosphorothioate modification in the phosphate backbone among the first 2 nucleotides at the 3' ends of the a sequence, the b sequence, and the c sequence.

[0444] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent two nucleotides.

[0445] Preferably, the sequence of the CD40 aptamer is:

[0446] SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, with a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5' end;

[0447] Preferably, the sequence of the PD-L1 aptamer is:

[0448] SEQ ID NO:238: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGG, with a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5' end;

[0449] Or

[0450] iii) CCPD3 variant 2: The sequence of the DNA vector is:

[0451] Sequence a: SEQ ID NO:295: GCCCACGAGCGTTCCGGGAGA;

[0452] Sequence b: SEQ ID NO:49: TCTCCCGGTTCGCCGCGAG;

[0453] Sequence c: SEQ ID NO:296: CTCGCGGCCATAGCCGTGGGC;

[0454] CpG2006 is linked to the 5' end of sequence a through the spacer sequence TTTT, the CD40 aptamer is linked to the 5' end of sequence b through the spacer sequence TTTT, and the PD-L1 aptamer is linked to the 5' end of sequence c through the spacer sequence TTTT,

[0455] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, with a phosphorothioate modification in the phosphate backbone between adjacent nucleotides;

[0456] Preferably, the sequence of the CD40 aptamer is:

[0457] SEQ ID NO:156: GCCAACGAGTAGGCGATAGCGCGTGGC, with a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5' end;

[0458] Preferably, the sequence of the PD-L1 aptamer is:

[0459] SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, with phosphorothioate modification in the phosphate backbone between the first 5 adjacent nucleotides at the 5' end;

[0460] or

[0461] iv) CCPD3 Variant 3: The sequence of the DNA vector is:

[0462] a sequence: SEQ ID NO:295: GCCCACGAGCGTTCCGGGAGA;

[0463] b sequence: SEQ ID NO:49: TCTCCCGGTTCGCCGCGAG;

[0464] c sequence: SEQ ID NO:296: CTCGCGGCCATAGCCGTGGGC;

[0465] CpG2006 is linked to the 5' end of the a sequence through the spacer sequence TTTT, the CD40 aptamer is linked to the 5' end of the b sequence through the spacer sequence TTTT; the PD-L1 aptamer is linked to the 5' end of the c sequence through the spacer sequence TTTT,

[0466] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, with phosphorothioate modification in the phosphate backbone between adjacent nucleotides;

[0467] Preferably, the sequence of the CD40 aptamer is:

[0468] SEQ ID NO:156: GCCAACGAGTAGGCGATAGCGCGTGGC, with phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5' end;

[0469] Preferably, the sequence of the PD-L1 aptamer is:

[0470] SEQ ID NO:246: GGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCC, with phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5' end;

[0471] v) CCPD3 Variant 4:

[0472] The sequence of the DNA vector is:

[0473] a sequence: SEQ ID NO:295: GCCCACGAGCGTTCCGGGAGA;

[0474] b sequence: SEQ ID NO:49: TCTCCCGGTTCGCCGCGAG;

[0475] c sequence: SEQ ID NO:296: CTCGCGGCCATAGCCGTGGGC;

[0476] CpG2006 is linked to the 5'-end of the a sequence through the spacer sequence TTTT, the CD40 aptamer is linked to the 5'-end of the b sequence through the spacer sequence TTTT; the PD-L1 aptamer is linked to the 5'-end of the c sequence through the spacer sequence TTTT,

[0477] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a thiophosphate modification in the phosphate backbone between adjacent two nucleotides;

[0478] Preferably, the sequence of the CD40 aptamer is:

[0479] SEQ ID NO:156: GCCAACGAGTAGGCGATAGCGCGTGGC, and there is a thiophosphate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end;

[0480] Preferably, the sequence of the PD-L1 aptamer is:

[0481] SEQ ID NO:248: TACAGGTTCTGGGGGGTGGGTGGGGAACCTGTT, and there is a thiophosphate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end;

[0482] vi) CCPD3 variant 5:

[0483] The sequence of the DNA vector is:

[0484] a sequence: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC;

[0485] b sequence: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG;

[0486] c sequence: SEQ ID NO:20: CAGCAGCAGCAGCA CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC, wherein, SEQ ID NO:12: CAGCAGCAGCAGCA is a single-stranded linker sequence;

[0487] CpG2006 is linked to the 5'-end of sequence a through the spacer sequence TTTT, the CD40 aptamer is linked to the 5'-end of sequence b through the spacer sequence TTTTT, the PD-L1 aptamer is linked to the 3'-end of the complementary sequence of the single-stranded linker sequence through the spacer sequence TTTTT, and is linked to the 5'-end of sequence c through the complementary pairing of the single-stranded linker sequence and its complementary sequence;

[0488] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a thiophosphate modification in the phosphate backbone between adjacent nucleotides;

[0489] Preferably, the sequence of the CD40 aptamer is:

[0490] SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a thiophosphate modification in the phosphate backbone between the first 5 adjacent nucleotides at the 5'-end;

[0491] Preferably, the sequence of the complementary sequence of the single-stranded linker sequence - PD-L1 aptamer is: SEQ ID NO:297: TGCTGCTGCTGCTG TTTTT ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a thiophosphate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 3'-end, wherein, SEQ ID NO:11: TGCTGCTGCTGCTG is The complementary sequence of the single-stranded linker sequence;

[0492] vii) CCPD3 variant 6:

[0493] The sequence of the DNA vector is:

[0494] Sequence a: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC;

[0495] Sequence b: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG;

[0496] Sequence c: SEQ ID NO:20: CAGCAGCAGCAGCA CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC, wherein, SEQ ID NO:12: CAGCAGCAGCAGCA is the single-stranded linker sequence;

[0497] CpG2006 is linked to the 5'-end of sequence a through the spacer sequence TTTT, the CD40 aptamer is linked to the 5'-end of sequence b through the spacer sequence TTTTT, the PD-L1 aptamer is linked to the 3'-end of the complementary sequence of the single-stranded linker sequence through the spacer sequence TTTTT, and is linked to the 5'-end of sequence c through the complementary pairing of the single-stranded linker sequence and its complementary sequence;

[0498] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a thiophosphate modification in the phosphate backbone between adjacent two nucleotides;

[0499] Preferably, the sequence of the CD40 aptamer is:

[0500] SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a thiophosphate modification in the phosphate backbone between the first 5 adjacent nucleotides at the 5'-end;

[0501] Preferably, the sequence of the complementary sequence of the single-stranded linker sequence -TTTTT-PD-L1 aptamer is:

[0502] SEQ ID NO:298:TGCTGCTGCTGCTG TTTTTTACAGGTTCTGGGGGGTGGGTGGGGAACCTGTT, and there is a thiophosphate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 3'-end, wherein, SEQ ID NO:11: TGCTGCTGCTGCTG is the complementary sequence of the single-stranded linker sequence;

[0503] viii) CCPD3 variant 7:

[0504] The sequence of the DNA vector is:

[0505] Sequence a: SEQ ID NO:15: GACGCCCACGAGCGTTCCGGGAGAGGTGTAGCACGGTGGC, wherein, SEQID NO:7: TGTAGCACGGTGGC is the single-stranded linker sequence A;

[0506] Sequence b: SEQ ID NO:16: CCTCTCCCGGTTCGCCGCGAGCCTCGGCGCGGCCGTG, wherein, SEQ IDNO:9: TCGGCGCGGCCGTG is the single-stranded linker sequence B;

[0507] c sequence: SEQ ID NO:17: GGCTCGCGGCCATAGCCGTGGGCGTCTGCTGCTGCTGCTG, wherein, SEQ ID NO:11: TGCTGCTGCTGCTG is the single-stranded linker sequence C;

[0508] CpG2006 is connected to the 5'-end of the complementary sequence C' of the single-stranded linker C sequence through a transition sequence, and CpG2006 is connected to the 3'-end of the c sequence through complementary base pairing between the complementary sequence C' and the single-stranded linker C sequence;

[0509] The PD-L1 aptamer is sequentially connected to the transition sequence and the complementary sequence B' of the single-stranded linker sequence B, and the PD-L1 aptamer is connected to the 3'-end of the b sequence through complementary base pairing between the complementary sequence B' and the single-stranded linker sequence B;

[0510] The CD40 aptamer is sequentially connected to the transition sequence and the complementary sequence A' of the single-stranded linker sequence A, and the CD40 aptamer is connected to the 3'-end of the a sequence through complementary base pairing between the complementary sequence A' and the single-stranded linker sequence A;

[0511] Preferably, the sequence of CpG2006 is: SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a thiophosphate modification in the phosphate backbone between adjacent nucleotides;

[0512] Preferably, the sequence of the CD40 aptamer is: SEQ ID NO:156: GCCAACGAGTAGGCGATAGCGCGTGGC, and there is a thiophosphate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end;

[0513] Preferably, the sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a thiophosphate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end;

[0514] Preferably, the transition sequence is TTTTT.

[0515] iv) CCPD3 - variant 8

[0516] The a sequence is: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC;

[0517] The b sequence is: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG;

[0518] The c sequence is: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC;

[0519] CpG2006 is linked to the 5'-end of the a sequence through a spacer sequence, the CD40 aptamer is linked to the 5'-end of the b sequence through a spacer sequence, and the PD-L1 aptamer is linked to the 5'-end of the c sequence through the indicated spacer sequence.

[0520] Preferably, the sequence of CpG2006 is: SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, with a phosphorothioate modification in the phosphate backbone between adjacent nucleotides.

[0521] Preferably, the sequence of the CD40 aptamer is: SEQ ID NO:156: GCCAACGAGTAGGCGATAGCGCGTGGC, with a 2'-O-MOE modification on the ribose of the first 4 nucleotides at the 5'-end and a 5-methyl modification on the base of the nucleotide corresponding to Cm.

[0522] Preferably, the sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, with a 2'-O-MOE modification on the ribose of the first 4 nucleotides at the 5'-end and a 5-methyl modification on the base of the nucleotide corresponding to Cm.

[0523] Preferably, the spacer sequence is TTTTT.

[0524] v) CCPD3-variant 9

[0525] The a sequence is: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC;

[0526] The b sequence is: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG;

[0527] The c sequence is: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC;

[0528] CpG2006 is linked to the 5'-end of the a sequence through a spacer sequence, the CD40 aptamer is linked to the 5'-end of the b sequence through a spacer sequence, and the PD-L1 aptamer is linked to the 5'-end of the c sequence through the indicated spacer sequence.

[0529] Preferably, the sequence of CpG2006 is: SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, with phosphorothioate modification in the phosphate backbone between adjacent nucleotides;

[0530] Preferably, the sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, with 2'-O-MOE modification on the ribose of the first 5 nucleotides at the 5' end, and 5-methyl modification on the bases of the nucleotides corresponding to 3 Cm;

[0531] Preferably, the sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, with 2'-O-MOE modification on the ribose of the first 5 nucleotides at the 5' end, and 5-methyl modification on the bases of the nucleotides corresponding to 1 Cm;

[0532] Preferably, the transition sequence is TTTTT.

[0533] vi) CCPD3-variant 10,

[0534] The a sequence is: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC;

[0535] The b sequence is: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG;

[0536] The c sequence is: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC;

[0537] CpG2006 is linked to the 5' end of the a sequence through the transition sequence, the CD40 aptamer is linked to the 5' end of the b sequence through the transition sequence, and the PD-L1 aptamer is linked to the 5' end of the c sequence through the indicated transition sequence,

[0538] Preferably, the sequence of CpG2006 is: SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, with phosphorothioate modification in the phosphate backbone between adjacent nucleotides;

[0539] Preferably, the sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, with 2'-O-MOE modification on the ribose of the first 5 nucleotides at the 5' end, and 5-methyl modification on the bases of the nucleotides corresponding to 3 Cm;

[0540] Preferably, the sequence of the PD-L1 aptamer is: SEQ ID NO:249: CTACGAGACGAACTTATGCGTAATAATGACTGTCGTAG, with a 2'-O-MOE modification on the ribose of the first 5 nucleotides at the 5' end and a 5-methyl modification on the base of the nucleotide corresponding to 1 Cm;

[0541] Preferably, the transition sequence is TTTTT.

[0542] vii) CCPD3-variant 11,

[0543] The sequence of a is: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC;

[0544] The sequence of b is: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG;

[0545] The sequence of c is: SEQ ID NO:299: CGCGGCTCGCGGCT CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC, with the underlined part being the linker sequence;

[0546] CpG2006 is connected to the 5' end of the a sequence through the transition sequence, the CD40 aptamer is connected to the 5' end of the b sequence through the transition sequence, the PD-L1 aptamer is connected to the 3' end of the complementary sequence (SEQ ID NO:14: AGCCGCGAGCCGCG) of the above linker sequence, and is connected to the 5' end of the c sequence through complementary base pairing with the complementary sequence of the linker sequence,

[0547] Preferably, the sequence of CpG2006 is: SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, with a phosphorothioate modification on the phosphate backbone between adjacent nucleotides;

[0548] Preferably, the sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, with a 2'-O-MOE modification on the ribose of the first 5 nucleotides at the 5' end;

[0549] Preferably, the sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, with a 2'-O-MOE modification on the ribose of the first 1-5 nucleotides at the 3' end;

[0550] Preferably, the transition sequence is TTTTT.

[0551] viii) CCPD3 - Variant 12,

[0552] The a sequence is: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC;

[0553] The b sequence is: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG;

[0554] The c sequence is: SEQ ID NO:299: CGCGGCTCGCGGCT CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC, with the underlined part being the linker sequence;

[0555] CpG2006 is connected to the 5'-end of the a sequence through the transition sequence, the CD40 aptamer is connected to the 5'-end of the b sequence through the transition sequence, the PD-L1 aptamer is connected to the 3'-end of the complementary sequence of the above linker sequence (SEQ ID NO:14: AGCCGCGAGCCGCG) through the transition sequence, and is connected to the 5'-end of the c sequence by complementary base pairing with the complementary sequence of the linker sequence.

[0556] Preferably, the sequence of CpG2006 is: SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, with a phosphorothioate modification in the phosphate backbone between adjacent nucleotides;

[0557] Preferably, the sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, with a 2'-O-MOE modification on the ribose of the first 5 nucleotides at the 5'-end;

[0558] Preferably, the sequence of the PD-L1 aptamer is: SEQ ID NO:249: CTACGAGACGAACTTATGCGTAATAATGACTGTCGTAG, with a 2'-O-MOE modification on the ribose of the first 1 - 5 nucleotides at the 3'-end;

[0559] Preferably, the transition sequence is TTTTT.

[0560] Drug 12): CD16a aptamer - CTLA4 aptamer - CpG2006 - DNA vector, wherein the DNA vector is the 4th group among the aforementioned 26 nucleic acid vectors with backbone sequences. The CD16a aptamer is connected to the 5' end of the a sequence through a transition sequence, and the CTLA-4 aptamer is connected to the 5' end of the b sequence through a transition sequence; CpG2006 is connected to the 5' end of the c sequence through a transition sequence. In the DNA vector, the phosphate backbone between the first 2 nucleotides at the 3' ends of the a sequence, b sequence, and c sequence has a thiophosphate modification;

[0561] Preferably, the sequence of the CD16a aptamer is:

[0562] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and the phosphate backbone between the first 2 nucleotides at the 5' end has a thiophosphate modification;

[0563] Preferably, the sequence of the CTLA-4 aptamer is:

[0564] SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, the phosphate backbone between the first 2 nucleotides at the 5' end has a thiophosphate modification, and C and U are 2'-F modified, while A and G are 2'-OME modified;

[0565] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and the phosphate backbone between adjacent nucleotides has a thiophosphate modification;

[0566] Preferably, the transition sequence is TTTTT.

[0567] Drug 13): 2 * CpG2006 - CD40 aptamer - PD-L1 aptamer - C12 aptamer - DNA vector, wherein the DNA vector is the 5th group among the aforementioned 26 nucleic acid vectors with backbone sequences. Two CpG2006 are respectively connected to the 5' ends of the a sequence and c sequence through transition sequences, and the CD40 aptamer is located at the 5' end of the b sequence. In the DNA vector, the phosphate backbone between the first 2 nucleotides at the 3' ends of the a sequence, b sequence, and c sequence has a thiophosphate modification;

[0568] The PD-L1 aptamer is successively connected to the complementary sequence B' of the transition sequence and the single-stranded linker sequence B. The single-stranded linker sequence B is located at the 3' end of the b sequence, and the PD-L1 aptamer is connected to the 3' end of the b sequence through complementary base pairing with the complementary sequence B' of the single-stranded linker sequence B.

[0569] The C12 aptamer is sequentially linked to the transition sequence and the complementary sequence C' of the single-stranded linker sequence C. The single-stranded linker sequence C is located at the 3' end of the c sequence. The C12 aptamer is linked to the 3' end of the c sequence through complementary base pairing with the complementary sequence C'.

[0570] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a thiophosphate modification in the phosphate backbone between adjacent two nucleotides.

[0571] Preferably, the transition sequence is TTTTT.

[0572] Preferably, the sequence of the CD40 aptamer is:

[0573] SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a thiophosphate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5' end.

[0574] Preferably, the sequence of the PD-L1 aptamer is:

[0575] SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a thiophosphate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5' end.

[0576] Preferably, the sequence of the C12 aptamer is:

[0577] SEQ ID NO:164: GTGGATTGTTGTGTTCTGTTGGTTTTTGTGTTGTC, and there is a thiophosphate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5' end.

[0578] Preferably, the single-stranded linker sequence B is: SEQ ID NO:7: TGTAGCACGGTGGC, and the complementary sequence B' is SEQ ID NO:8: GCCACCGTGCTACA.

[0579] Preferably, the single-stranded linker sequence C is: SEQ ID NO:11: TGCTGCTGCTGCTG, and the complementary sequence C' is SEQ ID NO:12: CAGCAGCAGCAGCA.

[0580] Drug 14): CpG2006-C12 aptamer-CD47 siRNA-PD-L1 aptamer-PD-L1 siRNA-DNA vector, wherein the DNA vector is the 6th group of the nucleic acid vectors of the aforementioned 26 backbone sequences. CpG2006 is connected to the 5' end of the a sequence through a transition sequence. The C12 aptamer is connected to the antisense strand of CD47 siRNA through a transition sequence. The sense strand of CD47 siRNA is located at the 5' end of the b sequence. The antisense strand of CD47 siRNA connects the C12 aptamer and CD47 siRNA to the 5' end of the b sequence by complementary pairing with the sense strand of CD47 siRNA. The sense strand of PD-L1 siRNA is connected to the 5' end of the c sequence. The PD-L1 aptamer is connected to the antisense strand of PD-L1 siRNA through a transition sequence. Among them, in the DNA vector, there is a phosphorothioate modification in the phosphate backbone among the first 3 nucleotides at the 3' ends of the a sequence, the b sequence, and the c sequence;

[0581] Preferably, the sequence of the C12 aptamer is:

[0582] SEQ ID NO:164: GTGGATTGTTGTGTTCTGTTGGTTTTTGTGTTGTC, and there is a phosphorothioate modification in the phosphate backbone among the first 3 adjacent nucleotides at the 5' end;

[0583] Preferably, the antisense strand of CD47 siRNA is: SEQ ID NO:79: AUAUCUCUGGGUAAUCACCUU, and the sense strand is: SEQ ID NO:78: GGUGAUUACCCAGAGAUAUUU. There is a phosphorothioate modification in the phosphate backbone among the first 3 adjacent nucleotides at the 5' end of the antisense strand of CD47 siRNA, there is a phosphorothioate modification in the phosphate backbone among the first 3 adjacent nucleotides at the 5' end of the sense strand of CD47 siRNA, and there is a phosphorothioate modification in the phosphate backbone among the first 3 adjacent nucleotides at the 3' end;

[0584] Preferably, the sequence of the PD-L1 aptamer is:

[0585] SEQ ID NO:239: GCCCCAGTTATGCTTTCCCCCTCTGTCTCTTTG, and there is a phosphorothioate modification in the phosphate backbone among the first 3 adjacent nucleotides at the 5' end;

[0586] Preferably, the sense strand of the PD-L1 siRNA is: SEQ ID NO:94: CCAGCACACUGAGAAUCAAUU, and the antisense strand is: SEQ ID NO:95: UUGAUUCUCAGUGUGCUGGUU. There is a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5' end of the sense strand of the PD-L1 siRNA, and there is a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 3' end; there is a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5' end of the antisense strand of the PD-L1 siRNA.

[0587] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent two nucleotides.

[0588] Preferably, the transition sequence is TTTTT.

[0589] Drug 15): 2*CpG2006-CD40 aptamer-CD16a aptamer-DNA vector, wherein the DNA vector is the 7th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The 2 CpG2006 are respectively connected to the 5' ends of the a sequence and the c sequence through the transition sequence. The CD40 aptamer is connected to the 5' end of the b sequence through the transition sequence. The CD16a aptamer is connected to the 3' end of the b sequence through the transition sequence. There is a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 3' ends of the a sequence and the c sequence of the DNA vector.

[0590] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent two nucleotides.

[0591] Preferably, the transition sequence is TTTTT;

[0592] Preferably, the sequence of the CD16a aptamer is:

[0593] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 3' end.

[0594] Preferably, the sequence of the CD40 aptamer is:

[0595] SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a phosphorothioate modification in the phosphate backbone between the last 2 nucleotides at the 5' end.

[0596] Drug 16): 2*CpG2006 - CD40 aptamer - CD16a aptamer - FAP aptamer - DNA vector, wherein the DNA vector is the 8th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. Two CpG2006 are respectively connected to the 5' ends of the a sequence and the c sequence through a spacer sequence. The CD40 aptamer is connected to the 5' end of the b sequence through a spacer sequence. The CD16a aptamer is connected to the 3' end of the b sequence through a spacer sequence. The FAP aptamer is connected to the 3' end of the c sequence through a spacer sequence. Among them, there is a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 3' end of the a sequence of the DNA vector;

[0597] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent two nucleotides;

[0598] Preferably, the spacer sequence is TTTTT;

[0599] Preferably, the sequence of the CD16a aptamer is:

[0600] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 3' end;

[0601] Preferably, the sequence of the CD40 aptamer is:

[0602] SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a phosphorothioate modification in the phosphate backbone between the last 2 nucleotides at the 5' end;

[0603] Preferably, the sequence of the FAP aptamer is:

[0604] SEQ ID NO:188: CCGCTCGAGCTAGTCTGACAAAGAGAAACAC, and there is a phosphorothioate modification in the phosphate backbone between the last 2 nucleotides at the 3' end.

[0605] Drug 17): 2 * CpG2006 - VEGF aptamer - CD40 aptamer - PD - L1 aptamer - CD16a aptamer - DNA vector, wherein the DNA vector is the 6)th group of the nucleic acid vectors with the aforementioned 26 backbone sequences, 2 CpG2006 are respectively connected to the 5' ends of the a sequence and the c sequence through a linker sequence, the CD40 aptamer is connected to the 5' end of the b sequence through a linker sequence, the PD - L1 aptamer is connected to the 3' end of the b sequence through a linker sequence, the CD16a aptamer is connected to the 3' end of the c sequence through a linker sequence, and the VEGF aptamer is connected to the 3' end of the a sequence through a linker sequence.

[0606] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a thiophosphate modification in the phosphodiester backbone between adjacent two nucleotides.

[0607] Preferably, the VEGF aptamer:

[0608] SEQ ID NO:279: GGTGGGGGTGGACGGGCCGGGTAGA, and there is a thiophosphate modification in the phosphodiester backbone between the last two nucleotides at the 3' end.

[0609] Preferably, the sequence of the CD40 aptamer is:

[0610] SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a thiophosphate modification in the phosphodiester backbone between the first two nucleotides at the 5' end.

[0611] Preferably, the sequence of the PD - L1 aptamer is:

[0612] SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a thiophosphate modification in the phosphodiester backbone between the last two nucleotides at the 3' end.

[0613] Preferably, the sequence of the CD16a aptamer is:

[0614] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is a thiophosphate modification in the phosphodiester backbone between the last two nucleotides at the 3' end.

[0615] Drug 18): 2*AmiR21-TTA1 aptamer-DNA vector, wherein the DNA vector is the 13th group among the aforementioned 26 nucleic acid vectors with backbone sequences, and the two AmiR21 are directly connected to the 5' ends of the a sequence and the c sequence respectively, and the TTA1 aptamer is connected to the 5' end of the b sequence through a linker sequence.

[0616] Preferably, the linker sequence is TTTTT;

[0617] Preferably, the sequence of AmiR21 is GATAAGCT, and each nucleotide has a locked nucleic acid modification;

[0618] Preferably, the sequence of the TTA1 aptamer is:

[0619] SEQ ID NO:266: CTGCACTTGGCTTGGATTTCAGAAGGGAGACCC.

[0620] Drug 19): 2*AmiR-21-3*biotin-DNA vector, wherein the DNA vector is the 13th group among the aforementioned 26 nucleic acid vectors with backbone sequences, and the two AmiR21 are directly connected to the 5' ends of the a sequence and the c sequence respectively, and the three biotins are connected to the 5' end, the 3' end of the b sequence and the 3' end of the c sequence respectively.

[0621] Preferably, the sequence of AmiR-21 is GATAAGCT, and each position has a locked nucleic acid modification.

[0622] Drug 20): 2*AmiR-21-4*biotin-DNA vector, wherein the DNA vector is the 13th group among the aforementioned 26 nucleic acid vectors with backbone sequences, and the two AmiR21 are directly connected to the 5' ends of the a sequence and the c sequence respectively, and the four biotins are connected to the 3' end of the a sequence, the 5' end, the 3' end of the b sequence and the 3' end of the c sequence respectively.

[0623] Preferably, the sequence of AmiR-21 is GATAAGCT, and each position has a locked nucleic acid modification.

[0624] Drug 21): 2*AmiR-21-AS1411 aptamer-DNA vector, wherein the DNA vector is the 13th group among the aforementioned 26 nucleic acid vectors with backbone sequences, and the two AmiR21 are directly connected to the 5' ends of the a sequence and the c sequence respectively, and the AS1411 aptamer is connected to the 5' end of the b sequence through a linker sequence.

[0625] Preferably, the linker sequence is TTTTT;

[0626] Preferably, the sequence of AmiR-21 is GATAAGCT, and each position has a locked nucleic acid modification;

[0627] Preferably, the sequence of the AS1411 aptamer is as follows:

[0628] SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG.

[0629] Drug 22): 2*AmiR-21-AS1411 aptamer-DNA vector, wherein the DNA vector is the 23)rd group of the nucleic acid vectors with the aforementioned 26 backbone sequences, two AmiR-21 are directly connected to the 5'-ends of the a sequence and the c sequence respectively, and the AS1411 aptamer is connected to the 5'-end of the b sequence through a linker sequence.

[0630] Preferably, the linker sequence is TTTTT;

[0631] Preferably, the sequence of AmiR-21 is GATAAGCT, wherein the 1st, 3rd-5th positions have 2'-OME modification, and the 2nd, 6th-8th positions have 2'-F modification;

[0632] Preferably, the sequence of the AS1411 aptamer is as follows:

[0633] SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG.

[0634] Drug 23): 2*AmiR-21-AS1411 aptamer-biotin-DNA vector, wherein the DNA vector is the 13)rd group of the nucleic acid vectors with the aforementioned 26 backbone sequences, two AmiR-21 are directly connected to the 5'-ends of the a sequence and the c sequence respectively, the AS1411 aptamer is connected to the 5'-end of the b sequence through a linker sequence, and biotin is connected to the 3'-end of the c sequence;

[0635] Preferably, the linker sequence is TTTTT;

[0636] Preferably, the sequence of AmiR-21 is GATAAGCT, wherein each position has locked nucleic acid modification;

[0637] Preferably, the sequence of the AS1411 aptamer is as follows:

[0638] SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG.

[0639] Drug 24): 2*AmiR-21-CD40 aptamer-DNA vector, wherein the DNA vector is the 13)rd group of the nucleic acid vectors with the aforementioned 26 backbone sequences, two AmiR-21 are directly connected to the 5'-ends of the a sequence and the c sequence respectively, and the CD40 aptamer is connected to the 5'-end of the b sequence through a linker sequence.

[0640] Preferably, the transition sequence is TTTTT;

[0641] Preferably, the sequence of AmiR-21 is GATAAGCT, where each position is locked nucleic acid modified;

[0642] Preferably, the sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG.

[0643] Drug 25): 2*AmiR-21-MUC1 aptamer-3*biotin-DNA vector, wherein the DNA vector is the 13)th group of the nucleic acid vectors with the aforementioned 26 backbone sequences, and the 2 AmiR21 are directly connected to the 5' ends of the a sequence and the c sequence respectively, and the MUC1 aptamer is connected to the 5' end of the b sequence through a transition sequence;

[0644] Preferably, the transition sequence is TTTTT;

[0645] Preferably, the sequence of AmiR-21 is GATAAGCT, where each position is locked nucleic acid modified;

[0646] Preferably, the sequence of the MUC 1 aptamer is: SEQ ID NO:208: GCAGTTGATCCTTTGGATACCCTGG.

[0647] Drug 26): AmiR-21-AS1411 aptamer-A15 aptamer-2*biotin-DNA vector, wherein the DNA vector is the 13)th group of the nucleic acid vectors with the aforementioned 26 backbone sequences, AmiR21 is directly connected to the 5' end of the a sequence, the AS1411 aptamer and the A15 aptamer are each connected to the 5' ends of the b sequence and the c sequence respectively through a transition sequence, and the 2 biotins are connected to the 3' end of the b sequence and the 3' end of the c sequence respectively;

[0648] Preferably, the transition sequence is TTTTT;

[0649] Preferably, the sequence of AmiR-21 is GATAAGCT, where each position is locked nucleic acid modified;

[0650] Preferably, the sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG;

[0651] Preferably, the sequence of the A15 aptamer is: SEQ ID NO:129: CCCTCCTACATAGGG.

[0652] Drug 27): 2*mannose-2*AmiR-21-DNA vector, wherein the DNA vector is the 13th group of the nucleic acid vectors with the aforementioned 26 backbone sequences, and the two mannoses are respectively linked to the 5'-end and 3'-end of the b sequence, and the two AmiR-21s are directly linked to the 5'-ends of the a sequence and the c sequence respectively;

[0653] Preferably, the sequence of AmiR-21 is GATAAGCT, and each position thereof is a locked nucleic acid modification.

[0654] Drug 28): 2*mannose-A15 aptamer-2*AmiR-21-DNA vector, wherein the DNA vector is the 13th group of the nucleic acid vectors with the aforementioned 26 backbone sequences, the A15 aptamer is linked to the 5'-end of the b sequence through a spacer sequence, the two mannoses are respectively linked to the 5'-end of the A15 aptamer and the 3'-end of the b sequence, and the two AmiR-21s are directly linked to the 5'-ends of the a sequence and the c sequence respectively;

[0655] Preferably, the sequence of AmiR-21 is GATAAGCT, and each position thereof is a locked nucleic acid modification;

[0656] Preferably, the sequence of the A15 aptamer is: SEQ ID NO:129: CCCTCCTACATAGGG.

[0657] Drug 29): 2*mannose-survivin siRNA-DNA vector, wherein the DNA vector is the 13th group of the nucleic acid vectors with the aforementioned 26 backbone sequences, the two mannoses are respectively linked to the 5'-end and 3'-end of the b sequence, the sense strand of survivin siRNA is linked to the 3'-end of the c sequence, and the antisense strand of survivin siRNA is linked to the 3'-end of the c strand by complementary pairing with the sense strand of survivin siRNA;

[0658] Preferably, the sense strand of survivin siRNA is: SEQ ID NO:104: UGCAGGUUCCUUAUCUGUCATT,

[0659] the antisense strand of survivin siRNA is: SEQ ID NO:105: UGACAGAUAAGGAACCUGCTT, and the 3'-terminal TT of the sense strand and antisense strand of survivinsiRNA are both dTdT modifications.

[0660] Drug 30): 2*mannose-A15 aptamer-survivin siRNA-DNA vector, wherein the DNA vector is the 22nd group among the nucleic acid vectors of the aforementioned 26 backbone sequences, the A15 aptamer is connected to the 5' end of the b sequence through the linker sequence TTTTT, two mannoses are respectively connected to the 5' end of the A15 aptamer and the 3' end of the b sequence, the sense strand of survivin siRNA is connected to the 3' end of the c strand, and the antisense strand of survivin siRNA is connected to the 3' end of the c strand by complementary base pairing with the sense strand of survivin siRNA;

[0661] Preferably, the sense strand of survivin siRNA is: SEQ ID NO:104: UGCAGGUUCCUUAUCUGUCATT;

[0662] The antisense strand of survivin siRNA is: SEQ ID NO:105: UGACAGAUAAGGAACCUGCdTT; the TT at the 3' ends of the antisense strand and sense strand of survivin siRNA are both dTdT modifications;

[0663] Preferably, the sequence of the A15 aptamer is: SEQ ID NO:129: CCCTCCTACATAGGG.

[0664] Drug 31): AS1411 aptamer-survivin siRNA-PSMA aptamer-3*AmiR-21-RNA vector, wherein the DNA vector is the 16th group among the nucleic acid vectors of the aforementioned 26 backbone sequences, the PSMA aptamer is connected to the 3' end of the a sequence through the linker sequence AA, three AmiR-21 are connected in series to the 3' end of the b sequence through the linker sequence AA, the sense strand of survivin siRNA is connected to the 3' end of the c sequence through the linker sequence AAA, the AS1411 aptamer and the antisense strand of survivin siRNA are connected through the linker sequence TT and are connected to the 3' end of the c sequence by complementary base pairing between the antisense strand and sense strand of survivin siRNA, wherein the first 2 nucleotides at the 5' ends of the a sequence, b sequence and c sequence of the DNA vector independently have phosphorothioate modifications;

[0665] Preferably, the sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG;

[0666] Preferably, the sense strand of survivin siRNA is: SEQ ID NO:100: GCAGGUUCCUUAUCUGUCACAUU, and the antisense strand of survivin siRNA is: SEQ ID NO:300: UGUGACAGAUAAGGAACCUGCAG. The sense strand and antisense strand of survivin siRNA both have thiophosphate modifications between the first 3 positions at the 5' end and the last 3 positions at the 3' end;

[0667] Preferably, the sequence of the PSMA aptamer is:

[0668] SEQ ID NO:234: GGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUCCC. There is a thiophosphate modification in the phosphodiester backbone between the last 2 nucleotides at the 3' end;

[0669] Preferably, the sequence of AmiR-21 is: GAUAAGCU. There is a thiophosphate modification in the phosphodiester backbone between adjacent nucleotides.

[0670] Drug 32): 3*AmiR-21-ATP aptamer-FGF2 aptamer-DNA vector. Among them, the DNA vector is the 15th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. 3 AmiR-21s are directly concatenated and connected to the 5' end of the a sequence. The ATP aptamer is connected to the 5' end of the b sequence through the transition sequence TTTTT. The FGF2 aptamer is connected to the 5' end of the c sequence through U. Among them, there are thiophosphate modifications independently between the first 2 nucleotides at the 3' end of the a sequence, b sequence, and c sequence of the DNA vector;

[0671] Preferably, the sequence of the ATP aptamer is: SEQ ID NO:135: ACCTGGGGAGTATTGGGGAGGAAGG. There is a thiophosphate modification in the phosphodiester backbone between the first 2 nucleotides at the 5' end;

[0672] Preferably, the sequence of the FGF2 aptamer is:

[0673] SEQ ID NO:183: GGGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCCC. There is a thiophosphate modification in the phosphodiester backbone between the first 2 nucleotides at the 5' end;

[0674] Preferably, the sequence of AmiR-21 is: GATAAGCT. There is a thiophosphate modification in the phosphodiester backbone between adjacent nucleotides.

[0675] Drug 33): AS1411 aptamer - Survivin siRNA - PSMA aptamer - 3 * AmiR - 21 - DNA / RNA hybrid vector, wherein the DNA - RNA hybrid vector is the 18th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The PSMA aptamer is connected to the 3' end of the a sequence through the linker sequence AA. Three tandem AmiR - 21 are connected to the 3' end of the b sequence through the linker sequence AA. The sense strand of Survivin siRNA is connected to the 3' end of the c sequence through the linker sequence AAAA. The AS1411 aptamer is connected to the 5' end of the antisense strand of Survivin siRNA through the linker sequence AA. The antisense strand of Survivin siRNA is complementary base - paired with the sense strand of Survivin siRNA. Among them, there is a thiophosphate modification independently between the first 2 nucleotides at the 5' end of the b sequence and the c sequence of the DNA vector.

[0676] Preferably, the sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5' end.

[0677] Preferably, the antisense strand of Survivin siRNA is: SEQ ID NO:300: UGUGACAGAUAAGGAACCUGCAG; the sense strand is: SEQ ID NO:100: GCAGGUUCCUUAUCUGUCACAUU; there are thiophosphate modifications in the phosphate backbone between the first 3 adjacent nucleotides at the 5' end and between the last 3 adjacent nucleotides at the 3' end of both the sense strand and the antisense strand of Survivin siRNA.

[0678] Preferably, the sequence of the PSMA aptamer is:

[0679] SEQ ID NO:234: GGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUCCC, C and U have 2'-F modification, A and G have 2'-OME modification, and there is a thiophosphate modification on the phosphate backbone between the first 2 nucleotides at the 3' end.

[0680] Preferably, the sequence of AmiR - 21 is: GAUAAGCU, and there is a thiophosphate modification in the phosphate backbone between adjacent nucleotides.

[0681] Drug 34): 3*AmiR-21-AS1411 aptamer-FAP aptamer-DNA vector, wherein the RNA vector is the 15th group among the nucleic acid vectors of the aforementioned 26 backbone sequences, 3 AmiR-21 are concatenated and connected to the 5' end of the a sequence through the spacer sequence TTTTTT, the AS1411 aptamer is connected to the 5' end of the b sequence through the spacer sequence TTTTT, and the FAP aptamer is connected to the 5' end of the c sequence through the spacer sequence TTTTT;

[0682] Preferably, the sequence of AmiR-21 is: GATAAGCT, and there is a thiophosphate modification in the phosphate backbone between adjacent nucleotides;

[0683] Preferably, the sequence of the AS1411 aptamer is:

[0684] SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5' end;

[0685] Preferably, the sequence of the FAP aptamer is:

[0686] SEQ ID NO:188: CCGCTCGAGCTAGTCTGACAAAGAGAAACAC, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5' end.

[0687] Drug 35): AS1411 aptamer-Survivin siRNA-EpCAM aptamer-3*AmiR-21-DNA vector, wherein the DNA vector is the 14th group among the nucleic acid vectors of the aforementioned 26 backbone sequences, the AS1411 aptamer is connected to the 5' end of the antisense strand of Survivin siRNA through the spacer sequence AA, the sense strand of Survivin siRNA is connected to the 3' end of the c sequence through the spacer sequence AAAA, and the antisense strand of Survivin siRNA is complementary paired and connected to the sense strand of Survivin siRNA; 3 AmiR-21 are concatenated and connected to the 3' end of the b sequence through the spacer sequence AA, and the EpCAM aptamer is connected to the 3' end of the a sequence through the spacer sequence AA, wherein, there is a thiophosphate modification independently between the first 2 nucleotides at the 5' end of the b sequence of the DNA vector;

[0688] Preferably, the sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5' end;

[0689] Preferably, the antisense strand of Survivin siRNA is: SEQ ID NO:300: UGUGACAGAUAAGGAACCUGCAG, the sense strand of Survivin siRNA is: SEQ ID NO:100: GCAGGUUCCUUAUCUGUCACAUU. There are thiophosphate modifications between the 3 adjacent nucleotides before the 5' end and between the 3 adjacent nucleotides at the end of the 3' end of the sense and antisense strands of Survivin siRNA. The 2nd, 6th, 8th, 9th, 12th, 14th, and 16th positions at the 5' end of the antisense strand of Survivin siRNA have 2'-F modification, and the rest have 2'-OMe modification. The 7th, 9th, 10th, and 11th positions of the sense strand of Survivin siRNA have 2'-F modification, and the rest have 2'-OMe modification;

[0690] Preferably, the sequence of AmiR-21 is: GATAAGCT, and there is thiophosphate modification in the phosphate backbone between adjacent nucleotides;

[0691] Preferably, the sequence of EpCAM aptamer is: SEQ ID NO:179: GCGACUGGUUACCCGGUCG, C and U have 2'-F modification, and A and G have 2'-OME modification;

[0692] There is thiophosphate modification in the phosphate backbone between the 3 adjacent nucleotides before the 5' end and between the 3 adjacent nucleotides at the end of the 3' end.

[0693] Drug 36): IL-4RA aptamer - TGF-β aptamer - PD-L1 aptamer - 2*AmiR-21 - DNA vector, wherein the DNA vector is the 15th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The IL-4RA aptamer is connected to the 5' end of the a sequence through 1 AmiR-21, the TGF-β aptamer is connected to the 5' end of the b sequence through the transition sequence TTTTT, and the PD-L1 aptamer is connected to the 5' end of the c sequence through 1 AmiR-21. Among them, there are thiophosphate modifications independently between the first 2 nucleotides at the 3' end of the a sequence, b sequence, and c sequence of the DNA vector;

[0694] Preferably, the sequence of the IL-4RA aptamer is:

[0695] SEQ ID NO:203: AAAAAGCAACAGGGUGCUCCAUGCGCAUGGAACCUGCGCG, and there is thiophosphate modification in the phosphate backbone between the 4 adjacent nucleotides before the 5' end;

[0696] Preferably, the sequence of the TGF-β aptamer is:

[0697] SEQ ID NO:269: ACATTGCTGCGTGATCGCCTCACATGGGTTTGTCTGGTCGATTTGGAGGTGGTGGGTGGC, with phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end;

[0698] Preferably, the sequence of the PD-L1 aptamer is:

[0699] SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, with phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end;

[0700] Preferably, the sequence of AmiR-21 is: GATAAGCT, with phosphorothioate modification in the phosphate backbone between adjacent nucleotides.

[0701] Drug 37): AS1411 aptamer - ATAD2 siRNA - GPC3 aptamer - 5*AimR-21 - DNA vector, wherein the DNA vector is the 19th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The AS1411 aptamer is linked to the 5'-end of the antisense strand of ATAD2 siRNA through 1 AimR-21. The sense strand of ATAD2 siRNA is linked to the 3'-end of the c sequence through 1 AimR-21. The antisense strand of ATAD2 siRNA is complementary paired and linked to the sense strand of ATAD2 siRNA. 1 AimR-21 is linked to the 3'-end of the a sequence. The GPC3 aptamer is linked to the 5'-end of the b sequence through 1 AimR-21. 1 AimR-21 is linked to the 5'-end of the c sequence. Among them, there are phosphorothioate modifications independently between the first 2 nucleotides at the 5'-end of the b sequence of the DNA vector.

[0702] Preferably, the sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, with phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end;

[0703] Preferably, the antisense strand of ATAD2 siRNA is: SEQ ID NO:68: GCGUCGAAGUUGUAGGAUUUU, and the sense strand is: SEQ ID NO:69: AAUCCUACAACUUCGACGCUU. There are phosphorothioate modifications between the first 3 adjacent nucleotides at the 5'-end and the last 3 adjacent nucleotides at the 3'-end of the sense strand and antisense strand of ATAD2 siRNA. The 2nd, 6th, 8th, 9th, 12th, 14th, and 16th positions from the 5'-end have 2'-F modification, and the rest are 2'-OME modification;

[0704] The sequence of the GPC3 aptamer is: SEQ ID NO:190: TAACGCTGACCTTAGCTGCATGGCTTTACATGTTCCA, and there is a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5'-end;

[0705] Preferably, the sequence of AmiR-21 is: GATAAGCT, and there is a phosphorothioate modification in the phosphate backbone between adjacent nucleotides.

[0706] Drug 38): Vap7 aptamer - TGF-β aptamer - Act-12c aptamer - 3*AmiR-21 - DNA vector, wherein the DNA vector is the 15th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The Vap7 aptamer is linked to the 5'-end of the a sequence through two tandem AmiR-21s. The TGF-β aptamer is linked to the 5'-end of the b sequence through the spacer sequence TTTTT. The Act-12c aptamer is linked to the 5'-end of the c sequence through 1 AmiR-21. Among them, there is an independent phosphorothioate modification between the first 2 nucleotides at the 3'-ends of the a sequence, b sequence, and c sequence of the DNA vector;

[0707] Preferably, the sequence of the Vap7 aptamer is: SEQ ID NO:277: TGGTGGGGGTGGACGGGCCGGGTAGA, and there is a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end;

[0708] Preferably, the sequence of AmiR-21 is: GATAAGCT, and there is a phosphorothioate modification in the phosphate backbone between adjacent nucleotides;

[0709] Preferably, the sequence of the TGF-β aptamer is:

[0710] SEQ ID NO:269: ACATTGCTGCGTGATCGCCTCACATGGGTTTGTCTGGTCGATTTGGAGGTGGTGGGTGGC, and there is a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end;

[0711] Preferably, the sequence of the Act-12c aptamer is:

[0712] SEQ ID NO:137: CGGGGAAAGTCACGGGGGGTTTCAGATGTTCTGATCGGTGTGGAG, and there is a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end.

[0713] Drug 39): AS1411 aptamer - 3 * AmiR - 21 - IL - 4RA aptamer - VCAM - 1 aptamer - DNA vector, wherein the DNA vector is the 15th group of the nucleic acid vectors of the aforementioned 26 backbone sequences. The AS1411 aptamer is sequentially connected to the 5' end of the a sequence through the transition sequence TTTTT and 3 tandem AmiRs. The IL - 4RA aptamer and the VCAM - 1 aptamer are respectively connected to the 5' end of the b sequence and the 5' end of the c sequence through the transition sequence TTTTT. Among them, the first 2 nucleotides at the 3' end of the a sequence, b sequence, and c sequence of the DNA vector independently have thiophosphate modifications;

[0714] Preferably, the sequence of the AS1411 aptamer is: SEQ ID NO:131: G*GTGGTGGTGGTTGTGGTGGTGGTGG, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5' end;

[0715] Preferably, the sequence of AmiR - 21 is: GATAAGCT, and there is a thiophosphate modification in the phosphate backbone between adjacent nucleotides;

[0716] Preferably, the sequence of the IL - 4RA aptamer is:

[0717] SEQ ID NO:203: AAAAAGCAACAGGGUGCUCCAUGCGCAUGGAACCUGCGCG, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5' end, and C or U has 2'-F modification, and A or G has 2'-OME modification;

[0718] Preferably, the sequence of the VCAM - 1 aptamer is:

[0719] SEQ ID NO:284: GGACACGGCAAAGGGGTATAGCCTACCGGACCGTGAACATGGAATGGTGTGCTGCGTGG, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5' end.

[0720] Drug 40): GPC1 aptamer-AS1411 aptamer-EpCAM aptamer-2*AmiR-21-DNA vector, wherein the DNA vector is the 14th group among the aforementioned 26 nucleic acid vectors with backbone sequences. The GPC1 aptamer is connected to the 5'-end of the a sequence through one AmiR-21. The AS1411 aptamer is connected to the 5'-end of the b sequence through the transition sequence TTTTT. The EpCAM aptamer is connected to the 5'-end of the c sequence through one AmiR-21. Among them, the first 3 nucleotides at the 3'-ends of the a sequence, b sequence, and c sequence of the DNA vector independently have thiophosphate modifications, and the first 2 nucleotides at the 3'-ends independently have 2'-O-MOE modifications;

[0721] Preferably, the sequence of the GPC1 aptamer is: SEQ ID NO:189: AACGGAGTGTGGCTAACTCGA, and there is a thiophosphate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end;

[0722] Preferably, the sequence of AmiR-21 is: GATAAGCT, and there is a thiophosphate modification in the phosphate backbone between adjacent nucleotides;

[0723] Preferably, the sequence of the AS1411 aptamer is:

[0724] SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, and there are thiophosphate modifications in the phosphate backbone between the 1st-2nd, 3rd-4th, 13th-14th, 16th-17th, and 24th-25th nucleotides counted from the 5'-end;

[0725] Preferably, the sequence of the EpCAM aptamer is: SEQ ID NO:179: GCGACUGGUUACCCGGUCG, and there is a thiophosphate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end, and C or U has 2'-F modification, and A or G has 2'-OME modification.

[0726] Drug 41): 3*AmiR-21-AS1411 aptamer-CD40 aptamer-2*biotin-DNA vector, wherein the DNA vector is the 1st group among the aforementioned 26 nucleic acid vectors with backbone sequences. The three AmiR-21 are respectively connected to the 5'-end, 3'-end of the a sequence, and the 3'-end of the b sequence. The AS1411 aptamer is connected to the 5'-end of the b sequence through the transition sequence TTTTT. The CD40 aptamer is connected to the 5'-end of the c sequence through the transition sequence TTTTT. One biotin is modified at the 3'-end of the AmiR-21 located at the 3'-end of the a sequence, and the other biotin is modified at the 3'-end of the c sequence;

[0727] Preferably, the sequence of AmiR-21 is: GATAAGCT, and each nucleotide has a locked nucleic acid modification;

[0728] Preferably, the sequence of the AS1411 aptamer is: SEQ ID NO:131:

[0729] GGTGGTGGTGGTTGTGGTGGTGGTGG;

[0730] Preferably, the sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG.

[0731] Drug 42): IL-4RA aptamer-VCAM-12D aptamer-PD-L1 aptamer-3*AmiR-21-DNA vector, wherein the DNA vector is the nucleic acid vector of the 3rd group among the aforementioned 26 backbone sequences. The IL-4RA aptamer is connected to the 5'-end of the a sequence through the first AmiR21, the VCAM-12d aptamer is connected to the 5'-end of the b sequence through the second AmiR21, and the PD-L1 aptamer is connected to the 5'-end of the c sequence through the third AmiR21. Among them, there is a thiophosphate modification independently between the first 2 nucleotides at the 3'-ends of the a sequence, b sequence, and c sequence of the DNA vector;

[0732] Preferably, the sequence of the IL-4RA aptamer is:

[0733] SEQ ID NO:203: AAAAAGCAACAGGGUGCUCCAUGCGCAUGGAACCUGCGCG, there is a thiophosphate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end, and C or U has a 2'-F modification, and A or G has a 2'-OME modification;

[0734] Preferably, the sequence of the VCAM-12d aptamer is:

[0735] SEQ ID NO:285: AGGGAATCTTGCCTAGGGAGGGAGTAGCGAAAGGGCTCA, there is a thiophosphate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end;

[0736] Preferably, the sequence of the PD-L1 aptamer is:

[0737] SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, there is a thiophosphate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end;

[0738] Preferably, the sequence of AmiR-21 is: GATAAGCT, and there is a phosphorothioate modification in the phosphate backbone between adjacent nucleotides.

[0739] Drug 43): TAPsiRNA-3*AmiR-21-2*AS1411 aptamer-DNA vector, wherein the DNA vector is the 6th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The sense strand of TAPsiRNA is connected to the 3' end of the c sequence through the transition sequence AAAA. One AS1411 aptamer is connected to the antisense strand of TAPsiRNA through the transition sequence AAAA, and the AS1411 aptamer is connected to the 3' end of the c sequence through the complementary pairing between the antisense strand and the sense strand. Another AS1411 aptamer is connected to the 3' end of the a sequence through the transition sequence AAAA. Three AmiR-21 are connected in series to the 3' end of the b sequence through the transition sequence AA. There is a phosphorothioate modification independently between the first 2 nucleotides at the 5' end of the a sequence, b sequence and c sequence of the DNA vector.

[0740] Preferably, the sense strand sequence of TAPsiRNA is: SEQ ID NO:301: GCUGCACACGGUUCAGAAU, and the antisense strand sequence is: SEQ ID NO:109: AUUCUGAACCGUGUGCAGCUU. There is a phosphorothioate modification between the first 3 bases at the 5' end and the last 3 bases at the 3' end of the sense strand and antisense strand of TAPsiRNA. The 2nd, 6th, 8th, 9th, 12th, 14th, and 16th positions at the 5' end of the antisense strand of TAPsiRNA are 2'-F modified, and the rest are 2'-OME modified. The 7th, 9th, 10th, and 11th positions at the 5' end of the sense strand of TAPsiRNA are 2'-F modified, and the rest are 2'-OME modified.

[0741] Preferably, the sequence of AmiR-21 is: GATAAGCT, and there is a phosphorothioate modification in the phosphate backbone between adjacent nucleotides.

[0742] Preferably, the sequence of AS1411-1 is:

[0743] SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, and there is a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 5' end.

[0744] Drug 44): PD-1 aptamer-AS1411 aptamer-PD-L1 aptamer-3*AmiR-21-DNA vector, wherein the DNA vector is the 3rd group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The PD-1 aptamer is connected to the 5' end of the a sequence through one AmiR-21. The AS1411 aptamer is connected to the 5' end of the b sequence through one AmiR-21. The PD-L1 aptamer is connected to the 5' end of the c sequence through one AmiR-21. There is a thiophosphate modification independently between the first 2 nucleotides at the 3' ends of the a sequence, b sequence and c sequence of the DNA vector;

[0745] Preferably, the sequence of the PD-1 aptamer is: SEQ ID NO:253:

[0746] AGCGGTGACGGCACAGACGGTACAGTTCCCGTCCCTGCACTACACGTATGCCGCT, and there is a thiophosphate modification in the phosphodiester backbone between the first 4 adjacent nucleotides at the 5' end;

[0747] Preferably, the sequence of the AS1411 aptamer is: SEQ ID NO:131:

[0748] GGTGGTGGTGGTTGTGGTGGTGGTGG, and there is a thiophosphate modification in the phosphodiester backbone between the first 2 adjacent nucleotides at the 5' end;

[0749] Preferably, the sequence of the PD-L1 aptamer is: SEQ ID NO:241:

[0750] ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a thiophosphate modification in the phosphodiester backbone between the first 4 adjacent nucleotides at the 5' end;

[0751] Preferably, the sequence of AmiR-21 is: GATAAGCT, and there is a thiophosphate modification in the phosphodiester backbone between adjacent nucleotides.

[0752] Drug 45): CPG1826-CD40 aptamer-AmiR-21-3*biotin-DNA vector, wherein the DNA vector is the 13th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. CpG1826 is connected to the 5' end of the a sequence through a spacer sequence. The CD40 aptamer is connected to the 5' end of the b sequence through a spacer sequence. AmiR-21 is connected to the 5' end of the c sequence through a spacer sequence. Three biotins are respectively connected to the 3' ends of the a sequence, b sequence and c sequence;

[0753] Preferably, the sequence of CpG1826 is: SEQ ID NO:59: TCCATGACGTTCCTGACG, with a phosphorothioate modification in the phosphate backbone between adjacent nucleotides;

[0754] Preferably, the transition sequence is TTTTT;

[0755] Preferably, the sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG;

[0756] Preferably, the sequence of AmiR21 is GATAAGCT, and each nucleotide has a locked nucleic acid modification.

[0757] Drug 46): ATP aptamer - AmiR - 21 - FGF2 aptamer - AmiR - 1306 - DNA vector, wherein, in the DNA vector, the a sequence is: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC; the b sequence is: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG; the c sequence is: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC; the ATP aptamer is connected to the 5' end of the a sequence through the transition sequence TTTTT, the FGF2 aptamer is connected to the 5' end of the b sequence through the transition sequence U, and AmiR1306 and AmiR - 21 are sequentially connected to the 5' end of the c sequence.

[0758] The sequence of the ATP aptamer is SEQ ID NO:136: GGGAGGACGATGCGGAGGAAGGGTAGG, with a phosphorothioate modification on the phosphate backbone between the first 4 nucleotides at the 5' end;

[0759] The sequence of the FGF2 aptamer is SEQ ID NO:183: GGGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCCC, wherein C and U have 2'-F modification;

[0760] The sequence of AmiR1306 is: SEQ ID NO:127: CATCACCACCAGAGCCAACGTC, wherein there is a phosphorothioate modification on the phosphate backbone between the first 5 nucleotides at the 5' end;

[0761] The sequence of AmiR - 21 is: GATAAGCT, and each nucleotide is a locked nucleic acid modification.

[0762] Drug 47): CD16a aptamer-CTLA-4 aptamer-PD-L1 aptamer-DNA vector, wherein the DNA vector is the 9th group of the nucleic acid vectors with the aforementioned 26 backbone sequences, the CD16a aptamer is connected to the 5'-end of the a sequence through a transition sequence, the CTLA-4 aptamer is connected to the 5'-end of the b sequence through a transition sequence, the PD-L1 aptamer is connected to the 5'-end of the c sequence, and there is a thiophosphate modification independently between the first 2 nucleotides at the 3'-ends of the a sequence, b sequence and c sequence of the DNA vector;

[0763] Preferably, the sequence of the CD16a aptamer is:

[0764] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end;

[0765] Preferably, the sequence of the CTLA-4 aptamer is:

[0766] SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end, and C or U has a 2'-F modification, and A or G has a 2'-OME modification;

[0767] Preferably, the sequence of the PD-L1 aptamer is:

[0768] SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end.

[0769] Drug 48): CD16a aptamer-Act-12c aptamer-PD-L1 aptamer-DNA vector, wherein the DNA vector is the 9th group of the nucleic acid vectors with the aforementioned 26 backbone sequences, the CD16a aptamer is connected to the 5'-end of the a sequence through a transition sequence, the Act-12c aptamer is connected to the 5'-end of the b sequence through a transition sequence, the PD-L1 aptamer is connected to the 5'-end of the c sequence, and there is a thiophosphate modification independently between the first 2 nucleotides at the 3'-ends of the a sequence, b sequence and c sequence of the DNA vector;

[0770] Preferably, the sequence of the CD16a aptamer is:

[0771] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end;

[0772] Preferably, the sequence of the Act-12c aptamer is as follows:

[0773] SEQ ID NO:137: CGGGGAAAGTCACGGGGGGTTTCAGATGTTCTGATCGGTGTGGAG, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5' end;

[0774] Preferably, the sequence of the PD-L1 aptamer is as follows:

[0775] SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5' end.

[0776] Drug 49): CTLA-4 aptamer - PD-L1 aptamer - PD1 aptamer - DNA vector, wherein the DNA vector is the 5th group of the nucleic acid vectors with the aforementioned 26 backbone sequences,

[0777] The PD-L1 aptamer is sequentially linked to the complementary sequence A' of the transition sequence and the single-stranded linker sequence A. The single-stranded linker sequence A is located at the 3' end of the a sequence. The PD-L1 aptamer is linked to the 3' end of the a sequence through complementary base pairing with the complementary sequence A'.

[0778] The PD1 aptamer is sequentially linked to the complementary sequence B' of the transition sequence and the single-stranded linker sequence B. The single-stranded linker sequence B is located at the 3' end of the b sequence. The PD-L1 aptamer is linked to the 3' end of the b sequence through complementary base pairing with the complementary sequence B'.

[0779] The CTLA-4 aptamer is linked to the complementary sequence C' of the single-stranded linker sequence C. The single-stranded linker sequence C is located at the 3' end of the c sequence. The PD-L1 aptamer is linked to the 3' end of the c sequence through complementary base pairing with the complementary sequence C'.

[0780] Preferably, the sequence of the PD-L1 aptamer is as follows:

[0781] SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, with a phosphorothioate modification in the phosphate backbone between the first three adjacent nucleotides at the 5' end;

[0782] Preferably, the sequence of the PD1 aptamer is as follows:

[0783] SEQ ID NO:254: ACCGACAGTGAAGGACTCAGCGAACTCTCAGACTCGGTTC, with a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5'-end;

[0784] Preferably, the sequence of the CTLA-4 aptamer is:

[0785] SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, with a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5'-end, and a 2'-O-MOE modification on the ribose of the first 2 nucleotides at the 5'-end, and the remaining C or U has a 2'-F modification;

[0786] Preferably, the single-stranded linker sequence A is: SEQ ID NO:7: TGTAGCACGGTGGC, and the complementary sequence A' is SEQ ID NO:8: GCCACCGTGCTACA;

[0787] Preferably, the single-stranded linker sequence B is: SEQ ID NO:7: TGTAGCACGGTGGC, and the complementary sequence B' is SEQ ID NO:8: GCCACCGTGCTACA;

[0788] Preferably, the single-stranded linker sequence C is: SEQ ID NO:11: TGCTGCTGCTGCTG, and the complementary sequence C' is SEQ ID NO:12: CAGCAGCAGCAGCA.

[0789] Drug 50): PD1 aptamer - IL-4Ra aptamer - OX40 aptamer - DNA vector, wherein the DNA vector is the 6th group of the nucleic acid vectors with the aforementioned 26 backbone sequences, the PD1 aptamer is linked to the 5'-end of the a sequence through the spacer sequence AAA, the IL-4Ra aptamer is linked to the 5'-end of the b sequence through the spacer sequence AAA, the OX40 aptamer is linked to the 5'-end of the c sequence through the spacer sequence AAA, and there is a phosphorothioate modification independently between the first 3 nucleotides at the 3'-ends of the a sequence, b sequence and c sequence of the DNA vector;

[0790] Preferably, the sequence of the PD1 aptamer is:

[0791] SEQ ID NO:253: AGCGGTGACGGCACAGACGGTACAGTTCCCGTCCCTGCACTACACGTATGCCGCT, with a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end;

[0792] Preferably, the sequence of the IL-4Ra aptamer is:

[0793] SEQ ID NO:203: AAAAAGCAACAGGGUGCUCCAUGCGCAUGGAACCUGCGCG, with phosphorothioate modifications in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end;

[0794] Preferably, the sequence of the OX40 aptamer is:

[0795] SEQ ID NO:229: CAGUCUGCAUCGUAGGAAUCGCCACCGUAUACUUUCCCAC, with phosphorothioate modifications in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end, and the ribose of the first 3 nucleotides at the 5'-end has 2'-O-MOE modification, and the remaining C or U has 2'-F modification, and A or G has 2'-OME modification.

[0796] Drug 51): CD16a aptamer - OX40 aptamer - PD-L1 aptamer - DNA vector, wherein the DNA vector is the 3rd group of the nucleic acid vectors with the aforementioned 26 backbone sequences, the CD16a aptamer is connected to the 5'-end of the a sequence through a linker sequence, the OX40 aptamer is connected to the 5'-end of the b sequence through a linker sequence, the PD-L1 aptamer is connected to the 5'-end of the c sequence through a linker sequence, and there are phosphorothioate modifications independently between the first 2 nucleotides at the 3'-ends of the a sequence, b sequence and c sequence of the DNA vector;

[0797] Preferably, the sequence of the CD16a aptamer is:

[0798] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, with phosphorothioate modifications in the phosphate backbone between the first 2 nucleotides at the 5'-end;

[0799] Preferably, the sequence of the OX40 aptamer is:

[0800] SEQ ID NO:230: GGGAUGCGGAAAAAAGAACACUUCCGAUUAGGGCCCACCCUAACGGCCGCAGAC, C or U has 2'-F modification, A or G has 2'-OME modification, and there are phosphorothioate modifications in the phosphate backbone between the first 2 nucleotides at the 5'-end;

[0801] Preferably, the sequence of the PD-L1 aptamer is:

[0802] SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, with phosphorothioate modifications in the phosphate backbone between the first 2 nucleotides at the 5'-end.

[0803] Drug 52): CD16a aptamer-VEGF165 aptamer-PD-L1 aptamer-DNA vector, wherein the DNA vector is the 3rd group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The CD16a aptamer is connected to the 5'-end of the a sequence through a linker sequence, the VEGF165 aptamer is connected to the 5'-end of the b sequence through a linker sequence, the PD-L1 aptamer is connected to the 5'-end of the c sequence through a linker sequence, and there is a thiophosphate modification independently between the first 2 nucleotides at the 3'-ends of the a sequence, b sequence and c sequence of the DNA vector;

[0804] Preferably, the sequence of the CD16a aptamer is:

[0805] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end;

[0806] Preferably, the sequence of the VEGF165 aptamer is:

[0807] SEQ ID NO:280: CGGAAUCAGUGAAUGCUUAUACAUCCG, C or U has a 2'-F modification, A or G has a 2'-OME modification, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end;

[0808] Preferably, the sequence of the PD-L1 aptamer is:

[0809] SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end.

[0810] Drug 53): CD16a aptamer-CTLA4 aptamer-TIM3 aptamer-DNA vector, wherein the DNA vector is the 3rd group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The CD16a aptamer is connected to the 5'-end of the a sequence through a linker sequence, the CTLA4 aptamer is connected to the 5'-end of the b sequence through a linker sequence, the TIM3 aptamer is connected to the 5'-end of the c sequence through a linker sequence, and there is a thiophosphate modification independently between the first 2 nucleotides at the 3'-ends of the a sequence, b sequence and c sequence of the DNA vector;

[0811] Preferably, the sequence of the CD16a aptamer is:

[0812] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5' end;

[0813] Preferably, the sequence of the CTLA4 aptamer is:

[0814] SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5' end, C or U has a 2'-F modification, and A or G has a 2'-OME modification;

[0815] Preferably, the sequence of the TIM3 aptamer is:

[0816] SEQ ID NO:270: GGGAGAGGACCAGUAGCCACUAUGGUGUUGGAGCUAGCGGCAGAGCGUCGCGGUCCC UCCC, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5' end, C or U has a 2'-F modification, and A or G has a 2'-OME modification.

[0817] Drug 54): PD-1 aptamer - CTLA-4 aptamer - LAG-3 aptamer - DNA vector, wherein the DNA vector is the 3rd group of the nucleic acid vectors with the aforementioned 26 backbone sequences, the PD-L1 aptamer is connected to the 5' end of the a sequence through a linker sequence, the CTLA-4 aptamer is connected to the 5' end of the b sequence through a linker sequence, the LAG-3 aptamer is connected to the 5' end of the c sequence through a linker sequence, and there is a phosphorothioate modification independently between the first two nucleotides at the 3' end of the a sequence, b sequence, and c sequence of the DNA vector;

[0818] Preferably, the sequence of the PD-1 aptamer is:

[0819] SEQ ID NO:253: AGCGGTGACGGCACAGACGGTACAGTTCCCGTCCCTGCACTACACGTATGCCGCT, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5' end;

[0820] Preferably, the sequence of the CTLA-4 aptamer is:

[0821] SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5' end, C or U has a 2'-F modification, and A or G has a 2'-OME modification;

[0822] Preferably, the sequence of the LAG-3 aptamer is:

[0823] SEQ ID NO:206: GGGAGAGAGAUAUAAGGGCCUCCUGAUACCCGCUGCUAUCUGGACCGAUCCCAUUAC CAAAUUCUCUCCC. There is a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end. C or U has a 2'-F modification, and A or G has a 2'-OME modification.

[0824] Drug 55): CD16a aptamer - Act-12c aptamer - MUC1 aptamer - DNA vector. Among them, the DNA vector is the 3rd group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The CD16a aptamer is linked to the 5'-end of the a sequence through a transition sequence, the Act-12c aptamer is linked to the 5'-end of the b sequence through a transition sequence, and the MUC1 aptamer is linked to the 5'-end of the c sequence through a transition sequence. There is a phosphorothioate modification independently between the first two nucleotides at the 3'-ends of the a sequence, b sequence, and c sequence of the DNA vector.

[0825] Preferably, the sequence of the CD16a aptamer is:

[0826] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG. There is a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end.

[0827] Preferably, the sequence of the Act-12c aptamer is:

[0828] SEQ ID NO:137: CGGGGAAAGTCACGGGGGGTTTCAGATGTTCTGATCGGTGTGGAG. There is a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end.

[0829] Preferably, the sequence of the MUC1 aptamer is: SEQ ID NO:209:

[0830] GAAGTGAAAATGACAGAACACAACA.

[0831] Drug 56): CD16a aptamer - TGF-β aptamer - PD-L1 aptamer - DNA vector, wherein the DNA vector is the 3rd group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The CD16a aptamer is connected to the 5' end of the a sequence through a linker sequence, the TGF-β aptamer is connected to the 5' end of the b sequence through a linker sequence, the PD-L1 aptamer is connected to the 5' end of the a sequence through a linker sequence, and there is a thiophosphate modification independently between the first 2 nucleotides at the 3' ends of the a, b, and c sequences of the DNA vector;

[0832] Preferably, the sequence of the CD16a aptamer is:

[0833] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5' end;

[0834] Preferably, the sequence of the TGF-β aptamer is:

[0835] SEQ ID NO:269: ACATTGCTGCGTGATCGCCTCACATGGGTTTGTCTGGTCGATTTGGAGGTGGTGGGTGGC, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5' end;

[0836] Preferably, the sequence of the PD-L1 aptamer is:

[0837] SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5' end.

[0838] Drug 57): CD16a aptamer - CD40 aptamer - CTLA-4 aptamer - DNA vector, wherein the DNA vector is the 3rd group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The CD16a aptamer is connected to the 5' end of the a sequence through a linker sequence, the CD40 aptamer is connected to the 5' end of the b sequence through a linker sequence, the CTLA-4 aptamer is connected to the 5' end of the c sequence through a linker sequence, and there is a thiophosphate modification independently between the first 2 nucleotides at the 3' ends of the a, b, and c sequences of the DNA vector;

[0839] Preferably, the sequence of the CD16a aptamer is:

[0840] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5' end;

[0841] Preferably, the sequence of the CD40 aptamer is:

[0842] SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, with a thiophosphate modification in the phosphate backbone between the first two nucleotides at the 5'-end;

[0843] Preferably, the sequence of the CTLA-4 aptamer is:

[0844] SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, with a thiophosphate modification in the phosphate backbone between the first two nucleotides at the 5'-end, C or U having a 2'-F modification, and A or G having a 2'-OME modification.

[0845] Drug 58): HER2 aptamer - HER3 aptamer - CD40 aptamer - CD16a aptamer - DNA vector, wherein the DNA vector is the 7th group among the nucleic acid vectors of the aforementioned 26 backbone sequences, the HER3 aptamer is linked to the 5'-end of the a sequence through the linker sequence AA, the HER2 aptamer is linked to the 5'-end of the c sequence through the linker sequence AA, the CD40 aptamer and the CD16a aptamer are respectively linked to the 5'-end and 3'-end of the b sequence through the linker sequence AA, and the first two nucleotides at the 3'-ends of the a sequence and the c sequence of the DNA vector independently have thiophosphate modifications;

[0846] Preferably, the sequence of the HER2 aptamer is:

[0847] SEQ ID NO:194: AGCCGCGAGGGGAGGGAUAGGGUAGGGCGCGGCU, with a thiophosphate modification in the phosphate backbone between the first two nucleotides at the 5'-end, C or U having a 2'-F modification, and A or G having a 2'-OME modification;

[0848] Preferably, the sequence of the HER3 aptamer is:

[0849] SEQ ID NO:197: CAGCGAAAGUUGCGUAUGGGUCACAUCGCAGGCACAUGUCAUCUGGGCG, with a thiophosphate modification in the phosphate backbone between the first two nucleotides at the 5'-end, C or U having a 2'-F modification, and A or G having a 2'-OME modification;

[0850] Preferably, the sequence of the CD40 aptamer is:

[0851] SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end;

[0852] Preferably, the sequence of the CD16a aptamer is:

[0853] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end.

[0854] Drug 59): CD16a aptamer - Act-12c aptamer - CTLA-4 aptamer - GPC1 aptamer - DNA vector, wherein the DNA vector is the 10th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The CD16a aptamer is linked to the 5'-end of the a sequence through the linker sequence TTTTT. The Act-12c aptamer is linked to the 5'-end of the b sequence through the linker sequence TTTTT. The CTLA-4 aptamer and the GPC1 aptamer are respectively linked to the 5'-end and 3'-end of the c sequence through the linker sequence TTT. The first two nucleotides at the 3'-ends of the a sequence and the b sequence of the DNA vector each independently have a phosphorothioate modification;

[0855] Preferably, the sequence of the CD16a aptamer is:

[0856] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end;

[0857] Preferably, the sequence of the Act-12c aptamer is:

[0858] SEQ ID NO:137: CGGGGAAAGTCACGGGGGGTTTCAGATGTTCTGATCGGTGTGGAG, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end;

[0859] Preferably, the sequence of the CTLA-4 aptamer is:

[0860] SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end, C or U has a 2'-F modification, and A or G has a 2'-OME modification;

[0861] Preferably, the sequence of the GPC1 aptamer is:

[0862] SEQ ID NO:189: AACGGAGTGTGGCTAACTCGA, with a phosphorothioate modification in the phosphate backbone between the last two nucleotides at the 3'-end.

[0863] Drug 60): CD16a aptamer - HER3 aptamer - VEGF165 aptamer - DNA vector, wherein the DNA vector is the 3rd group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The CD16a aptamer is linked to the 5'-end of the a sequence through the linker sequence TTTTT, the HER3 aptamer is linked to the 5'-end of the b sequence through the linker sequence TTTTT, the VEGF165 aptamer is linked to the 5'-end of the c sequence through the linker sequence TTTTT, and there is a phosphorothioate modification independently between the first two nucleotides at the 3'-ends of the a sequence, b sequence and c sequence of the DNA vector.

[0864] Preferably, the sequence of the CD16a aptamer is:

[0865] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end.

[0866] Preferably, the sequence of the HER3 aptamer is:

[0867] SEQ ID NO:197: CAGCGAAAGUUGCGUAUGGGUCACAUCGCAGGCACAUGUCAUCUGGGCG, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end, C or U has a 2'-F modification, and A or G has a 2'-OME modification.

[0868] Preferably, the sequence of the VEGF165 aptamer is:

[0869] SEQ ID NO:280: CGGAAUCAGUGAAUGCUUAUACAUCCG, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end, C or U has a 2'-F modification, and A or G has a 2'-OME modification.

[0870] Drug 61): VEGF aptamer - GPC1 aptamer - PD - L1 aptamer - CD16a aptamer - DNA vector, wherein the DNA vector is the 11)th group among the aforementioned 26 nucleic acid vectors with backbone sequences. The VEGF aptamer and the GPC1 aptamer are respectively connected to the 5' end and the 3' end of the a sequence through the transition sequence TTTTT. The PD - L1 aptamer and the CD16a aptamer are respectively connected to the 5' end of the b sequence and the 5' end of the c sequence through the transition sequence TTTTT. There is a thiophosphate modification independently between the first 2 nucleotides at the 3' end of the b sequence and the c sequence of the DNA vector;

[0871] Preferably, the sequence of the VEGF aptamer is:

[0872] SEQ ID NO:279: GGTGGGGGTGGACGGGCCGGGTAGA, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5' end;

[0873] Preferably, the sequence of the GPC1 aptamer is:

[0874] SEQ ID NO:189: AACGGAGTGTGGCTAACTCG*A, and there is a thiophosphate modification in the phosphate backbone between the last 2 nucleotides at the 3' end;

[0875] Preferably, the sequence of the PD - L1 aptamer is:

[0876] SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5' end;

[0877] Preferably, the sequence of the CD16a aptamer is:

[0878] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5' end.

[0879] Drug 62): PD - 1 aptamer - PD - L1 aptamer - 2 * AmiR21 - Act - 12c aptamer - DNA vector, wherein the DNA vector is the 3)rd group among the aforementioned 26 nucleic acid vectors with backbone sequences. The PD - 1 aptamer is connected to the 5' end of the a sequence through an AmiR21. The PD - L1 aptamer is connected to the 5' end of the b sequence through another AmiR21. The Act - 12c aptamer is connected to the 5' end of the c sequence through the transition sequence TTTTT. There is a thiophosphate modification independently between the first 2 nucleotides at the 3' end of the a sequence, the b sequence and the c sequence of the DNA vector;

[0880] Preferably, the sequence of the PD-1 aptamer is:

[0881] SEQ ID NO:253: AGCGGTGACGGCACAGACGGTACAGTTCCCGTCCCTGCACTACACGTATGCCGCT, with a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end;

[0882] Preferably, the sequence of the PD-L1 aptamer is:

[0883] SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, with a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end;

[0884] Preferably, the sequence of the Act-12c aptamer is:

[0885] SEQ ID NO:137: CGGGGAAAGTCACGGGGGGTTTCAGATGTTCTGATCGGTGTGGAG, with a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end;

[0886] Preferably, the sequence of AmiR21 is: GATAAGCT, with a phosphorothioate modification in the phosphate backbone between adjacent nucleotides.

[0887] Drug 63): Her3 aptamer - EGFR siRNA - AS1411 aptamer - Survivin siRNA - Her2 aptamer - DNA vector, wherein the DNA vector is the 14th group of the nucleic acid vectors with the aforementioned 26 backbone sequences, the AS1411 aptamer is connected to the 3'-end of the a sequence through the linker sequence AAAA, the Her2 aptamer is connected to the 3'-end of the b sequence through the linker sequence AAAA, the sense strand of the EGFR siRNA is connected to the 3'-end of the c sequence through the linker sequence AAAA; the sense strand of the Survivin siRNA is connected to the 3'-end of the b sequence through the linker sequence AAAA, and there are independent phosphorothioate modifications between the first 2 nucleotides at the 5'-ends of the a sequence, b sequence and c sequence of the DNA vector;

[0888] The Her3 aptamer is connected to the antisense strand of the EGFR siRNA through the linker sequence AA, and is connected to the 3'-end of the c sequence through complementary pairing with the sense strand of the EGFR siRNA via the antisense strand of the EGFR siRNA;

[0889] The Her2 aptamer is linked to the antisense strand of Survivin siRNA through the spacer sequence AA, and is linked to the 3' end of the b sequence by complementary base pairing between the antisense strand of Survivin siRNA and the sense strand of Survivin siRNA;

[0890] Preferably, the sequence of the Her3 aptamer is:

[0891] SEQ ID NO:197: CAGCGAAAGUUGCGUAUGGGUCACAUCGCAGGCACAUGUCAUCUGGGCG. There is a phosphorothioate modification in the phosphate backbone between the first three adjacent nucleotides at the 5' end.

[0892] Preferably, the antisense strand of the EGFR siRNA is: SEQ ID NO:302: AAUUAGAUAAGACUGCUAAGGCA, and the sense strand is: SEQ ID NO:82: CCUUAGCAGUCUUAUCUAAUU. There are phosphorothioate modifications in the phosphate backbone between the first three adjacent nucleotides at the 5' end and between the last three adjacent nucleotides at the 3' end for both the antisense strand and the sense strand of the EGFR siRNA;

[0893] Preferably, the sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG. There is a phosphorothioate modification in the phosphate backbone between the last two nucleotides at the 3' end.

[0894] Preferably, the sense strand of the Survivin siRNA is: SEQ ID NO:303: GCAGGUUCCUUAUCUGUCACA,

[0895] The antisense strand of the Survivin siRNA is: SEQ ID NO:300: UGUGACAGAUAAGGAACCUGCAG, where there is a phosphorothioate modification in the phosphate backbone between the first three adjacent nucleotides at the 5' end and between the last three adjacent nucleotides at the 3' end;

[0896] The sequence of the Her2 aptamer is:

[0897] SEQ ID NO:194: AGCCGCGAGGGGAGGGAUAGGGUAGGGCGCGGCU. There is a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5' end; C or U has a 2'-F modification, and A or G has a 2'-OME modification.

[0898] Drug 64): Survivin siRNA-TFRA3 aptamer-AS1411 aptamer-3*AmiR-21-DNA vector, wherein the DNA vector is the 17th group of the nucleic acid vectors of the aforementioned 26 backbone sequences, the TFRA3 aptamer is connected to the 5' end of the a sequence through one AmiR-21, the FA is connected to the 3' end of the a sequence, the AS1411 aptamer is connected to the 5' end of the b sequence through one AmiR-21, the sense strand of Survivin siRNA is connected to the 5' end of the c sequence through one AmiR-21, and the antisense strand of Survivin siRNA is complementary paired and connected to the sense strand of Survivin siRNA;

[0899] Preferably, the sequence of the TFRA3 aptamer is: SEQ ID NO:262: GCGTGGTCACACGC;

[0900] Preferably, the sequence of AmiR-21 is: GATAAGCT;

[0901] Preferably, the sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG;

[0902] Preferably, the sense strand of Survivin siRNA is: SEQ ID NO:304: GCAGGUUCCUUAUCUGUCA, wherein there is a phosphorothioate modification between the first 3 adjacent nucleotides at the 5' end, there is a phosphorothioate modification between the last 3 adjacent nucleotides at the 3' end, and there is a 2'-F modification at the 7th, 9th - 11th positions starting from the 5' end, and the rest are 2'-OMe modifications;

[0903] The antisense strand of Survivin siRNA is: SEQ ID NO:305: UGACAGAUAAGGAACCUGCAGUU, there is a phosphorothioate modification between the 5' end and the first 3 positions at the 3' end, there is a 2'-F modification at the 2nd, 6th, 8th, 9th, 12th, 14th, 16th positions starting from the 5' end, and the rest are 2'-OMe modifications.

[0904] Drug 65): AS1411 aptamer-EGFR siRNA-VEGF165 aptamer-PD-L1 aptamer-RNA vector, wherein the RNA vector is the 16th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The VEGF165 aptamer is connected to the 3'-end of the a sequence through the linker sequence AA. The PD-L1 aptamer is connected to the 3'-end of the b sequence through the linker sequence AA. The sense strand of the EGFR siRNA is connected to the 3'-end of the c sequence through the linker sequence AA. The AS1411 aptamer is connected to the 5'-end of the antisense strand of the EGFR siRNA through the linker sequence AA. The antisense strand of the EGFR siRNA is complementary paired and connected to the sense strand of the EGFR siRNA. The first 2 nucleotides at the 5'-end of the a sequence of the DNA vector each independently have phosphorothioate modification;

[0905] Preferably, the sequence of the AS1411 aptamer is: SEQ ID NO:131:

[0906] GGTGGTGGTGGTTGTGGTGGTGGTGG, and there is phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end;

[0907] Preferably, the sense strand of the EGFR siRNA is: SEQ ID NO:82: CCUUAGCAGUCUUAUCUAAUU, and there is phosphorothioate modification in the phosphate backbone between the last 3 adjacent nucleotides at the 3'-end;

[0908] The antisense strand of the EGFR siRNA is:

[0909] SEQ ID NO:302: AAUUAGAUAAGACUGCUAAGGCA, and there are phosphorothioate modifications both between the first 3 nucleotides at the 5'-end and between the last 3 adjacent nucleotides at the 3'-end;

[0910] Preferably, the sequence of the VEGF165 aptamer is:

[0911] SEQ ID NO:280: CGGAAUCAGUGAAUGCUUAUACAUCCG, wherein C and U have 2'-F modification, A and G have 2'-OME modification, and there is phosphorothioate modification in the phosphate backbone between the last 2 nucleotides at the 3'-end;

[0912] Preferably, the sequence of the PD-L1 aptamer is:

[0913] SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, wherein C and U are 2'-F modified, A and G are 2'-OME modified, and there is a phosphorothioate modification in the phosphate backbone between the last two nucleotides at the 3' end.

[0914] Drug 66): CEA aptamer - CD16a - aptamer - Act - 12c aptamer - PD - L1 aptamer - DNA vector, wherein the DNA vector is the 20th group of the nucleic acid vectors of the aforementioned 26 backbone sequences. The CEA aptamer is linked to the 5' end of the a sequence through the spacer sequence AAA, the CD16a - aptamer is linked to the 3' end of the a sequence through the spacer sequence AA, the Act - 12c aptamer and the PD - L1 aptamer are each linked to the 5' ends of the b sequence and the c sequence through the spacer sequence AA respectively, and there is an independent phosphorothioate modification between the first two nucleotides at the 3' ends of the b sequence and the c sequence of the DNA vector;

[0915] Preferably, the sequence of the CEA aptamer is: SEQ ID NO:150: TTAACTTATTCGACCATA, and there is a phosphorothioate modification in the phosphate backbone between the 1st and 2nd nucleotides at the 5' end;

[0916] Preferably, the sequence of the CD16a aptamer is:

[0917] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is a phosphorothioate modification in the phosphate backbone between the 1st and 2nd nucleotides at the 3' end;

[0918] Preferably, the sequence of the Act - 12c aptamer is:

[0919] SEQ ID NO:137: CGGGGAAAGTCACGGGGGGTTTCAGATGTTCTGATCGGTGTGGAG, and there is a phosphorothioate modification in the phosphate backbone between the 1st and 2nd nucleotides at the 5' end;

[0920] Preferably, the sequence of the PD - L1 aptamer is:

[0921] SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a phosphorothioate modification in the phosphate backbone between the 1st and 2nd nucleotides at the 5' end.

[0922] Drug 67): AS1411 aptamer-TAP siRNA-CD16a aptamer-CTLA-4 aptamer-DNA vector, wherein the DNA vector is the 14th group of the nucleic acid vectors of the aforementioned 26 backbone sequences. The CD16a aptamer is connected to the 3' end of the a sequence through the transition sequence AAAA. The CTLA-4 aptamer is connected to the 3' end of the b sequence through the transition sequence AAAA. The sense strand of TAP siRNA is connected to the 3' end of the c sequence through the transition sequence AAAA. The AS1411 aptamer is connected to the 5' end of the antisense strand of TAP siRNA through the transition sequence AAA. The antisense strand of TAP siRNA is complementary base-paired and connected to the sense strand of TAP siRNA. The first 2 nucleotides at the 5' ends of the a sequence, b sequence, and c sequence of the DNA vector each independently have a phosphorothioate modification;

[0923] Preferably, the sequence of the AS1411 aptamer is:

[0924] SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, with a phosphorothioate modification in the phosphate backbone between the 1st and 2nd nucleotides at the 5' end;

[0925] Preferably, the sense strand of TAP siRNA is: SEQ ID NO:301: GCUGCACACGGUUCAGAAU, with phosphorothioate modifications between the 1st and 3rd nucleotides at the 5' end and between the last 1st and 3rd nucleotides at the 3' end, 2'-F modification at the 7th, 9th - 11th nucleotides from the 5' end, and 2'-OME modification for the remaining nucleotides;

[0926] The antisense strand of TAP siRNA is: SEQ ID NO:109: AUUCUGAACCGUGUGCAGCUU, with phosphorothioate modifications between the 1st and 3rd nucleotides at the 5' end and between the last 1st and 3rd nucleotides at the 3' end, 2'-F modification at the 2nd, 6th, 8th, 9th, 12th, 14th, 16th nucleotides from the 5' end, and 2'-OME modification for the remaining nucleotides;

[0927] Preferably, the sequence of the CD16a aptamer is:

[0928] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, with phosphorothioate modifications between the 1st and 2nd nucleotides at the 5' end and between the last 1st and 2nd nucleotides at the 3' end;

[0929] Preferably, the sequence of the CTLA-4 aptamer is:

[0930] SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU. There is a phosphorothioate modification in the phosphate backbone between the 1st and 2nd nucleotides at the 3'-end. C and U have 2'-F modification, and A and G have 2'-OME modification.

[0931] Drug 68): AS1411 aptamer - TAP siRNA - CD16a aptamer - Act-12c aptamer - DNA vector. Among them, the DNA vector is the 14th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The CD16a aptamer is linked to the 3'-end of the a sequence through the transition sequence AAAA. The Act-12c aptamer is linked to the 3'-end of the b sequence through the transition sequence AAAA. The sense strand of TAP siRNA is linked to the 3'-end of the c sequence through the transition sequence AAAA. The AS1411 aptamer is linked to the 5'-end of the antisense strand of TAP siRNA through the transition sequence AAA. The antisense strand of TAP siRNA is complementary paired and linked to the sense strand of TAP siRNA. There is a phosphorothioate modification independently between the first 2 nucleotides at the 5'-ends of the a sequence, b sequence and c sequence of the DNA vector.

[0932] Preferably, the sequence of the AS1411 aptamer is:

[0933] SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG. There is a phosphorothioate modification in the phosphate backbone between the 1st and 2nd nucleotides at the 5'-end.

[0934] Preferably, the sense strand of TAP siRNA is: SEQ ID NO:301: GCUGCACACGGUUCAGAAU. There is a phosphorothioate modification in the phosphate backbone between the adjacent nucleotides at the 1st - 3rd positions at the 5'-end and the 1st - 3rd positions at the 3'-end. The 7th and 9th - 11th nucleotides from the 5'-end have 2'-F modification, and the remaining nucleotides have 2'-OME modification.

[0935] The antisense strand of TAP siRNA is: SEQ ID NO:109: AUUCUGAACCGUGUGCAGCUU. There is a phosphorothioate modification in the phosphate backbone between the adjacent nucleotides at the 1st - 3rd positions at the 5'-end and the 1st - 3rd positions at the 3'-end. The 2nd, 6th, 8th, 9th, 12th, 14th, 16th nucleotides from the 5'-end have 2'-F modification, and the remaining nucleotides have 2'-OME modification.

[0936] Preferably, the sequence of the CD16a aptamer is:

[0937] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTG*G, with a phosphorothioate modification in the phosphate backbone between nucleotides 1 and 2 at the 3'-end;

[0938] Preferably, the sequence of the Act-12c aptamer is:

[0939] SEQ ID NO:137: CGGGGAAAGTCACGGGGGGTTTCAGATGTTCTGATCGGTGTGGAG, with a phosphorothioate modification in the phosphate backbone between nucleotides 1 and 2 at the 3'-end.

[0940] Drug 69): CD16a aptamer - AS1411 aptamer - TAP siRNA - OX40 aptamer - Act-12c aptamer - DNA vector, wherein the DNA vector is the 14th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. Therefore, the CD16a aptamer is connected to the 5'-end of the a sequence through the linker sequence AA, the sense strand of the TAP siRNA is connected to the 3'-end of the a sequence through the linker sequence AA, the AS1411 aptamer is connected to the 5'-end of the antisense strand of the TAP siRNA through the linker sequence AAA, the antisense strand of the TAP siRNA is complementary paired and connected to the sense strand of the TAP siRNA, the OX40 aptamer is connected to the 3'-end of the b sequence through the linker sequence AA, the Act-12c aptamer is connected to the 5'-end of the c sequence through the linker sequence AAAA, and there are independent phosphorothioate modifications between the first 2 nucleotides at the 5'-ends of the b sequence and the c sequence of the DNA vector;

[0941] Preferably, the sequence of the CD16a aptamer is:

[0942] SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, with a phosphorothioate modification in the phosphate backbone between nucleotides 1 and 2 at the 5'-end;

[0943] Preferably, the sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, with a phosphorothioate modification in the phosphate backbone between nucleotides 1 and 2 at the 5'-end;

[0944] Preferably, the sense strand of the TAP siRNA is: SEQ ID NO:301: GCUGCACACGGUUCAGAAU, with phosphorothioate modifications in the phosphate backbones between adjacent nucleotides 1 - 3 at the 5'-end and 1 - 3 at the 3'-end, 2'-F modifications at nucleotides 7, 9, 10, and 11 from the 5'-end, and 2'-OME modifications for the remaining nucleotides;

[0945] The antisense strand of the TAP siRNA is: SEQ ID NO:109: AUUCUGAACCGUGUGCAGCUU. There is a phosphorothioate modification in the phosphate backbone between the adjacent nucleotides at positions 1-3 at the 5'-end and positions 1-3 at the 3'-end. The nucleotides at positions 2, 6, 8, 9, 12, 14, and 16 from the 5'-end have 2'-F modification, and the remaining nucleotides have '-OME modification;

[0946] Preferably, the sequence of the OX40 aptamer is:

[0947] SEQ ID NO:228: GGGAGGACGAUGCGGCAGUCUGCAUCGUAGGAAUCGCCACCGUAUACUUUCCCACCA GACGACUCGCUG. There is a phosphorothioate modification in the phosphate backbone between the nucleotides at positions 1-2 at the 3'-end. C and U have 2'-F modification, and A and G have 2'-OMe modification;

[0948] Preferably, the sequence of the Act-12c aptamer is:

[0949] SEQ ID NO:137: CGGGGAAAGTCACGGGGGGTTTCAGATGTTCTGATCGGTGTGGAG. There is a phosphorothioate modification at positions 1-2 at the 5'-end.

[0950] Drug 70): CTLA-4 aptamer - CD40 aptamer - FAP aptamer - DNA vector. Among them, the DNA vector is the 15th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The CTLA-4 aptamer is connected to the 5'-end of the a sequence through the linker sequence TTTTT. The CD40 aptamer is connected to the 5'-end of the b sequence through the linker sequence TTTTT. The FAP aptamer is connected to the 5'-end of the c sequence through the linker sequence TTTTT. There is a phosphorothioate modification independently between the first 2 nucleotides at the 3'-ends of the a sequence, b sequence, and c sequence of the DNA vector;

[0951] Preferably, the sequence of the CTLA-4 aptamer is:

[0952] SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU. There is a phosphorothioate modification in the phosphate backbone between the nucleotides at positions 1-2 at the 5'-end. C and U have 2'-F modification, and A and G have 2'-OMe modification;

[0953] Preferably, the sequence of the CD40 aptamer is:

[0954] SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, with a phosphorothioate modification in the phosphate backbone between nucleotides 1 and 2 at the 5'-end;

[0955] Preferably, the sequence of the FAP aptamer is:

[0956] SEQ ID NO:188: CCGCTCGAGCTAGTCTGACAAAGAGAAACAC, with a phosphorothioate modification in the phosphate backbone between nucleotides 1 and 2 at the 5'-end.

[0957] Drug 71): VEGF165 aptamer - ASAP1 siRNA - CD24A - 2 aptamer - SARS-CoV-2 - N48 aptamer - DNA vector, wherein the DNA vector is the 14th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The sense strand of ASAP1 siRNA is linked to the 3'-end of the c sequence through the linker sequence AA. The VEGF165 aptamer is linked to the 5'-end of the antisense strand of ASAP1 siRNA through the linker sequence AA. The antisense strand of ASAP1 siRNA is complementary paired and linked to the sense strand of ASAP1 siRNA. The CD24 A - 2 aptamer is linked to the 3'-end of the b sequence through the linker sequence AA. The SARS-CoV-2 - N48 aptamer is linked to the 3'-end of the a sequence through the linker sequence AA. There are independent phosphorothioate modifications between the first 2 nucleotides at the 5'-ends of the b sequence and the c sequence of the DNA vector;

[0958] Preferably, the sequence of the VEGF165 aptamer is:

[0959] SEQ ID NO:280: CGGAAUCAGUGAAUGCUUAUACAUCCG, with a phosphorothioate modification in the phosphate backbone between nucleotides 1 and 2 at the 5'-end, C and U have 2'-F modification, and A and G have 2'-OME modification;

[0960] Preferably, the antisense strand of ASAP1 siRNA is: SEQ ID NO:65: UGAUAUUAUGGAAGCAAAUUU, with phosphorothioate modifications in the phosphate backbones between nucleotides 1 - 3 at the 5'-end and nucleotides 1 - 3 at the 3'-end, and nucleotides 2, 6, 8, 9, 12, 14, 16 at the 5'-end have 2'-F modification, and the rest have 2'-OME modification;

[0961] The sense strand of ASAP1 siRNA is: SEQ ID NO:64: AUUUGCUUCCAUAAUAUCAUU. There is a phosphorothioate modification in the phosphate backbone between nucleotides 1-3 at the 5'-end and 1-3 at the 3'-end. Nucleotides 7 and 9-11 at the 5'-end have 2'-F modification, and the rest have 2'-OME modification.

[0962] Preferably, the sequence of the SARS-CoV-2-N48 aptamer is:

[0963] SEQ ID NO:222: GCTGGATGTCGCTTACGACAATATTCCTTAGGGGCACCGCTACATTGACACATCCAGC. There is a phosphorothioate modification in the phosphate backbone between nucleotides 1-2 at the 3'-end.

[0964] Preferably, the sequence of the CD24A-2 aptamer is:

[0965] SEQ ID NO:167: ATCCAGAGTGACGCAGCATATGTGGGTGGGTGGGCGGTTATGCTGAGTCAGCCTTGCTT GGACACGGTGGCTTAGT. There is a phosphorothioate modification in the phosphate backbone between nucleotides 1-2 at the 5'-end.

[0966] Drug 72): 3*FGF5 aptamer-DNA vector. Among them, the DNA vector is the 15th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. Each of the 3 FGF5 aptamers is connected to the 5'-end of the a sequence, the 5'-end of the b sequence, and the 5'-end of the c sequence through U. There is an independent phosphorothioate modification between the first 2 nucleotides at the 3'-ends of the a sequence, b sequence, and c sequence of the DNA vector.

[0967] Preferably, the sequence of the FGF5 aptamer is:

[0968] SEQ ID NO:186: GGGCGACCUCUCCGUACUGACCUACAGAGCGACAUACUAGUGUAUCCAGAUCGCCC;. There is a phosphorothioate modification in the phosphate backbone between nucleotides 1-2 at the 5'-end. C and U have 2'-F modification, and A and G have 2'-OMe modification.

[0969] Drug 73): AS1411 aptamer - ASAP1 siRNA - VEGF aptamer - SARS-CoV-2-N48 aptamer - RNA vector, wherein the DNA vector is the 21st group of the nucleic acid vectors of the aforementioned 26 backbone sequences. The VEGF aptamer is connected to the 3' end of the a sequence through the spacer sequence AA. The SARS-CoV-2-N48 aptamer is connected to the 3' end of the b sequence through the spacer sequence AA. The sense strand of the ASAP1 siRNA is connected to the 3' end of the c sequence. The AS1411 aptamer is connected to the 5' end of the antisense strand of the ASAP1 siRNA through the spacer sequence AA. The antisense strand of the ASAP1 siRNA is complementary base-paired and connected to the sense strand of the ASAP1 siRNA. The first 2 nucleotides at the 5' ends of the a sequence, b sequence, and c sequence of the DNA vector each independently have phosphorothioate modifications, and in the c sequence, A and G have 2'-OME modifications, and C and U have 2'-F modifications;

[0970] Preferably, the sequence of the AS1411 aptamer is:

[0971] SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, with a phosphorothioate modification in the phosphate backbone between the 1st and 2nd nucleotides at the 5' end;

[0972] Preferably, the antisense strand of the ASAP1 siRNA is: SEQ ID NO:65: UGAUAUUAUGGAAGCAAAUUU, with phosphorothioate modifications in the phosphate backbone between the 1st - 3rd nucleotides at the 5' end and between the 1st - 3rd adjacent nucleotides at the 3' end, and having 2'-F modifications at the 2nd, 6th, 8th, 9th, 12th, 14th, and 16th positions from the 5' end, and the rest having 2'-OME modifications;

[0973] The sense strand of the ASAP1 siRNA is: SEQ ID NO:64: AUUUGCUUCCAUAAUAUCAUU, with phosphorothioate modifications in the phosphate backbone between the 1st - 3rd nucleotides at the 5' end and between the 1st - 3rd adjacent nucleotides at the 3' end;

[0974] Preferably, the sequence of the VEGF aptamer is: SEQ ID NO:280: CGGAAUCAGUGAAUGCUUAUACAUCCG, with C and U having 2'-F modifications and A and G having 2'-OMe modifications;

[0975] Preferably, the sequence of the SARS-CoV-2-N48 aptamer is:

[0976] SEQ ID NO:222: GCTGGATGTCGCTTACGACAATATTCCTTAGGGGCACCGCTACATTGACACATCCAGC, with a phosphorothioate modification in the phosphate backbone between the 1st and 2nd nucleotides at the 3' end.

[0977] Drug 74): CpG2006-CD40 aptamer-PD1 aptamer-DNA vector, wherein the DNA vector is the 6th group among the nucleic acid vectors with the aforementioned 26 backbone sequences, CpG2006 is linked to the 5' end of the a sequence through a spacer sequence, the CD40 aptamer is linked to the 5' end of the b sequence through a spacer sequence, and the PD-1 aptamer is linked to the 5' end of the c sequence through a spacer sequence;

[0978] Preferably, the sequence of CpG2006 is:

[0979] SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, with a phosphorothioate modification in the phosphate backbone between adjacent nucleotides;

[0980] Preferably, the sequence of the CD40 aptamer is:

[0981] SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, with a 2'-O-methoxyethyl (MOE) modification at the 2' position of the ribose of the first 4 nucleotides at the 5' end, and a phosphorothioate modification in the phosphate backbone between the first 5 nucleotides at the 5' end;

[0982] Preferably, the sequence of the PD1 aptamer is:

[0983] SEQ ID NO:254: ACCGACAGTGAAGGACTCAGCGAACTCTCAGACTCGGTTC, with a 2'-O-methoxyethyl (MOE) modification at the 2' position of the ribose of the first 4 nucleotides at the 5' end, and a phosphorothioate modification in the phosphate backbone between the first 5 nucleotides at the 5' end.

[0984] Drug 75): CD24 aptamer-CpG2006 variant-CD40 aptamer-PD-L1 aptamer-DNA vector, wherein the DNA vector is the 6th group among the nucleic acid vectors with the aforementioned 26 backbone sequences, the CD24 aptamer is linked to the 5' end of the a sequence through the CpG2006 variant sequence GTCGTT, the CD40 aptamer is linked to the 5' end of the b sequence through the spacer sequence TTTTT, and the PD-L1 aptamer is linked to the 5' end of the c sequence through the spacer sequence TTTTT;

[0985] Preferably, the sequence of the CD24 aptamer is:

[0986] SEQ ID NO:166: TATGTGGGTGGGTGGGCGGTTATGCTGAGTCAGCCTTGCT, with phosphorothioate modification on the phosphate backbone of the first 4 nucleotides at the 5' end;

[0987] Preferably, the sequence of the CD40 aptamer is:

[0988] SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, with phosphorothioate modification on the phosphate backbone between the first 5 nucleotides at the 5' end;

[0989] Preferably, the sequence of the PD-L1 aptamer is:

[0990] SEQ ID NO:238: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGG, with 2'-O-MOE modification on the ribose of the first 6 nucleotides at the 5' end;

[0991] The transition sequence TTTTT is PEG-modified TTTTT.

[0992] Drug 76): HBsAg aptamer - HBV siRNA - miR-34 - PD-L1 aptamer - miR-542 - AS1411 aptamer - DNA vector, wherein the DNA vector is the 24th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The sense strand of HBV siRNA is linked to the 3' end of sequence a. The HBsAg aptamer is connected to the antisense strand of HBV siRNA and is located at the 5' end of the antisense strand of HBV siRNA. The PD-L1 aptamer is linked to the 3' end of sequence b via miR-34. The AS1411 aptamer is linked to the 3' end of sequence c via miR-542;

[0993] Preferably, the sense strand of the HBV siRNA is: SEQ ID NO:88: GGACUUCUCUCAAUUUUCUUU, and the antisense strand is: SEQ ID NO:89: AGAAAAUUGAGAGAAGUCCUU. Among them, C and U in the sense strand and antisense strand of the HBV siRNA have 2'-F modification, and the phosphate backbone between the 1st - 3rd nucleotides at the 3' end has phosphorothioate modification;

[0994] Preferably, the sequence of the HBsAg aptamer is:

[0995] SEQ ID NO:192: CACAGCGAACAGCGGCGGACATAATAGTGCTTACTACGAC, with phosphorothioate modification on the phosphate backbone of the first 4 nucleotides at the 5' end;

[0996] Preferably, the sequence of miR-34 is: TGTGACAG;

[0997] Preferably, the sequence of the PD-L1 aptamer is:

[0998] SEQ ID NO:238: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGG, with a 2'-O-MOE modification on the ribose of the 3rd nucleotide at the 3' end;

[0999] Preferably, the sequence of miR-542 is: TGGCAGTGT;

[1000] Preferably, the sequence of the AS1411 aptamer is:

[1001] SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, with a 2'-O-MOE phosphorothioate modification on the phosphate backbone between the 4th nucleotides at the 3' end.

[1002] Drug 77): IL-4Ra aptamer - TIMC-d aptamer - 4*miR-126 - RNA vector, wherein the RNA vector is the 25th group of the nucleic acid vectors with the aforementioned 26 backbone sequences, the IL-4Ra aptamer is directly linked to the 5' end of the a sequence, the TIMC-d aptamer is directly linked to the 5' end of the b sequence, and 4 miR-126 are tandemly linked to the 5' end of the c sequence,

[1003] The sequence of the IL-4Ra aptamer is:

[1004] SEQ ID NO:203: AAAAAGCAACAGGGUGCUCCAUGCGCAUGGAACCUGCGCG, with a phosphorothioate modification on the phosphate backbone of the first 4 nucleotides at the 5' end;

[1005] The sequence of the TIMC-d aptamer is:

[1006] SEQ ID NO:272: AAGCAACACUUAGUCGCGAUUGAUACGUGCGCAGUCAU, with a phosphorothioate modification on the phosphate backbone of the first 4 nucleotides at the 5' end;

[1007] The sequence of miR-126 is:

[1008] UCGUACC, with a phosphorothioate modification on the phosphate backbone between adjacent nucleotides.

[1009] Drug 78): CD3-4 aptamer - PD-1 aptamer - BCMA aptamer - DNA vector, wherein the DNA vector is the 24th group among the nucleic acid vectors of the aforementioned 26 backbone sequences. The CD3-4 aptamer is connected to the complementary sequence A' of the single-stranded linker sequence A in the a sequence through the spacer sequence TTTTTT, and is connected to the 3'-end of the a sequence through complementary base pairing between the complementary sequence A' and the single-stranded linker sequence A;

[1010] The PD-1 aptamer is connected to the complementary sequence B' of the single-stranded linker sequence B in the b sequence through the spacer sequence TTTTT, and is connected to the 3'-end of the b sequence through complementary base pairing between the complementary sequence B' and the single-stranded linker sequence B;

[1011] The BCMA aptamer is connected to the complementary sequence C' of the single-stranded linker sequence C in the c sequence, and is connected to the 3'-end of the c sequence through complementary base pairing between the complementary sequence C' and the single-stranded linker sequence C;

[1012] The a sequence is:

[1013] SEQ ID NO:15: GACGCCCACGAGCGTTCCGGGAGAGG TGTAGCACGGTGGC, Among them, the underlined part is the single-stranded linker sequence A;

[1014] Preferably, the sequence of the CD3-4 aptamer - spacer sequence - complementary sequence A' of the single-stranded linker sequence A is:

[1015] SEQ ID NO:306: TCTCGGACGCGTGTGGTCGGCCGAGTGGCCCACGGTAGAAGGGTTAGAACTGCTGGTTGGTGAATCTCGCTGCCTGGCCCTAGAGTGTTTTTT GCCACCGTGCTACA;

[1016] The b sequence in the DNA vector is:

[1017] SEQ ID NO:16: CCTCTCCCGGTTCGCCGCGAGCC TCGGCGCGGCCGTG, Among them, the underlined part is the single-stranded linker sequence B;

[1018] Preferably, the sequence of the PD-1 aptamer - spacer sequence TTTTT - complementary sequence B' of the single-stranded linker sequence B is:

[1019] SEQ ID NO:307: ACCGACAGTGAAGGACTCAGCGAACTCTCAGACTCGGTTCTTTTT CACGGCCGC GCCGA; there is a phosphorothioate modification in the phosphate backbone between the first 5 nucleotides at the 5' end;

[1020] The c sequence is: SEQ ID NO:17: GGCTCGCGGCCATAGCCGTGGGCG TCTGCTGCTGCTGCTG, Among them, the underlined part is the single-stranded linker sequence C;

[1021] Preferably, the complementary sequence C' of the BCMA aptamer - transition sequence U - single-stranded linker sequence C: SEQ ID NO:308: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUACU CAGCA GCAGCAGCA , the underlined part is the complementary sequence C' of the single-stranded linker sequence C, there is a phosphorothioate modification in the phosphate backbone between the last 3 nucleotides at the 3' end, the ribose of the first 4 nucleotides at the 5' end has a 2'-O-MOE modification, and C and U in the remaining nucleotides have a 2'F modification.

[1022] Drug 79): CpG2006 - CD38 aptamer - PD-L1 aptamer - DNA vector; among them, the DNA vector is the 6th group of the nucleic acid vectors with the aforementioned 26 backbone sequences, CpG2006 is connected to the 5' end of the a sequence through the transition sequence TTTTT, the CD38 aptamer is connected to the 5' end of the b sequence through the transition sequence TTTTT, and the PD-L1 aptamer is connected to the 5' end of the c sequence through the transition sequence TTTTT,

[1023] Preferably, CpG2006 - transition sequence TTTTT - a sequence is:

[1024] SEQ ID NO:309: TCGTCGTTTTGTCGTTTTGTCGTTTTTTTGCGACGCCCACGAGCGTTCCGGGAGAGGAGC, the phosphate backbone of adjacent nucleotides of CpG2006 has a phosphorothioate modification;

[1025] Preferably, CD38 aptamer - transition sequence TTTTT - b sequence is:

[1026] SEQ ID NO:310: TACGTGAATCTCGTACGATACTCTGTAAGCGTTTTTTGCTCCTCTCCCGGTTCGCCGCGA GCCGCG, the ribose of the first 3 nucleotides at the 5' end has a 2'-O-MOE modification;

[1027] Preferably, PD-L1 aptamer - transition sequence TTTTT - c sequence is:

[1028] SEQ ID NO:311: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGGTTTTTCGCGGCTCGCGGCC ATAGCCGTGGGCGTCGC. The ribose of the first 6 nucleotides at the 5'-end has a 2'-O-MOE modification.

[1029] Drug 80): CD20 aptamer - CpG - BYZD - CD38 aptamer - miR - 34 - CD3 aptamer - DNA vector; wherein, the DNA vector is the 6th group among the aforementioned 26 nucleic acid vectors with backbone sequences. The CD20 aptamer is linked to the 5'-end of the a sequence through CpG - BYZDAGCGAA. The CD38 aptamer is linked to the 5'-end of the b sequence through miR - 34. The CD3 aptamer is linked to the 5'-end of the c sequence through the spacer sequence TTTTT.

[1030] Preferably, the CD20 aptamer - CpG - BYZD - a sequence is:

[1031] SEQ ID NO:312:TGCGTGTGTAGTGTGTCTGTTTTTTATCTTCTTTTATCTACTCTTAGGGATTTG GGCGG AGC GAAGCGACGCCCACGAGCGTTCCGGGAGAGGAGC, SEQ ID NO:165: TGCGTGTGTAGTGTGTCTGTTTTTTATCTTCTTTTATCTACTCTTAGGGATTTGGGCGG is the CD20 aptamer, AGCGAA is CpG - BYZD, and there is a phosphorothioate modification in the phosphate backbone between the first 4 nucleotides at the 5'-end.

[1032] Preferably, the CD38 aptamer - miR - 34 - b sequence is:

[1033] SEQ ID NO:313:TACGTGAATCTCGTACGATACTCTGTAAGCGT TGTGACAGGCTCCTCTCCCGGTTCGC CGCGAGCCGCG. The ribose of the first 3 nucleotides at the 5'-end has a 2'-O-MOE modification. TGTGACAG is miR - 34. Before TGTGACAG is the CD38 aptamer, and after TGTGACAG is the b sequence.

[1034] Preferably, the CD3 aptamer - spacer sequence TTTTT - c sequence is:

[1035] SEQ ID NO:314: GCCGCGGGGTGGGTCTAGTGTGGATGTTTAGGGGGCGGCTTTTTCGCGGCTCGCGGCC ATAGCCGTGGGCGTCGC, with 2'-O-MOE modification on the ribose of the first 4 nucleotides at the 5' end.

[1036] Drug 81): CpG2006-CD38 aptamer-miR-126-PD-L1 aptamer-DNA vector; wherein, the DNA vector is the 6th group of the nucleic acid vectors of the aforementioned 26 backbone sequences, CpG2006 is connected to the 5' end of the a sequence through the linker sequence TTTTTT, the CD38 aptamer is connected to the 5' end of the b sequence through miR-126, and the PD-L1 aptamer is connected to the 5' end of the c sequence through the linker sequence TTTTTT.

[1037] Preferably, CpG2006-linker sequence TTTTTT-a sequence is:

[1038] SEQ ID NO:309: TCGTCGTTTTGTCGTTTTGTCGTTTTTTTGCGACGCCCACGAGCGTTCCGGGAGAGGA GC, with phosphorothioate modification on the phosphate backbone between adjacent nucleotides of CpG2006, and phosphorothioate modification on the phosphate backbone between the last two nucleotides at the 3' end of the a sequence.

[1039] Preferably, CD38 aptamer-miR-126-b sequence is:

[1040] SEQ ID NO:315: TACGTGAATCTCGTACGATACTCTGTAAGCGT UCGUACCG GCTCCTCTCCCGGTTCGCCG CGAGCCGCG, wherein the sequence of the CD38 aptamer is SEQ ID NO:170: TACGTGAATCTCGTACGATACTCTGTAAGCGT, with 2'-O-MOE modification on the ribose of the first 3 nucleotides at the 5' end; UCGUACCG is the sequence of miR-126, with 2'-O-MOE modification on the ribose of each nucleotide.

[1041] Preferably, PD-L1 aptamer-linker sequence TTTTTT-c sequence is:

[1042] SEQ ID NO:311: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGGTTTTTCGCGGCTCGCGGCCA TAGCCGTGGGCGTCGC. The ribose of the first 6 nucleotides at the 5'-end of the PD-L1 aptamer has 2'-O-MOE modification.

[1043] Drug 82): BCMA aptamer - miR-126 - CD38 aptamer - miR-122 - CD3 aptamer - miR-34 - DNA vector; wherein, the DNA vector is the 6th group of the nucleic acid vectors of the aforementioned 26 backbone sequences. The BCMA aptamer is linked to the 5'-end of the a sequence through miR-126, the CD38 aptamer is linked to the 5'-end of the b sequence through miR-122, and the CD3 aptamer is linked to the 5'-end of the c sequence through miR-34;

[1044] Preferably, BCMA aptamer - miR-126 - a sequence is:

[1045] SEQ ID NO:316: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUACU CGT AC CG GCGACGCCCACGAGCGTTCCGGGAGAGGAGC, wherein CGTACCG is the sequence of miR-126. Before CGTACCG is the sequence of the BCMA aptamer, and after CGTACCG is the a sequence. The ribose of the first 4 nucleotides at the 5'-end of the BCMA aptamer sequence has 2'-O-MOE, and C and U at the remaining positions have 2'F modification;

[1046] Preferably, CD38 aptamer - miR-122 - b sequence is:

[1047] SEQ ID NO:317: TmAmCmGTGAATCTCGTACGATACTCTGTAAGCGT GGAAGTGT GCTCCTCTCCCGGTTC GCCGCGAGCCGCG. The ribose of the first 3 nucleotides at the 5'-end has 2'-O-MOE modification. GGAAGTGT is the sequence of miR-122. Before GGAAGTGT is the sequence of the CD38 aptamer, and after GGAAGTGT is the b sequence,

[1048] Preferably, CD3 aptamer - miR-34 - c sequence is:

[1049] SEQ ID NO:318: AmGmCmCmGCGGGGTGGGTCTAGTGTGGATGTTTAGGGGGCGGCT TGTGACA GCGCGG CTCGCGGCCATAGCCGTGGGCGTCGC. The ribose of the first 4 nucleotides at the 5'-end has a 2'-O-MOE modification. TGTGACA is the sequence of miR-34. The sequence before TGTGACA is the sequence of the CD3 aptamer. The sequence after TGTGACA is the c sequence.

[1050] Drug 83): GPC3 aptamer - AmiR-21 - CD38 aptamer - miR-122 - PD-L1 aptamer - miR-34 - DNA vector; wherein, the DNA vector is the 6th group of the nucleic acid vectors of the aforementioned 26 backbone sequences. The GPC3 aptamer is linked to the 5'-end of the a sequence through AmiR-21. The CD38 aptamer is linked to the 5'-end of the b sequence through miR-122. The PD-L1 aptamer is linked to the 5'-end of the c sequence through miR-34;

[1051] Preferably, GPC3 aptamer - AmiR-21 - a sequence is: SEQ ID NO:319: TAACGCTGACCTTAGCTGCATGGCTTTACATGTTCCA GATAAGCT GCGACGCCCACGAG CGTTCCGGGAGAGGAGC. The phosphate backbone between the first 4 nucleotides at the 5'-end has a thiophosphate modification. GATAAGCT is the sequence of AmiR-21. The sequence before GATAAGCT is the sequence of the GPC3 aptamer. The sequence after GATAAGCT is the a sequence;

[1052] Preferably, CD38 aptamer - miR-122 - b sequence is: SEQ ID NO:317: TACGTGAATCTCGTACGATACTCTGTAAGCGT GGAAGTGT GCTCCTCTCCCGGTTCGCC GCGAGCCGCG. The phosphate backbone between the first 4 nucleotides at the 5'-end has a thiophosphate modification; GGAAGTGT is the sequence of miR-122. The sequence before GGAAGTGT is the sequence of the CD38 aptamer. The sequence after GGAAGTGT is the b sequence;

[1053] Preferably, PD-L1 aptamer - miR-34 - c sequence is: SEQ ID NO:320: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGG TGTGACAGCGCGGCTCGC GGCCATAGCCGTGGGCGTCGC, the ribose of the first 6 nucleotides at the 5'-end has 2'-O-MOE modification; TGTGACAG is the sequence of miR-34, the sequence before TGTGACAG is the sequence of the PD-L1 aptamer, and the sequence after TGTGACAG is the c sequence.

[1054] Drug 84): CpG2006-VEGF165 aptamer-miR-122-PD-L1 aptamer-DNA vector; wherein, the DNA vector is the 6th group of the nucleic acid vectors of the aforementioned 26 backbone sequences, CpG2006 is connected to the 5'-end of the a sequence through the transition sequence TTTTT, the VEGF165 aptamer is connected to the 5'-end of the b sequence through miR-122, and the PD-L1 aptamer is connected to the 5'-end of the c sequence through the transition sequence TTTTT;

[1055] Preferably, CpG2006-transition sequence TTTTT-a sequence is:

[1056] SEQ ID NO:309: TCGTCGTTTTGTCGTTTTGTCGTT TTTTT GCGACGCCCACGAGCGTTCCGGGAGAGGAG C; the phosphate backbone between adjacent nucleotides of CpG2006 has thiophosphate modification;

[1057] Preferably, VEGF165 aptamer-miR-122-b sequence is:

[1058] SEQ ID NO:321: CGGAAUCAGUGAAUGCUUAUACAUCCG GGAAGTGT GCTCCTCTCCCGGTTCGCCGCG AGCCGCG, the ribose of the first 4 nucleotides at the 5'-end has 2'-O-MOE modification, and the C and U in the remaining RNA have 2'F modification; GGAAGTGT is the sequence of miR-122, the sequence before GGAAGTGT is the sequence of the VEGF165 aptamer, and the sequence after GGAAGTGT is the b sequence;

[1059] Preferably, PD-L1 aptamer-transition sequence TTTTT-c sequence is:

[1060] SEQ ID NO:311: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGGTTTTTCGCGGCTCGCGGC CATAGCCGTGGGCGTCGC, the ribose of the first 6 nucleotides at the 5'-end has 2'-O-MOE modification.

[1061] Drug 85): CpG2006-HBsAg aptamer-miR-122-PD-L1 aptamer-DNA vector; wherein, the DNA vector is the 6th group of the nucleic acid vectors with the aforementioned 26 backbone sequences, CpG2006 is linked to the 5' end of the a sequence through the spacer sequence TTTTT, the HBsAg aptamer is linked to the 5' end of the b sequence through miR-122, and the PD-L1 aptamer is linked to the 5' end of the c sequence through the spacer sequence TTTTT;

[1062] Preferably, CpG2006-spacer sequence TTTTT-a sequence is:

[1063] SEQ ID NO:309: TCGTCGTTTTGTCGTTTTGTCGTTTTTTTGCGACGCCCACGAGCGTTCCGGGAGAGGAG C; the phosphate backbone between adjacent nucleotides of CpG2006 has a thiophosphate modification;

[1064] Preferably, HBsAg aptamer-miR-122-b sequence is:

[1065] SEQ ID NO:322: CACAGCGAACAGCGGCGGACATAATAGTGCTTACTACGAC GGAAGTGT GCTCCTCTCCC GGTTCGCCGCGAGCCGCG, the phosphate backbone between the first 4 nucleotides at the 5' end has a thiophosphate modification; GGAAGTGT is the sequence of miR-122, the sequence before GGAAGTGT is the sequence of the HBsAg aptamer, and the sequence after GGAAGTGT is the b sequence;

[1066] Preferably, PD-L1 aptamer-spacer sequence TTTTT-c sequence is:

[1067] SEQ ID NO:311: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGGTTTTTCGCGGCTCGCGGCCA TAGCCGTGGGCGTCGC, the ribose of the first 6 nucleotides at the 5' end has a 2'-O-MOE modification.

[1068] Drug 86): ASO-GSK836-HBsAg aptamer-miR-122-PD-L1 aptamer-DNA vector; wherein, the DNA vector is the 6th group of the nucleic acid vectors with the aforementioned 26 backbone sequences, ASO-GSK836 is linked to the 5' end of the a sequence through the spacer sequence TTTTT, the HBsAg aptamer is linked to the 5' end of the b sequence through miR-122, and the PD-L1 aptamer is linked to the 5' end of the c sequence through the spacer sequence TTTTT;

[1069] Preferably, the ASO-GSK836-spacer sequence TTTTT-a sequence is:

[1070] SEQ ID NO:323: GCAGAGGTGAAGCGAAGTCGTTTTTGCGACGCCCACGAGCGTTCCGGGAGAGGAGC, with phosphorothioate modification on the phosphate backbone between adjacent nucleotides of the first 6 nucleotides at the 5'-end;

[1071] Preferably, the HBsAg aptamer-miR-122-b sequence is:

[1072] SEQ ID NO:322: CACAGCGAACAGCGGCGGACATAATAGTGCTTACTACGAC GGAAGTGT GCTCCTCTCCC GGTTCGCCGCGAGCCGCG, with phosphorothioate modification on the phosphate backbone between the first 4 nucleotides at the 5'-end; GGAAGTGT is the sequence of miR-122, the sequence before GGAAGTGT is the sequence of the HBsAg aptamer, and the sequence after GGAAGTGT is the b sequence;

[1073] Preferably, the PD-L1 aptamer-spacer sequence TTTTT-c sequence is:

[1074] SEQ ID NO:311: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGGTTTTTCGCGGCTCGCGGCCA TAGCCGTGGGCGTCGC, with 2'-O-MOE modification on the ribose of the first 6 nucleotides at the 5'-end.

[1075] Drug 87): BCMA aptamer-CD38 aptamer-miR-126-PD-L1 aptamer-miR-34-DNA vector; wherein, the DNA vector is the 6th group of the nucleic acid vectors with the aforementioned 26 backbone sequences, the BCMA aptamer is directly linked to the 5'-end of the a sequence, the CD38 aptamer is linked to the 5'-end of the b sequence through miR-126, and the PD-L1 aptamer is linked to the 5'-end of the c sequence through miR-34;

[1076] Preferably, the BCMA aptamer-a sequence is:

[1077] SEQ ID NO:324: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUACUUGCGA CGCCCACGAGCGTTCCGGGAGAGGAGC, wherein, SEQ ID NO:140: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUAC is the BCMA aptamer in the form of RNA, all nucleotides of the RNA have 2'-F modification, and the remaining is the a sequence.

[1078] Preferably, the CD38 aptamer - miR - 126 - b sequence is:

[1079] SEQ ID NO:325: TACGTGAATCTCGTACGATACTCTGTAAGCGT GTCGTT GCTCCTCTCCCGGTTCGCCGCG AGCCGCG, the phosphate backbone between the first 4 nucleotides at the 5' end has phosphorothioate modification, GTCGTT is the sequence of miR - 126, the sequence before GTCGTT is the CD38 aptamer, and the sequence after GTCGTT is the b sequence;

[1080] Preferably, the PD - L1 aptamer - miR - 34 - c sequence is:

[1081] SEQ ID NO:320: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGG TGTGACAG CGCGGCTCGCG GCCATAGCCGTGGGCGTCGC, the ribose of the first 6 nucleotides at the 5' end has 2'-O-MOE modification, TGTGACAG is the sequence of miR - 34, the sequence before TGTGACAG is the sequence of the PD - L1 aptamer, and the sequence after TGTGACAG is the c sequence.

[1082] Drug 88): AS1411 aptamer - FGF2 aptamer - 3*AmiR - 21 - DNA vector; the AS1411 aptamer is connected to the 5' end of the a sequence of the DNA vector through the transition sequence TTTTT, the FGF2 aptamer is connected to the 5' end of the b sequence of the DNA vector through the transition base U, and 3 AmiR - 21 are directly connected in series to the 5' end of the c sequence of the DNA vector.

[1083] Preferably, the AS1411 aptamer - transition sequence TTTTT - a sequence is:

[1084] SEQ ID NO:326: GGTGGTGGTGGTTGTGGTGGTGGTGGTTTTTGCGCCCACGAGCGTTCCGGGAGAGC;

[1085] Preferably, the FGF2 aptamer - transition base U - b sequence is: SEQ ID NO:327: GGGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCCCUCCCUGCTCTCCCGGTTCGCCGCCAGCCGCC, where SEQ ID NO:183: GGGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCCC is the FGF2 aptamer in RNA form, and the C and U bases in the RNA have 2'-F modification, and the rest is the b sequence;

[1086] Preferably, the 3*AmiR - 21 - c sequence is:

[1087] SEQ ID NO:328: GATAAGCTGATAAGCTGATAAGCTGGCGGCAGGCGGCCATAGCCGTGGGCGC, GATAAGCT is the sequence of AmiR - 21, and the phosphate backbone of adjacent nucleotides has thiophosphate modification.

[1088] Drug 89): HBsAg aptamer - CD40 aptamer - PD - L1 aptamer - DNA vector, the HBsAg aptamer is connected to the 5' end of the a sequence of the DNA vector through the transition sequence TTTTT, the CD40 aptamer is connected to the 5' end of the b sequence of the DNA vector through the transition sequence TTTTT, and the PD - L1 aptamer is connected to the 5' end of the c sequence of the DNA vector through the transition sequence TTTTT,

[1089] Preferably, the HBsAg aptamer - transition sequence TTTTT - a sequence is:

[1090] SEQ ID NO:329: CACAGCGAACAGCGGCGGACATAATAGTGCTTACTACGAC TTTTT GCGACGCCCACGAGCGTTCCGGGAGAGGAGC, the phosphate backbone of the first 4 nucleotides before the 5' end has thiophosphate modification, the sequence before the transition sequence TTTTT is the HBsAg aptamer sequence, and the sequence after the transition sequence TTTTT is the a sequence;

[1091] Preferably, the CD40 aptamer - transition sequence TTTTT - b sequence is:

[1092] SEQ ID NO:330: CCAACGAGTAGGCGATAGCGCGTGGTTTTT GCTCCTCTCCCGGTTCGCCGCGAGCCGCG, with phosphorothioate modifications on the phosphate backbone between the first 3 nucleotides at the 5'-end and between the first 3 nucleotides at the 3'-end. The sequence before the transition sequence TTTTT is the sequence of the CD40 aptamer, and the sequence after the transition sequence TTTTT is the b sequence;

[1093] Preferably, the PD-L1 aptamer - transition sequence TTTTT - c sequence is:

[1094] SEQ ID NO:331: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT TTTTT CGCGGCTCG CGGCCATAGCCGTGGGCGTCGC, with phosphorothioate modifications on the phosphate backbone between the first 3 nucleotides at the 5'-end and between the first 3 nucleotides at the 3'-end. The sequence before the transition sequence TTTTT is the sequence of the PD-L1 aptamer, and the sequence after the transition sequence TTTTT is the c sequence.

[1095] Drug 90): HBsAg aptamer - CD40 aptamer - PD-L1 aptamer - DNA vector, which is the same as drug 89) except for the different sequence of the PD-L1 aptamer. Among them, the PD-L1 aptamer - transition sequence TTTTT - c sequence is:

[1096] SEQ ID NO:311: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGGTTTTTCGCGGCTCGCGGCC ATAGCCGTGGGCGTCGC, with 2'-O-MOE modification on the ribose of the first 6 nucleotides at the 5'-end. The sequence before the transition sequence TTTTT is the sequence of the PD-L1 aptamer, and the sequence after the transition sequence TTTTT is the c sequence.

[1097] Drug 91): BCMA aptamer - CD38 aptamer - CpG - BYZD - CD19 aptamer - AmiR-21 - DNA vector, among which, the a sequence, b sequence and c sequence of the DNA vector are as follows:

[1098] The a sequence is: SEQ ID NO:15: GACGCCCACGAGCGTTCCGGGAGAGG TGTAGCACGGTGGC, Among them, the underlined part is the single-stranded linker sequence A;

[1099] The b sequence is: SEQ ID NO:16: CCTCTCCCGGTTCGCCGCGAGCC TCGGCGCGGCCGTG, Among them, the underlined part is the single-stranded linker sequence B;

[1100] The c sequence is: SEQ ID NO:17: GGCTCGCGGCCATAGCCGTGGGCGTC TGCTGCTGCTGCTG, Among them, the underlined part is the single-stranded linker sequence C;

[1101] The CD38 aptamer is linked to the complementary sequence A' of the single-stranded linker sequence A through the spacer sequence TT and CpG-BYZD, and the complementary sequence A' is complementary to the single-stranded linker sequence A. Among them, CD38 aptamer-CpG-BYZD-complementary sequence A' is:

[1102] SEQ ID NO:332: TACGTGAATCTCGTACGATACTCTGTAAGCGTTT AGCGAA GCCACCGTGCTACA, where SEQ ID NO:170: TACGTGAATCTCGTACGATACTCTGTAAGCGT is the CD38 aptamer, and the phosphate backbone between the first 4 nucleotides at the 5' end has phosphorothioate modification; SEQ ID NO:8: GCCACCGTGCTACA is the complementary sequence A', TT is the spacer sequence, and AGCGAA is CpG-BYZD;

[1103] The CD19 aptamer is linked to the 5' end of the complementary sequence B' of the single-stranded linker sequence B via AmiR-21, and the complementary sequence B' is complementary to the single-stranded linker sequence B. Among them, CD19 aptamer-AmiR-21-complementary sequence B' is:

[1104] SEQ ID NO:333: UGAGCCCUGUUCGACAGGAGGCUCA GAUAAGCU CACGGCCGCGCCGA, where SEQ ID NO:160: UGAGCCCUGUUCGACAGGAGGCUCA is the sequence of the CD19 aptamer, and C and U bases have 2'-F modification; GAUAAGCU is the sequence of AmiR-21, and C and U have 2'-F modification; SEQ ID NO:10: CACGGCCGCGCCGA is the complementary sequence B';

[1105] The BCMA aptamer is linked to the 5' end of the complementary sequence C' of the single-stranded linker sequence C through the spacer sequence AA, and the complementary sequence C' is complementary to the single-stranded linker sequence C. Among them, BCMA aptamer-spacer sequence AA-complementary sequence C' is:

[1106] SEQ ID NO:334: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUACAA CAGC AGCAGCAGCA, wherein SEQ ID NO:12: CAGCAGCAGCAGCA is the complementary sequence C', and SEQ ID NO:140: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUAC is the sequence of the BCMA aptamer, and the C and U bases in the RNA sequence of the BCMA aptamer have 2'-F modification.

[1107] Drug 92): BCMA aptamer - CD38 aptamer - CD19 aptamer - AmiR - 21 - DNA vector, wherein the a sequence, b sequence, and c sequence of the DNA vector are as follows:

[1108] The a sequence is: SEQ ID NO:15: GACGCCCACGAGCGTTCCGGGAGAGG TGTAGCACGGTGGC, Among them, the underlined part is the single - strand linker sequence A;

[1109] The b sequence is: SEQ ID NO:16: CCTCTCCCGGTTCGCCGCGAGCC TCGGCGCGGCCGTG, Among them, the underlined part is the single - strand linker sequence B;

[1110] The c sequence is: SEQ ID NO:17: GGCTCGCGGCCATAGCCGTGGGCGTC TGCTGCTGCTGCTG, Among them, the underlined part is the single - strand linker sequence C;

[1111] The CD38 aptamer is connected to the complementary sequence A' of the single - strand linker sequence A through the transition sequence TTTTT, and the complementary sequence A' is complementary to the single - strand linker sequence A. Among them, the sequence of CD38 aptamer - transition sequence TTTTT - complementary sequence A' is:

[1112] SEQ ID NO:335: TACGTGAATCTCGTACGATACTCTGTAAGCGT TTTTT GCCACCGTGCTACA, SEQ ID NO:170: TACGTGAATCTCGTACGATACTCTGTAAGCGT is the sequence of the CD38 aptamer, and the phosphate backbone between the first 4 nucleotides at the 5' end has thiophosphate modification; SEQ ID NO:8: GCCACCGTGCTACA is the complementary sequence A' of the single - strand linker sequence A;

[1113] The CD19 aptamer is connected to the complementary sequence B' of the single-stranded linker sequence B through AmiR-21, and the complementary sequence B' is complementary paired with the single-stranded linker sequence B. Among them, the sequence of CD19 aptamer - AmiR-21 - complementary sequence B' is:

[1114] SEQ ID NO:333: UGAGCCCUGUUCGACAGGAGGCUCA GAUAAGCU CACGGCCGCGCCGA, where SEQ ID NO:160: UGAGCCCUGUUCGACAGGAGGCUCA is the sequence of the CD19 aptamer, and C and U have 2'-F modification; GAUAAGCU is the sequence of AmiR-21, and C and U have 2'-F modification; SEQ ID NO:10: CACGGCCGCGCCGA is the complementary sequence B';

[1115] The BCMA aptamer is connected to the 5'-end of the complementary sequence C' of the single-stranded linker sequence C through the transition sequence AA, and the complementary sequence C' is complementary paired with the single-stranded linker sequence C. Among them, BCMA aptamer - transition sequence AA - complementary sequence C' is:

[1116] SEQ ID NO:334: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUAC AA CAGC AGCAGCAGCA, where SEQ ID NO:12: CAGCAGCAGCAGCA is the complementary sequence C', and SEQ ID NO:140: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUAC is the sequence of the BCMA aptamer. In the RNA sequence of the BCMA aptamer, the C and U bases have 2'-F modification.

[1117] Drug 93): CpG2006 - CD38 aptamer - PD-L1 aptamer - DNA vector, where the a sequence, b sequence, and c sequence of the DNA vector are as follows:

[1118] The a sequence is: SEQ ID NO:15: GACGCCCACGAGCGTTCCGGGAGAGG TGTAGCACGGTGGC, Among them, the underlined part is the single-stranded linker sequence A;

[1119] The b sequence is: SEQ ID NO:16: CCTCTCCCGGTTCGCCGCGAGCC TCGGCGCGGCCGTG, Among them, the underlined part is the single-stranded linker sequence B;

[1120] The c sequence is: SEQ ID NO:17: GGCTCGCGGCCATAGCCGTGGGCGTC TGCTGCTGCTGCTG, Among them, the underlined part is the single-stranded linker sequence C;

[1121] The CD38 aptamer is connected to the complementary sequence A' of the single-stranded linker sequence A through the spacer sequence TTTTT. The complementary sequence A' is complementary paired with the single-stranded linker sequence A and connected to the 3' end of the a sequence. Among them, the sequence of CD38 aptamer - spacer sequence TTTTT - complementary sequence A' is:

[1122] SEQ ID NO:335: TACGTGAATCTCGTACGATACTCTGTAAGCGT TTTTT GCCACCGTGCTACA, SEQ ID NO:170: TACGTGAATCTCGTACGATACTCTGTAAGCGT is the sequence of the CD38 aptamer, and the phosphate backbone between the first 4 nucleotides at the 5' end has a thiophosphate modification; SEQ ID NO:8: GCCACCGTGCTACA is the complementary sequence A' of the single-stranded linker sequence A;

[1123] The PD-L1 aptamer is connected to the 5' end of the complementary sequence B' of the single-stranded linker sequence B through the spacer sequence TTTTT. The PD-L1 aptamer is complementary paired with the single-stranded linker sequence B through the complementary sequence B' and connected to the 3' end of the b sequence,

[1124] CpG2006 is connected to the 5' end of the complementary sequence C' of the single-stranded linker C sequence through the spacer sequence TTTTT. CpG2006 is complementary paired with the single-stranded linker C sequence through the complementary sequence C' and connected to the 3' end of the c sequence;

[1125] The sequence of PD-L1 aptamer - spacer sequence TTTTT - complementary sequence B' is: SEQ ID NO:336: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT TTTTT CACGGCCGCG CCGA, and there is a thiophosphate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5' end; among them, SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT is the sequence of the PD-L1 aptamer, and SEQ ID NO:10: CACGGCCGCGCCGA is the complementary sequence B';

[1126] The sequence of CpG2006 - spacer sequence TTTTT - complementary sequence C' is:

[1127] SEQ ID NO:337: TCGTCGTTTTGTCGTTTTGTCGTT TTTTT CAGCAGCAGCAGCA, wherein SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT is the sequence of CpG2006, and there is a phosphorothioate modification in the phosphate backbone between adjacent nucleotides in the sequence of CpG2006; SEQ ID NO:12: CAGCAGCAGCAGCA is the complementary sequence C';

[1128] Drug 94): BCMA aptamer - CD38 aptamer - CpG - BYZD - PD - L1 aptamer - DNA vector, wherein the a sequence, b sequence and c sequence of the DNA vector are as follows:

[1129] The a sequence is: SEQ ID NO:15: GACGCCCACGAGCGTTCCGGGAGAGG TGTAGCACGGTGGC, Wherein, the underlined part is the single - strand linker sequence A;

[1130] The b sequence is: SEQ ID NO:16: CCTCTCCCGGTTCGCCGCGAGCC TCGGCGCGGCCGTG, Wherein, the underlined part is the single - strand linker sequence B;

[1131] The c sequence is: SEQ ID NO:17: GGCTCGCGGCCATAGCCGTGGGCGTC TGCTGCTGCTGCTG, Wherein, the underlined part is the single - strand linker sequence C;

[1132] The CD38 aptamer is connected to the complementary sequence A' of the single - strand linker sequence A through CpG - BYZD, and the complementary sequence A' is complementary - paired and connected to the 3' end of the a sequence. Among them, the sequence of CD38 aptamer - CpG - BYZD - complementary sequence A' is:

[1133] SEQ ID NO:332: TACGTGAATCTCGTACGATACTCTGTAAGCGT TT AGCGAAGCCACCGTGCTACA, SEQ ID NO:170: TACGTGAATCTCGTACGATACTCTGTAAGCGT is the sequence of the CD38 aptamer, and there is a phosphorothioate modification in the phosphate backbone between the first 4 nucleotides at the 5' end; SEQ ID NO:8: GCCACCGTGCTACA is the complementary sequence A' of the single - strand linker sequence A; TT is the transition sequence, and AGCGAA is CpG - BYZD;

[1134] The PD-L1 aptamer is connected to the 5'-end of the complementary sequence B' of the single-stranded linker sequence B through the spacer sequence TTTTT. The PD-L1 aptamer is connected to the 3'-end of the b sequence through complementary base pairing between the complementary sequence B' and the single-stranded linker sequence B.

[1135] The BCMA aptamer is directly connected to the 5'-end of the complementary sequence C' of the single-stranded linker sequence C. The BCMA aptamer is connected to the 3'-end of the c sequence through complementary base pairing between the complementary sequence C' and the single-stranded linker sequence C;

[1136] The sequence of the PD-L1 aptamer - spacer sequence TTTTT - complementary sequence B' is: SEQ ID NO:336: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGTTTTTTCACGGCCGCG CCGA, and there is a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; among them, SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT is the sequence of the PD-L1 aptamer, and SEQ ID NO:10: CACGGCCGCGCCGA is the complementary sequence B'.

[1137] The sequence of the BCMA aptamer - spacer sequence AA - complementary sequence C' is:

[1138] SEQ ID NO:334: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUACAACAGC AGCAGCAGCA, among which, SEQ ID NO:140: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUAC is the BCMA aptamer, and the C and U bases in the RNA sequence of the BCMA aptamer have 2'-F modification; SEQ ID NO:12: CAGCAGCAGCAGCA is the complementary sequence C'.

[1139] Drug 95): BCMA aptamer - CD40 aptamer - PD-L1 aptamer - DNA vector, among which, the a sequence, b sequence and c sequence of the DNA vector are as follows:

[1140] The a sequence is: SEQ ID NO:15: GACGCCCACGAGCGTTCCGGGAGAGG TGTAGCACGGTGGC, Among them, the underlined part is the single-stranded linker sequence A;

[1141] The b sequence is: SEQ ID NO:16: CCTCTCCCGGTTCGCCGCGAGCC TCGGCGCGGCCGTG, Among them, the underlined part is the single-stranded linker sequence B;

[1142] The c sequence is: SEQ ID NO:17: GGCTCGCGGCCATAGCCGTGGGCGTC TGCTGCTGCTGCTG, Among them, the underlined part is the single-stranded linker sequence C;

[1143] The CD40 aptamer is connected to the complementary sequence A' of the single-stranded linker sequence A through the spacer sequence TTTTT. The complementary sequence A' is complementary paired with the single-stranded linker sequence A and connected to the 3'-end of the a sequence. Among them, the sequence of CD40 aptamer - spacer sequence TTTTT - complementary sequence A' is:

[1144] SEQ ID NO:338: GCCAACGAGTAGGCGATAGCGCGTGGC TTTTT GCCACCGTGCTACA, where SEQID NO:156: GCCAACGAGTAGGCGATAGCGCGTGGC is the CD40 aptamer, and the phosphate backbone between the first 4 nucleotides at the 5'-end has a thiophosphate modification; SEQ ID NO:8: GCCACCGTGCTACA is the complementary sequence A'.

[1145] The PD-L1 aptamer is connected to the 5'-end of the complementary sequence B' of the single-stranded linker sequence B through the spacer sequence TTTTT. The PD-L1 aptamer is complementary paired with the single-stranded linker sequence B through the complementary sequence B' and connected to the 3'-end of the b sequence.

[1146] The BCMA aptamer is directly connected to the 5'-end of the complementary sequence C' of the single-stranded linker C sequence. The BCMA aptamer is complementary paired with the single-stranded linker C sequence through the complementary sequence C' and connected to the 3'-end of the c sequence;

[1147] The sequence of PD-L1 aptamer - spacer sequence TTTTT - complementary sequence B' is: SEQ ID NO:336: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT TTTTT CACGGCCGCG CCGA, and there is a thiophosphate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; among them, SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT is the sequence of the PD-L1 aptamer, and SEQ ID NO:10: CACGGCCGCGCCGA is the complementary sequence B';

[1148] The sequence of the BCMA aptamer - spacer sequence AA - complementary sequence C' is as follows:

[1149] SEQ ID NO:334: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUACAACAGC AGCAGCAGCA, wherein SEQ ID NO:140: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUAC is the BCMA aptamer, and the C and U bases in the RNA sequence of the BCMA aptamer have 2'-F modification; SEQ ID NO:12: CAGCAGCAGCAGCA is the complementary sequence C'.

[1150] Drug 96): AmiR - 21 - AS1411 aptamer - CD40 aptamer - 2*biotin - DNA vector, wherein the DNA vector is the 1) group among the nucleic acid vectors of the aforementioned 26 backbone sequences, AmiR - 21 is linked to the 5'-end of the a sequence, the AS1411 aptamer is linked to the 5'-end of the b sequence through the spacer sequence TTTTT, the CD40 aptamer is linked to the 5'-end of the c sequence through the spacer sequence TTTTT, one biotin is modified at the 3'-end of the a sequence, and the other biotin is modified at the 3'-end of the c sequence;

[1151] The sequence of AmiR21 is GATAAGCT, and each nucleotide has locked nucleic acid modification;

[1152] The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG;

[1153] The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG.

[1154] Drug 97): 2*AmiR - 21 - 4*biotin - DNA vector;

[1155] Wherein, the DNA vector is the 11) group among the nucleic acid vectors of the aforementioned 26 backbone sequences, two AmiR21 are directly linked to the 5'-ends of the a sequence and the c sequence respectively, and four biotins are linked to the 3'-end of the a sequence, the 5'-end and 3'-end of the b sequence, and the 3'-end of the c sequence respectively,

[1156] Preferably, the sequence of AmiR - 21 is GATAAGCT, and each position has locked nucleic acid modification.

[1157] Drug 98): TTA1 aptamer-epirubicin-4*biotin-DNA vector;

[1158] The DNA vector is the 13th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. Four AmiR21 are directly linked to the 5' end and 3' end of the a sequence and c sequence respectively. The TTA1 aptamer is linked to the 5' end of the b sequence through a transition sequence. Epirubicin is inserted between the GC adjacent base pairs of the nucleic acid vector in a specific intercalation form;

[1159] Preferably, the sequence of the TTA1 aptamer is:

[1160] SEQ ID NO:265: CCTGCACTTGGCTTGGATTTCAGAAGGGAGACCC.

[1161] Drug 99): TTA1 aptamer-2*Survivin siRNA-DNA vector;

[1162] The DNA vector is the 13th group of the nucleic acid vectors with the aforementioned 26 backbone sequences. The TTA1 aptamer is linked to the 5' end of the b sequence through a transition sequence. The sense strands of two survivin siRNAs are linked to the 3' end of the b sequence and c sequence. The antisense strands of two survivin siRNAs are linked to the 3' end of the b sequence and c strand by complementary base pairing with the sense strands of survivin siRNAs;

[1163] Preferably, the TTA1 aptamer is:

[1164] SEQ ID NO:265: CCTGCACTTGGCTTGGATTTCAGAAGGGAGACCC;

[1165] Preferably, the antisense strand of Survivin siRNA is: SEQ ID NO:300: UGUGACAGAUAAGGAACCUGCAG;

[1166] The sense strand of Survivin siRNA is: SEQ ID NO:100: GCAGGUUCCUUAUCUGUCACAUU; Both the sense strand and antisense strand of Survivin siRNA have phosphorothioate modifications between the 3 adjacent nucleotides before the 5' end and between the 3 adjacent nucleotides at the end of the 3' end.

[1167] Drug 100): CD16a aptamer - CD40 aptamer - CpG2006 - DNA, wherein the DNA carrier is the 6th group in the aforementioned nucleic acid carriers. The CD16a aptamer is connected to the 5' end of the a sequence through a linker sequence, the CD40 aptamer is connected to the 3' end of the b sequence through a linker sequence, and CpG2006 is connected to the 5' end of the c sequence through a linker sequence;

[1168] Preferably, the sequence of the CD16a aptamer is SEQ ID NO:157:

[1169] CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, with the 1st - 3rd phosphate backbones at the 5' end being thiophosphate - modified;

[1170] Preferably, the sequence of the CD40 aptamer is SEQ ID NO:154:

[1171] CCAACGAGTAGGCGATAGCGCGTGG, with the 1st - 3rd phosphate backbones at the 5' end being thiophosphate - modified;

[1172] Preferably, the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, with the phosphate backbones between adjacent nucleotides all being thiophosphate - modified;

[1173] Preferably, the linker sequence is TTTTT.

[1174] In the third typical embodiment of the present application, a pharmaceutical composition is provided, comprising any one or more of the above - mentioned nucleic acid drugs, and optionally a pharmaceutically acceptable carrier and / or excipient.

[1175] Furthermore, at least one drug in the pharmaceutical composition is selected from the nucleic acid drugs of claim 12, and the pharmaceutical composition is selected from any of the following combinations;

[1176] Combination 1): Drug 2) + Drug 21);

[1177] Combination 2): Drug 6) + Drug 26);

[1178] Combination 3): Drug 6) + OX40 aptamer in RNA form;

[1179] Combination 4): Drug 3) + Drug 26);

[1180] Combination 5): Drug 3) + Drug 21) + OX40 aptamer in DNA form;

[1181] Combination 6): Drug 4) + Drug 21) + OX40 aptamer in DNA form;

[1182] Combination 7): Drug 4) + Drug 21);

[1183] Combination 8): Drug 3) + Drug 23);

[1184] Combination 9): Drug 4) + Drug 23);

[1185] Combination 10): Drug 3) + Drug 24) + OX40 aptamer in DNA form;

[1186] Combination 11): Drug 3) + Drug 41);

[1187] Combination 12): Drug 5) + Drug 41);

[1188] Combination 13): Drug 5) + Drug 96);

[1189] Combination 14): Drug 96) + Drug 41);

[1190] Combination 15): Drug 3) + Drug 97) + OX40 aptamer in DNA form;

[1191] Combination 16): Drug 4) + Drug 20) + OX40 aptamer in DNA form;

[1192] Combination 17): Drug 4) + Drug 20);

[1193] Combination 18): Drug 7) + Drug 25) + OX40 aptamer in DNA form;

[1194] Combination 19): Drug 1) + Drug 18) + Drug 98);

[1195] Combination 20): Drug 1) + Drug 18) + OX40 aptamer in DNA form + Drug 99); Combination 21): Drug 3) + Drug 18) + OX40 aptamer in DNA form;

[1196] Combination 22): Drug 3) + Drug 18);

[1197] Combination 23): Drug 3) + OX40 aptamer in DNA form;

[1198] Combination 24): Drug 3) + Drug 18) + OX40 aptamer in locked nucleic acid form;

[1199] Combination 25): Drug 3) + Drug 18) + OX40 aptamer in RNA form;

[1200] Combination 26): Drug 3) + Drug 18) + CD40 aptamer in DNA form Combination 27): Drug 3) + Drug 20) + CD40 aptamer in DNA form;

[1201] Combination 28): Drug 4) + Drug 19) + CD40 aptamer in the form of DNA;

[1202] Among them, the sequence of the OX40 aptamer in the form of DNA is:

[1203] SEQ ID NO:227: CAGTCTGCATCGTAGGATTAGCCACCGUATCTTTCCCAC;

[1204] The sequence of the OX40 aptamer in the form of RNA is:

[1205] SEQ ID NO:226: GGGAGGACGAUGCGGCAGUCUGCAUCGUAGGAAUCGCCACCGUAUACUUUCCCACCA GACGACUCGCUGAGGAUCCGAGA;

[1206] The locked nucleic acid form of the OX40 aptamer has locked nucleic acid modifications at the first 5 nucleotides at the 5' end and the first 4 nucleotides at the 3' end in the sequence of the OX40 aptamer in the form of DNA.

[1207] In the fourth typical embodiment of the present application, there is provided an application of any one of the foregoing nucleic acid carriers, any one of the nucleic acid drugs or any one of the pharmaceutical compositions in the preparation of a drug for treating tumors, liver diseases other than liver cancer or diseases caused by coronavirus infection.

[1208] Furthermore, the liver diseases other than liver cancer are hepatitis B or hepatitis C; the diseases caused by coronavirus infection include COVID-19; the tumors are male tumors, female tumors, respiratory tumors, digestive tumors, hematological tumors, urinary tumors, bone marrow tumors, neurological tumors, dermatological tumors, general surgical tumors or otolaryngological tumors; preferably, the male tumors are prostate cancer, penile cancer, testicular tumors or male urethral cancer, the female tumors are ovarian cancer, cervical cancer, endometrial cancer, uterine fibroids, vulvar cancer or malignant mole, the respiratory tumors are lung cancer, non-small cell lung cancer, small cell lung cancer, nasopharyngeal cancer, tracheal tumors, lung metastases, inflammatory pseudotumor of the lung or radiation-induced lung cancer, the digestive tumors are liver cancer, gastric cancer, colorectal cancer, gallbladder cancer, esophageal cancer, rectal cancer, pancreatic cancer or colon cancer, the hematological tumors are leukemia, lymphoma, lymphosarcoma or multiple myeloma, kidney cancer, bladder cancer or urinary cancer, the bone marrow tumors are giant cell tumor of bone, osteochondroma or osteosarcoma, the neurological tumors are brain tumors, meningiomas, tuberculomas of the brain, pituitary tumors, neuroblastomas, glioblastoma multiforme or gliomas, the dermatological tumors are skin cancer or melanoma, the general surgical tumors are breast cancer, lipoma, thyroid cancer or thyroid tumors, and the otolaryngological tumors are oral cancer, tongue cancer, laryngeal cancer, middle ear cancer, gingival cancer or intraorbital tumor.

[1209] Further, in the application process, the drug administration method is intratumoral administration, intravenous administration or intraperitoneal administration.

[1210] Further, in the application process, the daily drug dosage is 0.1 μg / Kg to 100 mg / Kg.

[1211] In the fifth typical embodiment of the present application, a preparation method of any of the foregoing nucleic acid drugs is provided. The preparation method includes obtaining a nucleic acid drug by self-assembling at least one oligonucleotide effector molecule carried on a nucleic acid carrier containing sequence a, sequence b, and sequence c through at least one strand; wherein, the oligonucleotide effector molecule is selected from at least one of the following: nucleic acid immune stimulant, nucleic acid aptamer, siRNA, miRNA, and ASO.

[1212] Further, the nucleic acid drug is obtained by self-assembling through 2-8 strands, preferably 3-6 strands.

[1213] Further, when self-assembling through more than 3 strands, the preparation method includes: providing the following 3 sequences, modified or unmodified, for self-assembling to form a nucleic acid carrier: sequence a, sequence b, and sequence c, and the modification means being modified by a chemical small molecule with a targeting effect; attaching the sequence of at least one oligonucleotide effector molecule to the 5' end and / or 3' end of at least one of the sequences a, b, and c of the nucleic acid carrier by sequence complementarity; wherein, the oligonucleotide effector molecule is selected from at least one of the following: nucleic acid immune stimulant, nucleic acid aptamer, siRNA, miRNA, and ASO.

[1214] Further, when the oligonucleotide effector molecule includes siRNA, the sense strand of the siRNA is synthesized at the 5' end and / or 3' end of at least one of the modified or unmodified sequences a, b, and c, and the antisense strand of the siRNA is self-assembled together with the modified or unmodified sequences a, b, and c, so that the siRNA is linked to the nucleic acid carrier by complementary base pairing between the antisense strand and the sense strand of the siRNA; preferably, the sense strand of the siRNA is directly synthesized at the 5' end and / or 3' end of at least one of the sequences a, b, and c through a linker sequence; preferably, the linker sequence is selected from 2-8, preferably 3-6 consecutive T, A, or U.

[1215] Furthermore, the oligonucleotide effector molecule includes miRNA and / or nucleic acid immune stimulant. miRNA is directly synthesized and / or the nucleic acid immune stimulant is synthesized through a transition sequence at the 5'-end and / or 3'-end of at least one of the modified or unmodified a sequence, b sequence, and c sequence, and the miRNA and / or nucleic acid immune stimulant is mounted on the nucleic acid carrier through self-assembly of the modified or unmodified a sequence, b sequence, and c sequence; preferably, the transition sequence is selected from 2 to 8, preferably 3 to 6 consecutive Ts or As.

[1216] Furthermore, the oligonucleotide effector molecule includes an aptamer. The aptamer is synthesized at the 5'-end and / or 3'-end of at least one of the modified or unmodified a sequence, b sequence, and c sequence, and the aptamer is mounted on the nucleic acid carrier through self-assembly of the modified or unmodified a sequence, b sequence, and c sequence; preferably, the aptamer is directly synthesized at the 5'-end and / or 3'-end of at least one of the a sequence, b sequence, and c sequence through a transition sequence; preferably, the transition sequence is selected from 2 to 8, preferably 3 to 6 consecutive Ts or As.

[1217] Furthermore, when the oligonucleotide effector molecule further includes a nucleic acid immune stimulant and / or an aptamer on the basis of including siRNA, the nucleic acid immune stimulant is synthesized through a transition sequence at the 5'-end and / or 3'-end of at least one of the modified or unmodified a sequence, b sequence, and c sequence, and at a position different from one end of the siRNA sense strand, and / or the aptamer is synthesized through a transition sequence at the 5'-end of the siRNA antisense strand to obtain an aptamer-siRNA fragment; the aptamer-siRNA fragment is co-incubated with the modified or unmodified a sequence, b sequence, and c sequence synthesized with the nucleic acid immune stimulant for self-assembly, so that the aptamer is mounted on the nucleic acid carrier through complementarity between the antisense strand and the sense strand of the siRNA.

[1218] Furthermore, when the oligonucleotide effector molecule includes miRNA and an aptamer, the aptamer is synthesized at the 5'-end or 3'-end of the miRNA to obtain an aptamer-miRNA fusion single-stranded sequence; the aptamer-miRNA fusion single-stranded sequence participates in self-assembly, so that the aptamer and miRNA are mounted on the nucleic acid carrier.

[1219] Furthermore, when the oligonucleotide effector molecule includes a nucleic acid immune stimulant and an aptamer, the nucleic acid immune stimulant and the aptamer are independently synthesized at any end of at least one of the modified or unmodified a sequence, b sequence, and c sequence to obtain a nucleic acid immune stimulant and / or aptamer fusion sequence, and the nucleic acid immune stimulant and / or aptamer fusion sequence participates in self-assembly, so that the aptamer and the nucleic acid immune stimulant are mounted on the nucleic acid carrier.

[1220] Furthermore, the a sequence, b sequence, and c sequence each include a vector backbone sequence and a single-stranded adhesion bridge sequence, and one or more oligonucleotide effector molecules self-assemble with the a sequence, b sequence, and c sequence through complementary sequences of the single-stranded adhesion bridge sequence to form a nucleic acid drug; preferably, the a sequence, b sequence, and c sequence are as follows:

[1221] The a sequence is: SEQ ID NO:15: GACGCCCACGAGCGTTCCGGGAGAGG TGTAGCACGGTGGC, Among them, the underlined part is the single-stranded linker sequence A;

[1222] The b sequence is: SEQ ID NO:16: CCTCTCCCGGTTCGCCGCGAGCC TCGGCGCGGCCGTG, Among them, the underlined part is the single-stranded linker sequence B;

[1223] The c sequence is: SEQ ID NO:17: GGCTCGCGGCCATAGCCGTGGGCGTC TGCTGCTGCTGCTG, Among them, the underlined part is the single-stranded linker sequence C.

[1224] Furthermore, the nucleic acid drug is CpG2006-CD40 aptamer-PD-L1 aptamer-DNA vector, and the preparation method includes any one of the following self-assembly methods;

[1225] 1) Self-assembly of three strands, where the three strands are respectively:

[1226] CpG2006-a sequence:

[1227] SEQ ID NO:309: TCGTCGTTTTGTCGTTTTGTCGTT TTTTT GCGACGCCCACGAGCGTTCCGGGAGAGGAG C, with a phosphorothioate modification on the phosphate backbone between the 1st and 24th adjacent nucleotides at the 5' end, TTTTT is a transition sequence, the sequence before TTTTT is the CpG2006 sequence, and the sequence after TTTTT is the a sequence;

[1228] CD40 aptamer-b sequence:

[1229] SEQ ID NO:330: CCAACGAGTAGGCGATAGCGCGTGGTTTTTGCTCCTCTCCCGGTTCGCCGCGAGCCGCG, with a phosphorothioate modification on the phosphate backbone between the 1st and 5th adjacent nucleotides at the 5' end, TTTTT is a transition sequence, the sequence before TTTTT is the CD40 aptamer sequence, and the sequence after TTTTT is the b sequence; and

[1230] PD-L1 aptamer-c sequence:

[1231] SEQ ID NO:331: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGTTTTTTCGCGGCTCGC GGCCATAGCCGTGGGCGTCGC. There is a phosphorothioate modification on the phosphate backbone between the 1st and 5th adjacent nucleotides at the 5'-end. TTTTT is a transition sequence. The sequence before TTTTT is the sequence of the PD-L1 aptamer, and the sequence after TTTTT is the c sequence;

[1232] 2) Self-assembly of 4 strands, where the 4 strands are respectively:

[1233] CpG2006-a sequence:

[1234] SEQ ID NO:309: TCGTCGTTTTGTCGTTTTGTCGTTTTTTTGCGACGCCCACGAGCGTTCCGGGAGAGGAG C. There is a phosphorothioate modification on the phosphate backbone between the 1st and 24th adjacent nucleotides at the 5'-end. TTTTT is a transition sequence. The sequence before TTTTT is the sequence of CpG2006, and the sequence after TTTTT is the a sequence;

[1235] CD40 aptamer-b sequence:

[1236] SEQ ID NO:339: CCAACGAGTAGGCGATAGCGCGTGGTTTGCTCCTCTCCCGGTTCGCCGCGAGCCTCGGC GCGGCCGTG. There is a phosphorothioate modification on the phosphate backbone between the 1st and 4th adjacent nucleotides at the 5'-end. TTT is a transition sequence. The sequence before TTT is the sequence of the CD40 aptamer, and the sequence after TTT is the b sequence;

[1237] Complementary sequence B' of the PD-L1 aptamer-transition sequence-single-stranded linker sequence B:

[1238] SEQ ID NO:336: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGTTTTTTCACGGCCGCG CCGA. There is a phosphorothioate modification on the phosphate backbone between the 1st and 4th adjacent nucleotides at the 5'-end. TTTTT is a transition sequence. The sequence before TTTTT is the sequence of the PD-L1 aptamer, and the sequence after TTTTT is the complementary sequence B'; and

[1239] c sequence:

[1240] SEQ ID NO:340: GGCTCGCGGCCATAGCCGTGGGCGTCGC;

[1241] or

[1242] The four strands are respectively:

[1243] CpG2006 - transition sequence - complementary sequence C' of single - strand linker sequence C:

[1244] SEQ ID NO:341: TCGTCGTTTTGTCGTTTTGTCGTTTTTTTTCAGCAGCAGCAGCA, with a phosphorothioate modification on the phosphate backbone between the 1st and 24th adjacent nucleotides at the 5' end, TTTTT is the transition sequence, the sequence before TTTTT is the sequence of CpG2006, and the sequence after TTTTT is the complementary sequence C';

[1245] Sequence a: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC;

[1246] CD40 aptamer - sequence b:

[1247] SEQ ID NO:339: CCAACGAGTAGGCGATAGCGCGTGGTTTGCTCCTCTCCCGGTTCGCCGCGAGCCTCGGC GCGGCCGTG, with a phosphorothioate modification on the phosphate backbone between the 1st and 4th adjacent nucleotides at the 5' end, TTT is the transition sequence, the sequence before TTT is the sequence of the CD40 aptamer, and the sequence after TTT is sequence b;

[1248] PD - L1 aptamer - sequence c:

[1249] SEQ ID NO:342: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGTTTTTTGGCTCGCGGC CATAGCCGTGGGCGTCGC, with a phosphorothioate modification on the phosphate backbone between the 1st and 4th adjacent nucleotides at the 5' end, TTTTT is the transition sequence, the sequence before TTTTT is the sequence of the PD - L1 aptamer, and the sequence after TTTTT is sequence c;

[1250] 3) Self - assembly of five strands, where the five strands are respectively:

[1251] Sequence a: SEQ ID NO:15: GACGCCCACGAGCGTTCCGGGAGAGGTGTAGCACGGTGGC; CD40 aptamer - transition sequence - sequence b:

[1252] SEQ ID NO:339: CCAACGAGTAGGCGATAGCGCGTGGTTTGCTCCTCTCCCGGTTCGCCGCGAGCCTCGGC GCGGCCGTG. There is a phosphorothioate modification on the phosphate backbone between the 1st and 4th adjacent nucleotides at the 5'-end. TTT is the transition sequence. The sequence before TTT is the CD40 aptamer sequence, and the sequence after TTT is the b sequence;

[1253] Complementary sequence B' of the PD-L1 aptamer - transition sequence - single-stranded linker sequence B:

[1254] SEQ ID NO:336: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGTTTTTTCACGGCCGCG CCGA. There is a phosphorothioate modification on the phosphate backbone between the 1st and 4th adjacent nucleotides at the 5'-end. TTTTT is the transition sequence. The sequence before TTTTT is the PD-L1 aptamer sequence, and the sequence after TTTTT is the complementary sequence B';

[1255] CpG2006 sequence - transition sequence - complementary sequence C' of single-stranded linker sequence C:

[1256] SEQ ID NO:337: TCGTCGTTTTGTCGTTTTGTCGTT TTTTT CAGCAGCAGCAGCA. There is a phosphorothioate modification on the phosphate backbone between the 1st and 24th adjacent nucleotides at the 5'-end. TTTTT is the transition sequence. The sequence before TTTTT is the CpG2006 sequence, and the sequence after TTTTT is the complementary sequence C';

[1257] c sequence: SEQ ID NO:17: GGCTCGCGGCCATAGCCGTGGGCGTCTGCTGCTGCTGCTG;

[1258] Or the five strands are respectively:

[1259] CpG2006 - transition sequence - a sequence:

[1260] SEQ ID NO:343: TCGTCGTTTTGTCGTTTTGTCGTTTTTTTGACGCCCACGAGCGTTCCGGGAGAGGTGTAG CACGGTGGC. There is a phosphorothioate modification on the phosphate backbone between the 1st and 24th adjacent nucleotides at the 5'-end. TTTTT is the transition sequence. The sequence before TTTTT is the CpG2006 sequence, and the sequence after TTTTT is the a sequence;

[1261] Complementary sequence A' of CD40 aptamer - transition sequence - single - strand linker sequence A:

[1262] SEQ ID NO:338: GCCAACGAGTAGGCGATAGCGCGTGGCTTTTTGCCACCGTGCTACA, with phosphorothioate modification on the phosphate backbone between the 1st - 4th adjacent nucleotides at the 5' end. TTTTT is the transition sequence. The sequence before TTTTT is the sequence of the CD40 aptamer, and the sequence after TTTTT is the complementary sequence A';

[1263] Sequence b: SEQ ID NO:16: CCTCTCCCGGTTCGCCGCGAGCCTCGGCGCGGCCGTG;

[1264] Complementary sequence B' of PD - L1 aptamer - transition sequence - single - strand linker sequence B:

[1265] SEQ ID NO:336: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGTTTTTTCACGGCCGCG CCGA, with phosphorothioate modification on the phosphate backbone between the 1st - 4th adjacent nucleotides at the 5' end. TTTTT is the transition sequence. The sequence before TTTTT is the sequence of the PD - L1 aptamer, and the sequence after TTTTT is the complementary sequence B';

[1266] Sequence c: SEQ ID NO:340: GGCTCGCGGCCATAGCCGTGGGCGTCGC;

[1267] 4) Self - assembly of 6 strands, where the 6 strands are respectively:

[1268] Sequence a: SEQ ID NO:15: GACGCCCACGAGCGTTCCGGGAGAGGTGTAGCACGGTGGC;

[1269] Sequence b: SEQ ID NO:16: CCTCTCCCGGTTCGCCGCGAGCCTCGGCGCGGCCGTG;

[1270] Sequence c: SEQ ID NO:17: GGCTCGCGGCCATAGCCGTGGGCGTCTGCTGCTGCTGCTG;

[1271] Complementary sequence C' of CpG2006 - transition sequence - single - strand linker sequence C:

[1272] SEQ ID NO:337: TCGTCGTTTTGTCGTTTTGTCGTTTTTTTCAGCAGCAGCAGCA; There is a phosphorothioate modification on the phosphate backbone between the 1st and 24th adjacent nucleotides at the 5'-end. TTTTT is the transition sequence. The sequence before TTTTT is the sequence of CpG2006, and the sequence after TTTTT is the complementary sequence C'.

[1273] Complementary sequence A' of CD40 aptamer - transition sequence - single-stranded linker sequence A: SEQ ID NO:338: GCCAACGAGTAGGCGATAGCGCGTGGCTTTTTGCCACCGTGCTACA; There is a phosphorothioate modification on the phosphate backbone between the 1st and 4th adjacent nucleotides at the 5'-end. TTTTT is the transition sequence. The sequence before TTTTT is the sequence of the CD40 aptamer, and the sequence after TTTTT is the complementary sequence A'.

[1274] Complementary sequence B' of PD-L1 aptamer - transition sequence - single-stranded linker sequence B:

[1275] SEQ ID NO:336: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGTTTTTTCACGGCCGCG CCGA; There is a phosphorothioate modification on the phosphate backbone between the 1st and 4th adjacent nucleotides at the 5'-end. TTTTT is the transition sequence. The sequence before TTTTT is the sequence of the PD-L1 aptamer, and the sequence after TTTTT is the complementary sequence B'.

[1276] Further, the self-assembly steps include: dissolving the modified or unmodified a sequence, b sequence, c sequence with at least one oligonucleotide effector molecule and the sequence of the optionally separately synthesized oligonucleotide effector molecule in an assembly solution, and successively performing a denaturation reaction and a renaturation reaction to form a self-assembly crude product; successively purifying, eluting and drying the self-assembly crude product to obtain a targeted nucleic acid carrier with at least one oligonucleotide effector molecule; preferably, the molar ratio between the a sequence, b sequence and c sequence is 0.90 to 1.10:0.90 to 1.10:0.90 to 1.10, more preferably 1:1:1; preferably, the assembly solution is an aqueous solution of TMS, an aqueous solution of sodium chloride, an aqueous solution of magnesium chloride or purified water; preferably, the temperature of the denaturation reaction is 80 to 99 °C, more preferably 85 to 99 °C, further preferably 90 to 99 °C; preferably, after the denaturation reaction is completed, the reaction system is cooled to the renaturation temperature for the renaturation reaction, and finally cooled to obtain the self-assembly crude product; wherein the holding temperature is 70 to 50 °C, more preferably 65 to 55 °C, further preferably 63 to 57 °C; the time of the renaturation reaction is 3 to 15 min, more preferably 3 to 10 min, further preferably 3 to 5 min; preferably, during the process of cooling the reaction system to the holding temperature, the cooling rate is 2 to 10 °C / min, more preferably 2 to 6 °C / min, further preferably 2 to 3 °C / min; preferably, the end temperature of the cooling is 0 to 25 °C, more preferably 0 to 15 °C, further preferably 0 to 4 °C; preferably, the pH value of the denaturation reaction is 5.4 to 8.8.

[1277] Applying the technical solution of the present application, using the nucleic acid nanoparticles self-assembled with the core sequences listed in the present application as the delivery carrier of oligonucleotide drugs, compared with the LNP and PNP in the prior art, since both the carrier itself and the delivered drug are nucleotide sequences, the compatibility with oligonucleotide drugs in physical and chemical properties is stronger, which is convenient to mount different types of small nucleic acid molecules according to the different carrier sequence structures or their lengths, and utilize the binding advantage of base complementary pairing, not only improving the delivery efficiency, but also making the delivery system more stable. In addition, the preparation process of the nucleic acid carrier is also simpler and more efficient. BRIEF DESCRIPTION OF THE DRAWINGS

[1278] The specification drawings forming a part of the present application are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation to the present invention. In the drawings:

[1279] Figures 1-1 to 1-4 Shows the HPLC chromatogram detection of the sequence assembly product in Example 1, wherein, Figure 1-1 is the HPLC chromatogram detection of C1, Figure 1-2 is the HPLC chromatogram detection of C2, Figure 1-3HPLC chromatogram of D1, Figure 1-4 HPLC chromatogram of D2;

[1280] Figure 2 shows the agarose gel electrophoresis detection diagram of the self-assembled product of 3*CPG2006-DNA vector in Example 2;

[1281] Figure 3 shows the agarose gel electrophoresis detection diagram of the self-assembled product of 2*CpG1826-2*mannose-DNA vector in Example 3;

[1282] Figure 4 shows the agarose gel electrophoresis detection diagram of the self-assembled product of 2*CpG1826-CD40 aptamer-DNA vector in Example 4;

[1283] Figure 5-1 shows the agarose gel electrophoresis detection diagram of the self-assembled product of 2*CpG2006-CD40 aptamer-DNA vector in Example 5;

[1284] Figure 5-2 shows the HPLC chromatogram of the self-assembled product of 2*CpG2006-CD40 aptamer-DNA vector in Example 5;

[1285] Figure 5-3 shows the melting peak and melting curve diagram of 2*CpG2006-CD40 aptamer-DNA vector in Example 5;

[1286] Figure 5-4 shows the agarose gel electrophoresis detection diagram of the serum stability test of 2*CpG2006-CD40 aptamer-DNA vector in Example 5;

[1287] Figure 6 shows the agarose gel electrophoresis detection diagram of the self-assembled product of 4*CpG2006-CD40 aptamer-DNA vector in Example 6;

[1288] Figure 7 shows the agarose gel electrophoresis detection diagram of the self-assembled product of 2*CpG1826-CD40 aptamer-2*mannose-DNA vector in Example 7;

[1289] Figure 8 shows the agarose gel electrophoresis detection diagram of the self-assembled product of CPG1826-CD40 aptamer-mannose-MUC1 aptamer-DNA vector in Example 8;

[1290] Figure 9Shows the agarose gel electrophoresis detection diagram of the self-assembled product of 2*CpG2006-CD40 aptamer-AmiR-21-3*mannose-DNA carrier in Example 9;

[1291] Figure 10 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of 2*CPG2006-CD40 aptamer-CD16a aptamer-CTLA-4 aptamer-DNA carrier in Example 10;

[1292] Figure 11 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of 2*CPG2006-CTLA-4 aptamer-PD-L1 aptamer-DNA in Example 11;

[1293] Figure 12-1 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of CCPD3 in Example 12;

[1294] Figure 12-2 Shows the HPLC chromatogram detection diagram of the self-assembled product of CCPD3 in Example 12;

[1295] Figure 12-3 Shows the melting peak and melting curve diagram of the self-assembled product of CCPD3 in Example 12;

[1296] Figure 13-1 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of CCPD3 deformation 1 in Example 13;

[1297] Figure 13-2 Shows the HPLC chromatogram detection diagram of the self-assembled product of CCPD3 deformation 1 in Example 13;

[1298] Figure 13-3 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of CCPD3 deformation 2 in Example 13;

[1299] Figure 13-4 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of CCPD3 deformation 3 in Example 13;

[1300] Figure 13-5 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of CCPD3 deformation 4 in Example 13;

[1301] Figure 13-6 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of CCPD3 deformation 5 in Example 13;

[1302] Figure 13-7 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of CCPD3 deformation 6 in Example 13;

[1303] Figure 13-8 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of CCPD3 variant 7 in Example 13;

[1304] Figure 13-9 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of CCPD3 variant 8 in Example 13;

[1305] Figure 13-10 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of CCPD3 variant 9 in Example 13;

[1306] Figure 13-11 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of CCPD3 variant 10 in Example 13;

[1307] Figure 13-12 Shows the HPLC chromatogram detection diagram of the self-assembled product of CCPD3 variant 11 in Example 13;

[1308] Figure 13-13 Shows the HPLC chromatogram detection diagram of the self-assembled product of CCPD3 variant 12 in Example 13;

[1309] Figure 14-1 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of 2*CpG2006-CD40-aptamer PD-L1 aptamer-C12 aptamer-DNA vector in Example 14;

[1310] Figure 14-2 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of 2*AmiR21-TTA1 aptamer-DNA vector in Example 14;

[1311] Figure 14-3 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of 2*AmiR-21-3*Bio-DNA vector in Example 14;

[1312] Figure 14-4 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of 2*AmiR-21-4*Bio-DNA vector in Example 14;

[1313] Figure 14-5 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of 2*AmiR-21-AS1411 aptamer-DNA vector in Example 14;

[1314] Figure 14-6 Shows the agarose gel electrophoresis detection diagram of the enhanced self-assembled product of 2*AmiR-21-AS1411 aptamer-DNA vector in Example 14;

[1315] Figure 14-7Shows the agarose gel electrophoresis detection diagram of the self-assembled product of 2*AmiR-21-AS1411 aptamer-Bio-DNA vector in Example 14;

[1316] Figure 14-8 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of 2*AmiR-21-CD40 aptamer-DNA vector in Example 14;

[1317] Figure 14-9 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of 2*AmiR-21-MUC1 aptamer-3*Bio-DNA vector in Example 14;

[1318] Figure 14-10 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of 2*mannose-2*AmiR-21-DNA vector in Example 14;

[1319] Figure 14-11 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of 2*mannose-A15 aptamer-2*AmiR-21-DNA vector in Example 14;

[1320] Figure 14-12 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of 2*mannose-survivin siRNA-DNA vector in Example 14;

[1321] Figure 14-13 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of 2*mannose-A15 aptamer-survivin siRNA-AmiR-21-DNA vector in Example 14;

[1322] Figure 14-14 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of AS1411 aptamer-Survivin siRNA-PSMA aptamer-3*AmiR-21-RNA vector in Example 14;

[1323] Figure 14-15A Shows the agarose gel electrophoresis detection diagram of the self-assembled product of 3*AmiR-21-AS1411 aptamer-FAP aptamer-DNA vector in Example 14, Figure 14-15B Shows the HPLC chromatogram detection diagram;

[1324] Figure 14-16 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of 3*AmiR-21-AS1411 aptamer-CD40 aptamer-2*Bio-DNA vector in Example 14;

[1325] Figure 14-17Shows the agarose gel electrophoresis detection diagram of the self-assembled product of TAP siRNA-3*AmiR-21-2*AS1411-1 aptamer-DNA vector in Example 14;

[1326] Figure 14-18 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of CPG1826-CD40 aptamer-AmiR-21-3*Bio-DNA vector in Example 14;

[1327] Figure 14-19 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of CD16a aptamer-CTLA-4 aptamer-PD-L1 aptamer-DNA vector in Example 14;

[1328] Figure 14-20 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of CD16a aptamer-Act-12c aptamer-PD-L1 aptamer-DNA vector in Example 14;

[1329] Figure 14-21A Shows the agarose gel electrophoresis detection diagram of the self-assembled product of CTLA-4 aptamer-PD-L1 aptamer-PD1 aptamer-DNA vector in Example 14, Figure 14-21B Shows the HPLC chromatogram detection diagram, Figure 14-21C Shows the melting peak and melting curve diagram, Figure 14-21D Shows the agarose gel electrophoresis detection diagram of the serum stability experiment.

[1330] Figure 14-22 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of CD16a aptamer-Act-12c aptamer-MUC1 aptamer (5TR1)-DNA vector in Example 14;

[1331] Figure 14-23 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of Her3 aptamer-EGFR siRNA-AS1411 aptamer-SurvivinsiRNA-Her2 aptamer-DNA vector in Example 14;

[1332] Figure 14-24 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of AS1411 aptamer-TAP siRNA-CD16a aptamer-Act-12c aptamer-DNA vector in Example 14;

[1333] Figure 14-25 Shows the agarose gel electrophoresis detection diagram of the self-assembled product of CD16a aptamer-AS1411 aptamer-TAP siRNA-OX40 aptamer-Act-12c aptamer-DNA vector in Example 14;

[1334] Figure 14-26A Shows the agarose gel electrophoresis detection map of the self-assembled product of AS1411-ASAP1 siRNA-VEGF aptamer-SARS-CoV-2-N48 aptamer-RNA vector in Example 14; Figure 14-26B Shows the HPLC chromatogram detection map;

[1335] Figure 14-27 Shows the agarose gel electrophoresis detection map of the self-assembled product of CD3-4 aptamer-PD-1 aptamer-BCMA aptamer-DNA vector in Example 14;

[1336] Figure 14-28 Shows the agarose gel electrophoresis detection map of the self-assembled product of CpG2006-CD38 aptamer-miR-126-PD-L1 aptamer-DNA vector in Example 14;

[1337] Figure 14-29 Shows the agarose gel electrophoresis detection map of the self-assembled product of BCMA aptamer-CD38 aptamer-miR-126-PD-L1 aptamer-miR-34-DNA vector (MM) in Example 14;

[1338] Figure 14-30 Shows the agarose gel electrophoresis detection map of the self-assembled product of AS1411 aptamer-FGF2 aptamer-3*AmiR-21-DNA vector in Example 14;

[1339] Figure 14-31 Shows the agarose gel electrophoresis detection map of the self-assembled product of HBsAg aptamer-CD40 aptamer-PD-L1 aptamer (CCPD3-C chain)-DNA vector (HBV) in Example 14;

[1340] Figure 14-32 Shows the agarose gel electrophoresis detection map of the self-assembled product of HBsAg aptamer-CD40 aptamer-PD-L1 aptamer (HD)-DNA vector (HBV) in Example 14;

[1341] Figure 14-33 Shows the agarose gel electrophoresis detection map of the self-assembled product of BCMA aptamer-CD38 aptamer-CPG aptamer-CD19 aptamer-AmiR-21-DNA3-TY (MM) in Example 14;

[1342] Figure 14-34 Shows the agarose gel electrophoresis detection map of the self-assembled product of BCMA aptamer-CD38 aptamer-CD19 aptamer-AmiR-21-DNA3-TY (MM) in Example 14;

[1343] Figure 14-35 Shows the agarose gel electrophoresis detection map of the self-assembled product of CpG2006-CD38 aptamer-PD-L1 aptamer-DNA3-TY (tumor) in Example 14;

[1344] Figure 14-36 Shows the agarose gel electrophoresis detection map of the self-assembled product of BCMA aptamer-CD38 aptamer-CPG aptamer-PD-L1 aptamer-DNA3-TY (MM) vector in Example 14;

[1345] Figure 14-37 Shows the agarose gel electrophoresis detection map of the self-assembled product of BCMA aptamer-CD40 aptamer-PD-L1 aptamer-DNA3-TY (MM) vector in Example 14;

[1346] Figure 14-38 Shows the agarose gel electrophoresis detection map of the self-assembled product of AmiR-21-AS1411 aptamer-CD40 aptamer-2* biotin-DNA vector in Example 14;

[1347] Figure 14-39 Shows the agarose gel electrophoresis detection map of the self-assembled product of 2*AmiR-21-4* biotin-DNA vector in Example 14;

[1348] Figure 14-40 Shows the agarose gel electrophoresis detection map of the self-assembled product of TTA1 aptamer-epirubicin-4* biotin-DNA vector in Example 14;

[1349] Figure 14-41 Shows the agarose gel electrophoresis detection map of the self-assembled product of the general vector DNA3-TY in Example 14;

[1350] Figure 15-1 Shows the HPLC chromatogram detection map of the self-assembled product 1 of CCPD3 in Example 15;

[1351] Figure 15-2 Shows the HPLC chromatogram detection map of the self-assembled product 2 of CCPD3 in Example 15;

[1352] Figure 15-3 Shows the HPLC chromatogram detection map of the self-assembled product 3 of CCPD3 in Example 15;

[1353] Figure 15-4 Shows the HPLC chromatogram detection map of the self-assembled product 4 of CCPD3 in Example 15;

[1354] Figure 15-5 Shows the melting peak and dissolution curve graph of the self-assembled product 1 of CCPD3 in Example 15;

[1355] Figure 15-6 Shows the melting peak and dissolution curve of the self-assembled product 5 of CCPD3 in Example 15;

[1356] Figure 15-7 Shows the melting peak and dissolution curve of the self-assembled product 6 of CCPD3 in Example 15;

[1357] Figure 15-8 Shows the melting peak and dissolution curve of the self-assembled product 7 of CCPD3 in Example 15;

[1358] Figure 15-9 Shows the melting peak and dissolution curve of the self-assembled product 8 of CCPD3 in Example 15;

[1359] Figure 15-10 Shows the melting peak and dissolution curve of the self-assembled product 9 of CCPD3 in Example 15;

[1360] Figure 15-11 Shows the melting peak and dissolution curve of the self-assembled product 10 of CCPD3 in Example 15;

[1361] Figure 15-12 Shows the melting peak and dissolution curve of the self-assembled product 11 of CCPD3 in Example 15;

[1362] Figure 15-13 Shows the melting peak and dissolution curve of the self-assembled product 12 of CCPD3 in Example 15;

[1363] Figure 15-14 Shows the melting peak and dissolution curve of the self-assembled product 13 of CCPD3 in Example 15;

[1364] Figure 16-1 Shows the animal body weight change curve in Example 16 (intravenous administration);

[1365] Figure 16-2 Shows the animal body weight change curve in Example 16 (intratumoral injection administration);

[1366] Figure 16-3 Shows the left tumor volume change curve in Example 16 (intravenous administration);

[1367] Figure 16-4 Shows the left tumor relative volume change curve in Example 16 (intravenous administration);

[1368] Figure 16-5 Shows the left tumor volume change curve in Example 16 (intratumoral injection administration);

[1369] Figure 16-6Shows the curve graph of the relative volume change of the left tumor in Example 16 (intratumoral injection administration); Figure 16-7 Shows the curve graph of the volume change of the right tumor in Example 16 (intratumoral injection administration);

[1370] Figure 16-8 Shows the curve graph of the relative volume change of the right tumor in Example 16 (intratumoral injection administration); Figure 16-9 Shows the curve graph of the weight change of the right tumor in Example 16 (tail vein injection administration);

[1371] Figure 16-10 Shows the curve graph of the weight change of the right tumor in Example 16 (intratumoral injection administration);

[1372] Figure 17-1 Shows the schematic diagram of animal inoculation and administration scheme in Example 17;

[1373] Figure 17-2 Shows the curve graph of animal body weight change in Example 17;

[1374] Figure 17-3 Shows the curve graph of the growth of the right tumor in Example 17;

[1375] Figure 17-4 Shows the curve graph of the growth of the left tumor in Example 17;

[1376] Figure 17-5 Shows the comparison graph of tumor weights in Example 17;

[1377] Figure 18-1 Shows the schematic diagram of animal inoculation and administration scheme in Example 18;

[1378] Figure 18-2 Shows the curve graph of animal body weight change in Example 18;

[1379] Figure 18-3 Shows the curve graph of the growth of the tumor on the administration side in Example 18;

[1380] Figure 18-4 Shows the curve graph of the growth of the tumor on the non - administration side in Example 18;

[1381] Figure 18-5 Shows the comparison graph of the weights of the tumors on the administration side in Example 18;

[1382] Figure 18-6 Shows the comparison graph of the weights of the tumors on the non - administration side in Example 18;

[1383] Figure 19-1 Shows the schematic diagram of animal inoculation and administration scheme in Example 19;

[1384] Figure 19-2Shows the animal body weight change curve graph in Example 19;

[1385] Figure 19-3 Shows the right tumor growth curve graph in Example 19;

[1386] Figure 19-4 Shows the left tumor growth curve graph in Example 19;

[1387] Figure 19-5 Shows the right tumor weight comparison graph in Example 19;

[1388] Figure 19-6 Shows the left tumor weight comparison graph in Example 19;

[1389] Figure 20-1 Shows the animal body weight change curve graph in Example 20;

[1390] Figure 20-2 Shows the left tumor growth curve graph in Example 20;

[1391] Figure 20-3 Shows the left tumor relative growth curve graph in Example 20;

[1392] Figure 20-4 Shows the right tumor growth curve graph in Example 20;

[1393] Figure 20-5 Shows the left tumor relative growth curve graph in Example 20;

[1394] Figure 20-6 Shows the right tumor weight comparison graph in Example 20;

[1395] Figure 21-1 Shows the animal body weight change curve graph in Example 21;

[1396] Figure 21-2 Shows the tumor growth curve graph in Example 21;

[1397] Figure 21-3 Shows the tumor relative growth curve graph in Example 21;

[1398] Figure 21-4 Shows the tumor weight comparison graph in Example 21;

[1399] Figure 22-1 Shows the schematic diagram of animal inoculation and drug administration plan in Example 22;

[1400] Figure 22-2 Shows the animal body weight change curve graph in Example 22;

[1401] Figure 22-3Shows the tumor growth curve graph on the drug-administered side in Example 22;

[1402] Figure 22-4 Shows the tumor growth curve graph on the non-drug-administered side in Example 22;

[1403] Figure 23-1 Shows the animal body weight change curve graph in Example 23;

[1404] Figure 23-2 Shows the tumor growth curve graph in Example 23;

[1405] Figure 23-3 Shows the relative tumor growth curve graph in Example 23;

[1406] Figure 23-4 Shows the tumor weight comparison graph in Example 23;

[1407] Figure 24-1 Shows the animal body weight change curve graph in Example 24;

[1408] Figure 24-2 Shows the tumor growth curve graph in Example 24;

[1409] Figure 24-3 Shows the relative tumor growth curve graph in Example 24;

[1410] Figure 24-4 Shows the tumor weight comparison graph in Example 24;

[1411] Figure 25-1 Shows the animal body weight change curve graph in Example 25;

[1412] Figure 25-2 Shows the tumor growth curve graph in Example 25;

[1413] Figure 25-3 Shows the tumor weight comparison graph in Example 25;

[1414] Figure 26-1 Shows the animal body weight change curve graph in Example 26;

[1415] Figure 26-2 Shows the tumor growth curve graph in Example 26;

[1416] Figure 26-3 Shows the tumor weight comparison graph in Example 26;

[1417] Figure 27-1 Shows the animal body weight change curve graph in Example 27;

[1418] Figure 27-2 Shows the tumor growth curve graph in Example 27;

[1419] Figure 27-3 Shows the tumor relative growth curve in Example 27;

[1420] Figure 27-4 Shows the tumor weight comparison chart in Example 27;

[1421] Figure 28-1 Shows the animal body weight change curve in Example 28;

[1422] Figure 28-2 Shows the tumor growth curve in Example 28;

[1423] Figure 28-3 Shows the tumor relative growth curve in Example 28;

[1424] Figure 28-4 Shows the tumor weight comparison chart in Example 28;

[1425] Figure 29-1 Shows the tumor growth curve in Example 29;

[1426] Figure 29-2 Shows the tumor relative growth curve in Example 29;

[1427] Figure 29-3 Shows the survival days chart in Example 29;

[1428] Figure 30-1 Shows the animal body weight change curve in Example 30;

[1429] Figure 30-2 Shows the tumor growth curve in Example 30;

[1430] Figure 30-3 Shows the tumor relative growth curve in Example 30;

[1431] Figure 30-4 Shows the tumor weight comparison chart in Example 30;

[1432] Figure 31-1 Shows the animal body weight change curve in Example 31;

[1433] Figure 31-2 Shows the tumor growth curve in Example 31;

[1434] Figure 31-3 Shows the tumor relative growth curve in Example 31;

[1435] Figure 31-4 Shows the tumor weight comparison chart in Example 31;

[1436] Figure 32-1Shows the animal body weight change curve in Example 32;

[1437] Figure 32-2 Shows the tumor growth curve in Example 32;

[1438] Figure 32-3 Shows the tumor weight comparison chart in Example 32;

[1439] Figure 33-1 Shows the animal body weight change curve in Example 33;

[1440] Figure 33-2 Shows the tumor growth curve in Example 33;

[1441] Figure 33-3 Shows the tumor weight comparison chart in Example 33;

[1442] Figure 34-1 Shows the animal body weight change curve in Example 34;

[1443] Figure 34-2 Shows the tumor growth curve in Example 34;

[1444] Figure 34-3 Shows the tumor weight comparison chart in Example 34;

[1445] Figure 35-1 Shows the animal body weight change curve in Example 35;

[1446] Figure 35-2 Shows the tumor growth curve in Example 35;

[1447] Figure 35-3 Shows the tumor weight comparison chart in Example 35;

[1448] Figure 36-1 Shows the animal body weight change curve in Example 36;

[1449] Figure 36-2 Shows the tumor growth curve in Example 36;

[1450] Figure 36-3 Shows the tumor weight comparison chart in Example 36;

[1451] Figure 37-1 Shows the animal body weight change curve in Example 37;

[1452] Figure 37-2 Shows the tumor growth curve in Example 37;

[1453] Figure 37-3 Shows the tumor weight comparison chart in Example 37;

[1454] Figure 38-1 Shows the animal body weight change curve in Example 38;

[1455] Figure 38-2 Shows the tumor growth curve in Example 38;

[1456] Figure 38-3 Shows the tumor weight comparison chart in Example 38;

[1457] Figure 39-1 Shows the animal body weight change curve in Example 39;

[1458] Figure 39-2 Shows the tumor growth curve in Example 39;

[1459] Figure 39-3 Shows the tumor weight comparison chart in Example 39;

[1460] Figure 40-1 Shows the animal body weight change curve in Example 40;

[1461] Figure 40-2 Shows the tumor growth curve in Example 40;

[1462] Figure 40-3 Shows the tumor weight comparison chart in Example 40;

[1463] Figure 41-1 Shows the schematic diagram of animal inoculation and drug administration in Example 41;

[1464] Figure 41-2 Shows the animal body weight change curve in Example 41;

[1465] Figure 41-3 Shows the tumor growth curve in Example 41;

[1466] Figure 42-1 Shows the animal body weight change curve in Example 42;

[1467] Figure 42-2 Shows the tumor growth curve in Example 42;

[1468] Figure 42-3 Shows the tumor weight comparison chart in Example 42;

[1469] Figure 43-1 Shows the animal body weight change curve in Example 43;

[1470] Figure 43-2 Shows the tumor growth curve in Example 43;

[1471] Figure 43-3Shows the tumor weight comparison chart in Example 43;

[1472] Figure 44-1 Shows the tumor growth curve of the MC38 subcutaneous xenograft tumor model after the start of treatment in Example 44;

[1473] Figure 44-2 Shows the curve of animal body weight change of the MC38 subcutaneous xenograft tumor model after the start of treatment in Example 44;

[1474] Figure 44-3 A in shows the binding ratio of different concentrations of CCPD3-Cy5 (0, 100 nM, 200 nM, 500 nM) to monocytes of different species in Example 44, B shows the average fluorescence intensity of the binding of different concentrations of CCPD3-Cy5 (0, 100 nM, 200 nM, 500 nM) to monocytes of different species, C shows the binding ratio of different concentrations of CCPD3-Cy5 (0, 100 nM, 200 nM, 500 nM) to lymphocytes of different species, and D shows the average fluorescence intensity of the binding of different concentrations of CCPD3-Cy5 (0, 100 nM, 200 nM, 500 nM) to lymphocytes of different species;

[1475] Figure 44-4 Shows the curve of mouse body weight change in the in vivo efficacy test of CCPD3 in the GL261-Luc orthotopic tumor model of mouse glioma in Example 44;

[1476] Figure 44-5 Shows the curve of the percentage of mouse body weight change in the in vivo efficacy test of CCPD3 in the GL261-Luc orthotopic tumor model of mouse glioma in Example 44;

[1477] Figure 44-6 to 44-9 Shows the bioluminescence imaging map of each group of mice after inoculating tumors in Example 44, where Figure 44-6 Is the in vivo imaging map of the dorsal side of the mouse, Figure 44-7 Is the in vivo imaging map of the left side of the mouse, Figure 44-8 Is the in vivo imaging map of the right side of the mouse, Figure 44-9 Is the in vivo imaging map of the ventral side of the mouse;

[1478] Figure 44-10 Shows the curve of the change in BLI value of each group of mice in Example 44. See the figure, where A is the curve of the change in BLI value of the in vivo imaging of the dorsal side of the mouse, B is the curve of the change in BLI value of the in vivo imaging of the left side of the mouse, C is the curve of the change in BLI value of the in vivo imaging of the right side of the mouse, and D is the curve of the change in BLI value of the in vivo imaging of the ventral side of the mouse;

[1479] Figure 44-11 Shows the survival curve of mice in the GL261-Luc orthotopic xenograft tumor model in Example 44;

[1480] Figure 44-12 Shows the HE staining diagram of the brain tissue pathological section of the GL261-Luc in-situ xenograft tumor model group in Example 44;

[1481] Figure 44-13 Shows the electrophoresis detection diagram after diluting 100 times in the serum stability test in Example 44; and

[1482] Figure 44-14 Shows the electrophoresis detection diagram of the serum stability test in Example 44.

[1483] The Chinese corresponding to the English annotations in the drawings:

[1484] Tumor volume: Tumor volume; Days after transplanation: Days after inoculation; RTV: Relative tumor volume; Tumor weight, left tumor: Left tumor, right tumor: Right tumor; Daysafter incubation: Days after inoculation; control: Control; MeanValue: Mean value; concentration: Concentration; Body weight: Body weight; lymphocytes: Lymphocytes; monocytes: Monocytes; negtive control: Negative control; radiance: Radiance; color scale: Color scale; Percent survival: Survival rate; Days aftertumor incubation: Days after tumor inoculation; Total flux: Total flux.

[1485] The "CD40" part in the drawings is the abbreviation of the "CD40 aptamer" described in the examples, which has the same meaning and is also the same as "Apt CD40" in Table 5; in addition, similar situations also include MUC1, CD16a, CTLA-4, PD-L1, C12, TTA1, AS1411, A15, PSMA, FAP, CD16a, Act-12c, PD1, Her2, Her3, VEGF, N48, CD3-4, PD-1, BCMA, CD38, FGF2, HBsAg, CPG and CD-19. "Bio" is equivalent to "biotin", and "survivin" is equivalent to "surviviniRNA". Detailed implementation manners

[1486] It should be noted that, without conflict, the embodiments in the present application and the features in the embodiments can be combined with each other. The present invention will be described in detail below with reference to the drawings and in combination with the embodiments.

[1487] Glossary of Terms:

[1488] Oligonucleotides refer to oligonucleotide molecules including small interfering nucleic acids (siRNAs), antisense nucleic acids (ASOs), microRNAs (miRNAs), and aptamers. Oligonucleotide drugs are composed of nucleotides and represent a completely new class of drugs that are distinct from small molecule drugs and antibody drugs. Compared with traditional chemical drug molecules, oligonucleotide drugs have the advantages of strong target specificity, high efficiency, long-lasting drug action, simple drug design, and a rich pool of candidate targets. The main oligonucleotide drugs are siRNA drugs and antisense nucleic acid drugs, both of which mainly act on cytoplasmic mRNA and regulate protein expression by base complementary recognition and inhibition of target mRNA to achieve the purpose of treating diseases. The nucleic acids or small nucleic acids in this application all refer to small nucleic acids.

[1489] Antisense nucleic acid (ASO): ASO, namely antisense oligonucleotide, usually refers to short (16 - 53 nucleotides), synthetic oligonucleotides used to block the function of RNA (including mRNA or miRNA). The nucleotides are usually highly complementary to small RNAs and structurally contain chemically modified nucleotides or specific sequences added at both ends to enhance their binding affinity to the target sequence and resist intracellular nucleic acid degradation.

[1490] When targeting mRNA, ASOs are usually designed to form complementary pairs with specific regions of the target mRNA to prevent the reading by the translation machinery, cause the degradation of mRNA, or modify the splicing of mRNA.

[1491] When targeting miRNA, ASOs (also known as anti-miRNA molecules according to their function) are usually designed to form complementary pairs with specific miRNAs to prevent the binding of miRNAs to their target mRNAs, thereby inhibiting the function of miRNAs (miRNAs are a class of short non-coding RNAs that can affect the stability and translation of mRNA by forming complementary pairs with the 3' untranslated region of the target mRNA, further regulating protein expression). The ASOs acting as anti-miRNA molecules in this application include but are not limited to A-miR21, A-miR-10a, A-miR-30c, AmiR1306, etc.

[1492] MicroRNA (miRNA): It is a short non-coding RNA with a length of approximately 22 nucleotides. Its mechanism of action is as follows: miRNA regulates the stability or translation of target mRNA by forming complementary pairs with the 3' untranslated region (3'UTR) of the target mRNA, thereby affecting protein expression. miRNAs have been proven to play key roles in many biological processes, including development, differentiation, proliferation, and apoptosis, etc.

[1493] It exists in multiple forms. The most primitive one is pri-miRNA. After one processing, pri-miRNA becomes pre-miRNA, which is the precursor of microRNA. After pre-miRNA is digested by Dicer enzyme, it becomes mature miRNA. In actual research, pre-miRNA has been applied earliest and most widely. Many commercial MicroRNA libraries are in the form of pre-miRNA. Recently, it has also been found that both arms of microRNA play a very important role in the formation of mature miRNA. Therefore, the natural pri-miRNA form is increasingly adopted by researchers.

[1494] In addition, as part of a treatment strategy, in order to increase the level of specific miRNAs (such as miR-34a or miR-122) in the body, the concept of miRNA supplements has been proposed in existing research. Such supplements are usually analogs or mimics of miRNAs, which can be in the form of RNA, but also in the form of DNA. When in the form of DNA, as long as they can be transcribed into RNA with the same sequence, they can perform the same functions as normal miRNAs in cells.

[1495] Using miRNA supplements in the form of DNA sequences has some advantages. First, DNA is more stable and more resistant to degradation enzymes in the body. Second, DNA can be read by the cell's transcription machinery and transcribed into the corresponding RNA, thus increasing the level of miRNA in the cell. Finally, the synthesis difficulty and synthesis cost of DNA are relatively low, so DNA is easier to design and manufacture, especially for large-scale production and application.

[1496] Taking miR-34a as an example, miR-34a has been proven to play an important anti-tumor role in many types of cancers. Therefore, increasing the level of miR-34a in the body may be an effective cancer treatment strategy. By providing miR-34a supplements (i.e., miRNA analogs) in the form of DNA sequences, the level of miR-34a in the body can be increased, thereby inhibiting the growth and survival of cancer cells.

[1497] Therefore, in the application, the meaning of miRNA is broad, including various forms, such as the above-mentioned pri-miRNA, pre-miRNA, mature miRNA, and miRNA analogs (in the form of DNA, oligonucleotides that can form the same sequence and the same function as mature miRNA through transcription). In this application, miRNA analogs include but are not limited to one or more of miR-34, miR-542, miR-126, and miR-122.

[1498] Chemical modifications of oligonucleotide drugs at specific positions can improve the stability of these small nucleic acid molecules and avoid triggering immune system responses. The chemical modifications involved in the oligonucleotide drugs in this application include but are not limited to the following aspects:

[1499] 1) Backbone modification: The phosphorothioate (PS) bond modification is achieved by replacing one non-bridging oxygen in the phosphodiester with a sulfur atom. The PS linkage makes the modified oligonucleotide resistant to nucleases. Compared with unmodified oligonucleotides, these oligonucleotides are more likely to bind to plasma proteins and have an extended half-life.

[1500] 2) Ribose modification: Ribose modification refers to the replacement of the 2'-OH on the ribose of the nucleotide with 2'-F, 2'-OMe, or 2'-O-MOE. This modification can affect the affinity between the small nucleic acid and the target RNA, the stability against ribozymes, and the properties after binding to RNA. Currently, the more commonly used modification is 2'-O-methoxyethyl modification (2'-O-MOE).

[1501] 3) Base modification: By modifying the base, the interaction between the oligonucleotide drug and the mRNA base can be strengthened. Currently, the only widely used base modification is the C5 methyl substitution (5-Methylcytosine) on the pyrimidine ring.

[1502] Although there are already various carriers for improving drug delivery efficiency in the prior art, including nucleic acid carriers, it is still difficult to solve the problem of limited clinical application of drugs. To solve the above problems, the present invention provides a nucleic acid carrier, which comprises sequence a, sequence b, and sequence c. The nucleic acid carrier is selected from any one of the following: DNA carrier, RNA carrier, or DNA-RNA hybrid carrier; wherein, sequence a, sequence b, and sequence c self-assemble to form the nucleic acid carrier. Sequence a, sequence b, and sequence c include a vector backbone sequence, and the vector backbone sequence includes the following core sequences: sequence a1, sequence b1, and sequence c1, or any variant sequences of at least one of sequence a1, sequence b1, and sequence c1. The variant sequences include insertions, deletions, or substitutions of at least one base; wherein, in the DNA carrier, sequence a1 is SEQ ID NO:1, sequence b1 is SEQ ID NO:2, and sequence c1 is SEQ ID NO:3; in the RNA carrier, sequence a1 is SEQ ID NO:4, sequence b1 is SEQ ID NO:5, and sequence c1 is SEQ ID NO:6; the DNA-RNA hybrid carrier is a carrier self-assembled from a combination of the sequences of the DNA carrier and the RNA carrier.

[1503] SEQ ID NO:1: ACGAGCGTTCCG;

[1504] SEQ ID NO:2: CGGTTCGCCG;

[1505] SEQ ID NO:3: CGGCCATAGCCGT;

[1506] SEQ ID NO:4: ACGAGCGUUCCG;

[1507] SEQ ID NO:5: CGGUUCGCCG;

[1508] SEQ ID NO:6: CGGCCAUAGCCGU.

[1509] The nucleic acid carrier in the above preferred embodiment is self-assembled from sequences containing the above core sequences, forming a three-dimensional nanostructure through self-assembly, which can effectively reduce or prevent degradation by nucleases and improve the stability of the carrier. Using nucleic acid nanoparticles self-assembled from three single strands with the core sequences listed in this application as the delivery carrier for oligonucleotide drugs, compared with LNP and PNP in the prior art, since both the carrier itself and the delivered drug are nucleotide sequences, they have stronger compatibility with oligonucleotide drugs in terms of physical and chemical properties, facilitating the attachment of different types of small nucleic acid molecules according to the different sequence structures or lengths of the carrier sequences, and taking advantage of the binding of base complementary pairing, not only improving the delivery efficiency, but also making the delivery system more stable. Moreover, the nucleic acid carrier with the above core sequence itself has a certain immune-stimulating effect. When used as the delivery carrier for nucleic acid drugs, it not only acts as a carrier, but also can enhance the efficacy of nucleic acid drugs to a certain extent. In addition, the preparation process of the nucleic acid carrier is also simpler and more efficient.

[1510] In the above nucleic acid carrier, according to the length of the oligonucleotide drug molecule sequence to be delivered subsequently, the lengths of its three sequences can also be appropriately extended to further improve the stability after attaching the oligonucleotide drug. In a preferred embodiment of this application, the above carrier backbone sequence further includes a first extension segment and an optional second extension segment, and the first extension segment and the second extension segment are located at the 5' end and / or 3' end of any one of the a1 sequence, b1 sequence, and c1 sequence. Preferably, the lengths of the first extension segment and the second extension segment are each independently 1-14 nt according to needs, preferably 1-10 nt, more preferably 2-7 nt, and further preferably 3-7 nt. Specifically, it can be 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, or 14 nt.

[1511] In some preferred embodiments, the first extension segment is selected from any one or more of the following DNA extension segments or the corresponding RNA extension segments:

[1512] 1) The 5'-end of the a1 sequence: GACGCCC, the 3'-end of the c1 sequence: GGGCGTC; or the RNA extension segment corresponding to the DNA extension segment in 1);

[1513] 2) The 3'-end of the a1 sequence: GGAGAGG, the 5'-end of the b1 sequence: CCTCTCC; or the RNA extension segment corresponding to the DNA extension segment in 2);

[1514] 3) The 3'-end of the b1 sequence: CGAGCC, the 5'-end of the c1 sequence: GGCTCG or GGCACG; or the RNA extension segment corresponding to the DNA extension segment in 3);

[1515] 4) The 5'-end of the a1 sequence: GGCGCCC or GACGCCC, the 3'-end of the c1 sequence: GGGCGCC; or the RNA extension segment corresponding to the DNA extension segment in 4);

[1516] 5) The 3'-end of the a1 sequence: GGAG, the 5'-end of the b1 sequence: CTCC; or the RNA extension segment corresponding to the DNA extension segment in 5);

[1517] 6) The 3'-end of the b1 sequence: CCAGCC, the 5'-end of the c1 sequence: GGCACG or GGCTCG; or the RNA extension segment corresponding to the DNA extension segment in 6).

[1518] Preferably, the second extension segment is selected from any one or more of the following DNA extension segments or RNA extension segments corresponding to the DNA extension segments:

[1519] 1) The 5'-end of the a1 sequence: C or GC, the 3'-end of the c1 sequence: GC or GCT; or the RNA extension segment corresponding to the DNA extension segment in 1);

[1520] 2) The 3'-end of the a1 sequence: AG, AGC or AGCT, the 5'-end of the b1 sequence: GCT or CT; or the RNA extension segment corresponding to the DNA extension segment in 2);

[1521] 3) The 3'-end of the b1 sequence: GC, GCG or GCGT, the 5'-end of the c1 sequence: GC or CGC; or the RNA extension segment corresponding to the DNA extension segment in 3);

[1522] 4) The 3'-end of the a1 sequence: C, AGGCC, AGGCCT or AGGAG, the 5'-end of the b1 sequence: G, GGCCT or CTCCT; or the RNA extension segment corresponding to the DNA extension segment in 4);

[1523] 5) The 3'-end of the b1 sequence: GCC or GCCT, the 5'-end of the c1 sequence: GGC; or the RNA extension segment corresponding to the DNA extension segment in 5).

[1524] Increasing the extension segments of the above different lengths helps to further improve the stability when nucleic acid carriers of different types carry effector molecules of different molecular weights, and also facilitates the selection of a suitable nucleic acid carrier according to the different nucleic acid effector molecules to be loaded.

[1525] It should be noted that the vector backbone sequence in this application includes the aforementioned a1 sequence, b1 sequence, and c1 sequence (or variant sequences thereof) and the aforementioned optional first extension segment and second extension segment. On the basis of such a vector backbone sequence, in some embodiments, in order to further improve the stability of small nucleic acid effector molecules with different sequence lengths to be loaded, the nucleic acid carrier may further include a single-stranded bonding bridge sequence and / or a transition sequence. Among them, the single-stranded bonding bridge sequence is selected from any one or more of the following: at the 3' end of the core sequence of the a sequence: SEQ ID NO:7: TGTAGCACGGTGGC or its complementary sequence SEQ ID NO:8: GCCACCGTGCTACA; at the 3' end of the core sequence of the b sequence: SEQ ID NO:9: TCGGCGCGGCCGTG or its complementary sequence SEQ ID NO:10: CACGGCCGCGCCGA; at the 3' end of the core sequence of the c sequence: SEQ ID NO:11: TGCTGCTGCTGCTG or its complementary sequence SEQ ID NO:12: CAGCAGCAGCAGCA; the transition sequence is a sequence formed by consecutive n U, T, or A, where n is a natural number from 2 to 8, preferably 3 to 6, or a randomly combined sequence of A, U, T, C, and / or G, and the transition sequence is located at the 5' end or 3' end of the core sequence.

[1526] The design of the above single-stranded linking bridge sequence and its complementary sequence is to connect the oligonucleotide effector molecule with the nucleic acid carrier sequence through complementary pairing. Therefore, according to the specific vector core sequence and the specific sequence of the oligonucleotide effector molecule, a single-stranded linking bridge sequence composed of an appropriate number and appropriate sequence is selected.

[1527] In some embodiments, in order to facilitate the synthesis of the nucleic acid carrier and / or the oligonucleotide drug and reduce the nucleic acid synthesis cost, the sequence of the nucleic acid carrier is set in the structural form of vector backbone sequence + single-stranded linking bridge sequence. In this way, it is convenient for various types of oligonucleotide effector molecules (except siRNA) to form the vector and load the oligonucleotide drug simultaneously through self-assembly by synthesizing a sequence complementary to the single-stranded linking bridge sequence at the end during synthesis. At the same time, it also avoids the problems of long fragment length, high synthesis difficulty, and high cost when directly synthesizing the nucleic acid sequence of the carrier and the nucleic acid sequence of the oligonucleotide drug.

[1528] In some preferred embodiments, the a sequence, b sequence, and c sequence in the nucleic acid vector are as follows:

[1529] The a sequence is: SEQ ID NO:15:

[1530] GACGCCCACGAGCGTTCCGGGAGAGG TGTAGCACGGTGGC, Among them, the underlined part is the single-stranded linker sequence A;

[1531] The b sequence is: SEQ ID NO:16: CCTCTCCCGGTTCGCCGCGAGCC TCGGCGCGGCCGTG, Among them, the underlined part is the single-stranded linker sequence B;

[1532] The c sequence is: SEQ ID NO:17:

[1533] GGCTCGCGGCCATAGCCGTGGGCGTC TGCTGCTGCTGCTG, Among them, the underlined part is the single-stranded linker sequence C.

[1534] It should be noted that the above single-stranded linker sequences do not always exist simultaneously in the a sequence, b sequence, and c sequence of the nucleic acid vector and can be selected according to actual needs. For example, they can exist only in the a sequence, only in the b sequence, only in the c sequence, or only in the a sequence and b sequence, only in the a sequence and c sequence, or only in the c sequence and b sequence.

[1535] In some other embodiments, the a sequence, b sequence, and c sequence in the nucleic acid vector are as follows:

[1536] The a sequence is: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC;

[1537] The b sequence is: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG;

[1538] The c sequence is: SEQ ID NO:20:

[1539] CAGCAGCAGCAGCA CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC, the underlined part is the single-stranded linker sequence.

[1540] It should be noted that depending on whether the small nucleic acid drug to be attached to the nucleic acid carrier is siRNA, miRNA, or aptamer, the specific method of attaching it to the nucleic acid carrier also varies. For example, when attaching an aptamer, it can be connected to any one or more of the a, b, or c sequences at either end through a spacer sequence or a single-stranded linker sequence. It is also possible to use miRNA as a spacer sequence to connect the aptamer sequence to any one of the a, b, or c sequences at either end (for example, when the miRNA sequence is set at the 5' end of the a sequence, the aptamer sequence can be set at the 5' end of this miRNA sequence; similarly, when the miRNA sequence is set at the 3' end of the b sequence, the aptamer sequence is set at the 3' end of this miRNA sequence). It should be noted here that when the aptamer sequence is connected through a spacer sequence or miRNA sequence, it is a covalent connection. When connected through a single-stranded linker sequence, it is achieved by complementary base pairing with the complementary sequence of the single-stranded linker covalently attached to the a, b, or c sequence. It is a connection method through intermolecular forces rather than a chemical covalent connection method. Similarly, when attaching siRNA, the antisense strand of siRNA is connected by complementary pairing with the sense strand covalently attached to the a, b, or c sequence. The connection of the sense strand is usually also carried out through a spacer sequence. In some cases, when the aptamer is in the form of RNA, similar to miRNA, it can be directly covalently connected to the a, b, or c sequence without passing through a spacer sequence. Or it can be covalently connected to the a, b, or c sequence only through individual TT, AA, or UU, or a single U or A.

[1541] In some preferred embodiments, the core sequences that self-assemble to form the nucleic acid carrier are respectively selected from any one of the following groups:

[1542] 1) a sequence: SEQ ID NO:21: GCGACGCCCACGAGCGTTCCGGGAGAGGAG,

[1543] b sequence: SEQ ID NO:22: CTCCTCTCCCGGTTCGCCGCGAGCCGCG,

[1544] c sequence: SEQ ID NO:23: CGCGGCACGCGGCCATAGCCGTGGGCGTCGC;

[1545] 2) a sequence: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT,

[1546] b sequence: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG,

[1547] c sequence: SEQ ID NO:23: CGCGGCACGCGGCCATAGCCGTGGGCGTCGC;

[1548] 3) a sequence: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT,

[1549] b sequence: SEQ ID NO:25: GCTCCTCTCCCGGTTCGCCGCGAGCCGCGT,

[1550] c sequence: SEQ ID NO:26: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGCT;

[1551] 4) a sequence: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT,

[1552] b sequence: SEQ ID NO:25: GCTCCTCTCCCGGTTCGCCGCGAGCCGCGT,

[1553] c sequence: SEQ ID NO:27: CGCGGCACGCGGCCATAGCCGTGGGCGTCGCT;

[1554] 5) a sequence: SEQ ID NO:28: GACGCCCACGAGCGTTCCGGGAGAGG,

[1555] b sequence: SEQ ID NO:29: CCTCTCCCGGTTCGCCGCGAGCC,

[1556] c sequence: SEQ ID NO:30: GGCTCGCGGCCATAGCCGTGGGCGTC;

[1557] 6) a sequence: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC,

[1558] b sequence: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG,

[1559] c sequence: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC;

[1560] 7) a sequence: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT,

[1561] b sequence: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG,

[1562] c sequence: SEQ ID NO:26: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGCT;

[1563] 8) a sequence: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT,

[1564] b sequence: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG,

[1565] c sequence: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC;

[1566] 9) a sequence: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT,

[1567] b sequence: SEQ ID NO:25: GCTCCTCTCCCGGTTCGCCGCGAGCCGCGT,

[1568] c sequence: SEQ ID NO:26: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGCT;

[1569] 10) a sequence: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT,

[1570] b sequence: SEQ ID NO:25: GCTCCTCTCCCGGTTCGCCGCGAGCCGCGT,

[1571] c sequence: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC;

[1572] 11) Sequence a: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC,

[1573] Sequence b: SEQ ID NO:25: GCTCCTCTCCCGGTTCGCCGCGAGCCGCGT,

[1574] Sequence c: SEQ ID NO:26: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGCT;

[1575] 12) Sequence a: SEQ ID NO:32: CGACGCCCACGAGCGTTCCGGGAGAGGAGC;

[1576] Sequence b: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG;

[1577] Sequence c: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC;

[1578] 13) Sequence a: SEQ ID NO:33: GCGGCGCCCACGAGCGTTCCGGGAGC;

[1579] Sequence b: SEQ ID NO:34: GCTCCCGGTTCGCCGCCAGCCGCC;

[1580] Sequence c: SEQ ID NO:35: GGCGGCAGGCGGCCATAGCCGTGGGCGCCGC;

[1581] 14) Sequence a: SEQ ID NO:36: GCGGCGCCCACGAGCGTTCCGGGAGAGGCC;

[1582] Sequence b: SEQ ID NO:37: GGCCTCTCCCGGTTCGCCGCCAGCCGCC;

[1583] Sequence c: SEQ ID NO:38: GGCGGCTGGCGGCCATAGCCGTGGGCGCCGC;

[1584] 15) Sequence a: SEQ ID NO:39: GCGGCGCCCACGAGCGTTCCGGGAGAGGCCT;

[1585] b sequence: SEQ ID NO:40: GGCCTCTCCCGGTTCGCCGCCAGCCGCCT;

[1586] c sequence: SEQ ID NO:41: GGCGGCTGGCGGCCATAGCCGTGGGCGCCGCT;

[1587] 16) a sequence: SEQ ID NO:42: GCGGCGCCCACGAGCGUUCCGGGAGAGGCC;

[1588] b sequence: SEQ ID NO:43: GGCCUCUCCCGGUUCGCCGCCAGCCGCC;

[1589] c sequence: SEQ ID NO:44: GGCGGCUGGCGGCCAUAGCCGUGGGCGCCGC;

[1590] 17) a sequence: SEQ ID NO:45: CGACGCCCACGAGCGTTCCGGGAGAGGAG;

[1591] b sequence: SEQ ID NO:46: CTCCTCTCCCGGTTCGCCGCCAGCCGCC;

[1592] c sequence: SEQ ID NO:35: GGCGGCAGGCGGCCATAGCCGTGGGCGCCGC;

[1593] 18) a sequence: SEQ ID NO:36: GCGGCGCCCACGAGCGTTCCGGGAGAGGCC;

[1594] b sequence: SEQ ID NO:43: GGCCUCUCCCGGUUCGCCGCCAGCCGCC;

[1595] c sequence: SEQ ID NO:44: GGCGGCUGGCGGCCAUAGCCGUGGGCGCCGC;

[1596] 19) a sequence: SEQ ID NO:36: GCGGCGCCCACGAGCGTTCCGGGAGAGGCC;

[1597] b sequence: SEQ ID NO:40: GGCCTCTCCCGGTTCGCCGCCAGCCGCCT;

[1598] c sequence: SEQ ID NO:38: GGCGGCTGGCGGCCATAGCCGTGGGCGCCGC;

[1599] 20) a sequence: SEQ ID NO:36: GCGGCGCCCACGAGCGTTCCGGGAGAGGCC;

[1600] b sequence: SEQ ID NO:40: GGCCTCTCCCGGTTCGCCGCCAGCCGCCT;

[1601] c sequence: SEQ ID NO:41: GGCGGCTGGCGGCCATAGCCGTGGGCGCCGCT;

[1602] 21) a sequence: SEQ ID NO:36: GCGGCGCCCACGAGCGTTCCGGGAGAGGCC;

[1603] b sequence: SEQ ID NO:37: GGCCTCTCCCGGTTCGCCGCCAGCCGCC;

[1604] c sequence: SEQ ID NO:44: GGCGGCUGGCGGCCAUAGCCGUGGGCGCCGC;

[1605] 22) a sequence: SEQ ID NO:33: GCGGCGCCCACGAGCGTTCCGGGAGC;

[1606] b sequence: SEQ ID NO:46: CTCCTCTCCCGGTTCGCCGCCAGCCGCC;

[1607] c sequence: SEQ ID NO:35: GGCGGCAGGCGGCCATAGCCGTGGGCGCCGC;

[1608] 23) a sequence: SEQ ID NO:47: GCGGCGCCCACGAGCGTTCCGGGAGAGGAG;

[1609] b sequence: SEQ ID NO:46: CTCCTCTCCCGGTTCGCCGCCAGCCGCC;

[1610] c sequence: SEQ ID NO:35: GGCGGCAGGCGGCCATAGCCGTGGGCGCCGC;

[1611] 24) Sequence a: SEQ ID NO:48: CGCCCACGAGCGTTCCGGGAGA;

[1612] Sequence b: SEQ ID NO:49: TCTCCCGGTTCGCCGCGAG;

[1613] Sequence c: SEQ ID NO:50: CTCGCGGCCATAGCCGTGGGCG;

[1614] 25) Sequence a: SEQ ID NO:51: UCGCCCACGAGCGUUCCGGGAGA;

[1615] Sequence b: SEQ ID NO:52: UCUCCCGGUUCGCCGCGAG;

[1616] Sequence c: SEQ ID NO:53: UCUCGCGGCCAUAGCCGUGGGCG;

[1617] 26) Sequence a: SEQ ID NO:54: GCGCCCACGAGCGTTCCGGGAGAGC;

[1618] Sequence b: SEQ ID NO:55: CCCUGCTCTCCCGGTTCGCCGCCAGCCGCC;

[1619] Sequence c: SEQ ID NO:56: GGCGGCAGGCGGCCATAGCCGTGGGCGC.

[1620] The nucleic acid carriers self-assembled from core sequences with different compositions can adapt to the loading of different types of oligonucleotide drugs, and different types of oligonucleotide drugs can also be loaded on the same nucleic acid carrier, thereby improving the loading types and efficiency of oligonucleotide drugs.

[1621] It should be noted that, in order to further reduce the sensitivity of the above nucleic acid nanoparticles to RNase degradation and improve the stability during delivery, in some cases, certain sites on the nucleic acid carrier can be modified. In some preferred embodiments, at least one of the bases, riboses, and phosphate esters in the a sequence, b sequence, and c sequence has at least one modifiable site, and any modifiable site has at least one of the following modifications: -F, methyl, amino, disulfide, carbonyl, carboxyl, mercapto, aldehyde, and thio; preferably, some of the bases in the a sequence, b sequence, and c sequence have thio modification. When the modification site is mercapto, it belongs to thio modification, which has a weak modification intensity, low cost, and can improve the stability of the RNA sequence and the RNA carrier or DNA-RNA hybrid carrier assembled therefrom. To further improve the stability, in the nucleic acid carrier in the form of RNA, the RNA contains 2'-F modification and 2'-OMe modification, and more preferably, 2'-F modification is carried out on U and C, and 2'-OMe modification is carried out on A and G.

[1622] In the second typical embodiment of the present application, a nucleic acid drug is provided. The nucleic acid drug includes the above nucleic acid carrier and a bioactive substance attached to the nucleic acid carrier. The bioactive substance includes an oligonucleotide effector molecule and a targeting molecule for targeting and delivering the oligonucleotide molecule. Among them, the oligonucleotide effector molecule is selected from at least one of the following: nucleic acid immunostimulant, nucleic acid aptamer, siRNA, miRNA, and ASO; and when the oligonucleotide effector molecule includes a nucleic acid aptamer, the targeting molecule includes at least a nucleic acid aptamer; when the oligonucleotide effector molecule does not include a nucleic acid aptamer, the targeting molecule includes at least a small molecule compound with a targeting effect.

[1623] The above nucleic acid drug of the present application addresses the problems of 1) the compounding of multiple oligonucleotide drugs and 2) the systematic preparation of more complex structured nano-nucleic acid drugs. Based on the improved nano-nucleic acid carrier structure described above, by using different attachment strategies to attach one or more oligonucleotide effector molecules, it not only provides an integrated drug of multiple oligonucleotide drugs, but also provides a new idea and implementation path for the drug construction of such oligonucleotide drugs.

[1624] The nucleic acid immunostimulant in the present application is an immune stimulatory factor: Tumor cells have low expression of major histocompatibility complex (MHC) molecules, lack co-stimulatory molecules, have antigen processing defects, and changes in the expression of T cell signaling molecules, resulting in low anti-tumor immunity in the body, which is the main cause of tumor occurrence and development.

[1625] CPG ODN (CpG oligonucleotide) is a synthetic oligodeoxynucleotide (ODN) containing unmethylated cytosine-guanine dinucleotides (CpG), which can mimic bacterial DNA to stimulate immune cells of various mammals including humans.

[1626] The structural characteristics and immune effects of different types of CpG ODNs vary, and they are generally divided into three categories: A, B, and C.

[1627] Type A CpG ODN has a palindromic sequence containing CpG dinucleotides as the core, with poly G tails at both ends. The phosphodiester bond backbone is partially thiolated. It forms a higher-order structure through the palindromic sequence and poly G, and can activate plasmacytoid dendritic cells to induce a large amount of type I interferon, and has weak activity on B cells.

[1628] Type B CpG ODN is a fully thiolated linear CpG ODN, which has strong immune-stimulating activity on B cells but cannot activate plasmacytoid dendritic cells.

[1629] Type C CpG-ODN is a fully thiolated CpG ODN, which can form dimers through palindromic sequences and has the activities of both type A and type B CpG-ODNs. It can activate both plasmacytoid dendritic cells and B cells.

[1630] The above nucleic acid immune stimulant refers to DNA or artificially synthesized oligonucleotides containing CpG motifs, which can activate various immune cells such as dendritic cells, natural killer cells, B cells, and T cells, induce the secretion of Th1-type cytokines mainly interleukin-12, up-regulate the expression of co-stimulatory molecules, and induce Th1-type immune responses, thus having important application value in anti-tumor. Therefore, existing CpG immune stimulants are all applicable to this application. In a preferred embodiment of this application, the nucleic acid immune stimulant includes one or more of CpG2006, CpG2006 variant, CpG1826, CpG2216, CpG2395, and CpG-ODNT7; more preferably, the sequence of CpG2006 is: SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT or SEQ ID NO:58: UCGUCGUUUUGUCGUUUUGUCGUU; preferably, the sequence of CpG2006 variant is: GTCGTT; preferably, the sequence of CpG1826 is: SEQ ID NO:59: TCCATGACGTTCCTGACG; preferably, the sequence of CpG2216 is: SEQ ID NO:60: GGGGGACGATCGTCGGGGGG; preferably, the sequence of CpG2395 is: SEQ ID NO:61: TCGTCGTTTTCGGCGCGCGCCG; preferably, the sequence of CpG-ODNT7 is: SEQ ID NO:62: TCGTCGTCGTCGTCGTCGTCG or SEQ ID NO:63: TCGTCGTCGTCGTCGTCGTCGTCG; preferably, the nucleic acid immune stimulant further includes CpG-BYZD: AGCGAA.

[1631] The above siRNA can be all existing known siRNA drugs. In a preferred embodiment of this application, it includes but is not limited to siRNA of any one or more of the following molecules: ASAP1, ATAD2, CD24, CD47, EGFR, HBV, HSP, HS70, PD-L1, PAPP-1, Survivin, TAP, TIM-3, TGF-β1, and VEGF-C. Existing siRNA of the above molecules are all applicable to this application.

[1632] More preferably, the siRNA of ASAP1 is selected from any one of the following: i) sense strand: SEQ ID NO:64: AUUUGCUUCCAUAAUAUCAUU, antisense strand: SEQ ID NO:65: UGAUAUUAUGGAAGCAAAUUU. ii) sense strand: SEQID NO:66: UUAGGUUUGGGGUUGGAUCUU, antisense strand: SEQ ID NO:67: GAUCCAACCCCAAACCUAAUU.

[1633] More preferably, the antisense strand of the siRNA of ATAD2 is SEQ ID NO:68: GCGUCGAAGUUGUAGGAUUUU, and the sense strand is: SEQ ID NO:69: AAUCCUACAACUUCGACGCUU.

[1634] More preferably, the sense strand of the siRNA of CD24 is SEQ ID NO:70: UGUUUACAUUGUUGAGGUAUU, and the antisense strand is SEQ ID NO:71: UACCUCAACAAUGUAAACUUU.

[1635] More preferably, the siRNA of CD47 is selected from any one of the following: i) sense strand: SEQ ID NO:72:

[1636] GGUGAUUACCCAGAGAUAUTT, antisense strand: SEQ ID NO:73:

[1637] AUAUCUCUGGGUAAUCACCTT; ii) sense strand: SEQ ID NO:74:

[1638] UGGUGAAAGAGGUCAUUCCUU, antisense strand: SEQ ID NO:75:

[1639] GGAAUGACCUCUUUCACCAUU; iii) sense strand: SEQ ID NO:76:

[1640] GGAAUGACCUCUUUCACCATT, antisense strand: SEQ ID NO:77:

[1641] UGGUGAAAGAGGUCAUUCCTT; iv) sense strand: SEQ ID NO:78:

[1642] GGUGAUUACCCAGAGAUAUUU, antisense strand: SEQ ID NO:79:

[1643] AUAUCUCUGGGUAAUCACCUU;

[1644] Preferably, the siRNA of EGFR is selected from any one of the following: i) sense strand: SEQ ID NO:80:

[1645] GGCUGGUUAUGUCCUCAUUUU, antisense strand: SEQ ID NO:81:

[1646] AAUGAGGACAUAACCAGCCUU; ii) sense strand: SEQ ID NO:82:

[1647] CCUUAGCAGUCUUAUCUAAUU, antisense strand: SEQ ID NO:83:

[1648] UUAGAUAAGACUGCUAAGGUU; iii) sense strand: SEQ ID NO:84:

[1649] UGCCUUAGCAGUCUUAUCUAAUU, antisense strand: SEQ ID NO:85:

[1650] UUAGAUAAGACUGCUAAGGCAUU; iv) sense strand: SEQ ID NO:86:

[1651] UGCCUUAGCAGUCUUAUCUAAUUUU, antisense strand: SEQ ID NO:87:

[1652] AAUUAGAUAAGACUGCUAAGGCAUU;

[1653] Preferably, the sense strand of the siRNA of HBV is: SEQ ID NO:88:

[1654] GGACUUCUCUCAAUUUUCUUU, antisense strand is: SEQ ID NO:89:

[1655] AGAAAAUUGAGAGAAGUCCUU;

[1656] Preferably, the sense strand of the siRNA of HSP is: SEQ ID NO:90: CGCAGAACACCGUGUUCGAUU, antisense strand is: SEQ ID NO:91: UCGAACACGGUGUUCUGCGUU;

[1657] Preferably, the sense strand of the siRNA of HS70 is: SEQ ID NO:92: GGCCAACAAGAUCACCAUCUU, and the antisense strand is: SEQ ID NO:93: GAUGGUGAUCUUGUUGGCCUU;

[1658] Preferably, the siRNA of PD-L1 is selected from any one of the following: i) sense strand: SEQ ID NO:94:

[1659] CCAGCACACUGAGAAUCAAUU, antisense strand: SEQ ID NO:95:

[1660] UUGAUUCUCAGUGUGCUGGUU; ii) sense strand: SEQ ID NO:96:

[1661] AGACGUAAGCAGUGUUGAATT, antisense strand is: SEQ ID NO:97:

[1662] UUCAACACUGCUUACGUCUTT;

[1663] Preferably, the siRNA of PARP-1 is: sense strand: SEQ ID NO:98:

[1664] GAGGAAGGUAUCAACAAAUTT, antisense strand: SEQ ID NO:99:

[1665] AUUUGUUGAUACCUUCCUCTT;

[1666] Preferably, the siRNA of Survivin is selected from any one of the following: i) sense strand: SEQ ID NO:100:

[1667] GCAGGUUCCUUAUCUGUCACAUU, antisense strand: SEQ ID NO:101:

[1668] UGUGACAGAUAAGGAACCUGCUU; ii) sense strand: SEQ ID NO:102:

[1669] GGAAUUGGAAGGCUGGGAACCUU, antisense strand: SEQ ID NO:103:

[1670] GGUUCCCAGCCUUCCAAUUCCUU; iii) sense strand: SEQ ID NO:104:

[1671] UGCAGGUUCCUUAUCUGUCATT, antisense strand: SEQ ID NO:105:

[1672] UGACAGAUAAGGAACCUGCTT; iv) sense strand: SEQ ID NO:106:

[1673] CUGCAGGUUCCUUAUCUGUCACAUU, antisense strand: SEQ ID NO:107:

[1674] UGUGACAGAUAAGGAACCUGCAGUU;

[1675] Preferably, the siRNA of TAP is selected from any one of the following: i) sense strand: SEQ ID NO:108:

[1676] GCUGCACACGGUUCAGAAUUU, antisense strand: SEQ ID NO:109:

[1677] AUUCUGAACCGUGUGCAGCUU; ii) sense strand: SEQ ID NO:110:

[1678] CAGGAUGAGUUACUUGAAAUU, antisense strand: SEQ ID NO:111:

[1679] UUUCAAGUAACUCAUCCUGUU

[1680] Preferably, the sense strand of the siRNA of TIM-3 is: SEQ ID NO:112:

[1681] GUGCUCAGGACUGAUGAAATT, antisense strand: SEQ ID NO:113:

[1682] UUUCAUCAGUCCUGAGCACTT;

[1683] Preferably, the siRNA of TGF-β1 is selected from any one of the following: i) sense strand: SEQ ID NO:114:

[1684] GUCAACUGUGGAGCAACACUU, antisense strand: SEQ ID NO:115:

[1685] GUGUUGCUCCACAGUUGACUU; ii) sense strand: SEQ ID NO:116:

[1686] GCAACAACGCCAUCUAUGATT, antisense strand: SEQ ID NO:117:

[1687] UCAUAGAUGGCGUUGUUGCTT;

[1688] Preferably, the siRNA of VEGF-C is selected from any one of the following: i) sense strand: SEQ ID NO:118:

[1689] GCAAGACGUUGUUUGAAAUUAUU, antisense strand: SEQ ID NO:119:

[1690] UAAUUUCAAACAACGUCUUGCUU; ii) sense strand: SEQ ID NO:120:

[1691] CAGCAAGACGUUGUUUGAAAUUAUU, antisense strand: SEQ ID NO:121:

[1692] UAAUUUCAAACAACGUCUUGCUGUU; iii) sense strand: SEQ ID NO:122:

[1693] CAGGAUGGUAAAGACUACAUU, antisense strand: SEQ ID NO:123:

[1694] UGUAGUCUUUACCAUCCUGUU.

[1695] The sequences of the above siRNAs are shown in the following table. It should be noted that the sequences in this application are shown from the 5'-3' direction unless otherwise specified. In addition, the meanings of different modification symbols in this application are as follows: * represents phosphorothioate modification of the phosphate backbone (or also called thiophosphate modification), + represents locked nucleic acid modification, and m represents 2'-O-MOE modification.

[1696] Table 1:

[1697]

[1698]

[1699] (Note: When TT is at the end of the sequence in the above table, TT represents dTdT modification, and for the convenience of making the sequence list, it is abbreviated as TT).

[1700] More preferably, the ASO includes one or more of A-miR21, A-miR-10a, A-miR-30c, and AmiR1306, and the miRNA includes one or more of miR-34, miR-542, miR-126, and miR-122.

[1701] More preferably, A-miR21 is selected from any one of the following: i) GATAAGCT, all of which are phosphorothioate-modified or locked nucleic acid-modified; ii) SEQ ID NO: 124: GTCAACATCAGTCTGATAAGCTA; iii) SEQ ID NO: 125: TCAACATCAGTCTGATAAGCTA; iv) T in i) or ii) is replaced by U (i.e., GAUAAGCU, SEQ ID NO: 344: GUCAACAUCAGUCUGAUAAGCUA or SEQ ID NO: 345: UCAACAUCAGUCUGAUAAGCUA).

[1702] More preferably, A-miR-10a is ACAGGGTA, all of which are locked nucleic acid-modified.

[1703] More preferably, A-miR-30c is SEQ ID NO: 126: GCTGAGAGTGTAGGATGTTTACA.

[1704] More preferably, the sequence of miR-34 is: TGTGACAG.

[1705] More preferably, the sequence of miR-542 is: TGGCAGTGT.

[1706] More preferably, the sequence of miR-126 is: UCGUACC, or UCGUACCG; the ribose of each nucleotide has a 2'-O-MOE modification, or CGTACCG or GTCGTT 。

[1707] More preferably, the sequence of miR-122 is: GGAAGTGT.

[1708] More preferably, the sequence of AmiR1306 is: SEQ ID NO: 127: CATCACCACCAGAGCCAACGTC.

[1709] The sequences and modifications of the above miRNAs are specifically shown in the following table.

[1710] Table 2:

[1711]

[1712] In the present application, aptamers include aptamers in the form of DNA or aptamers in the form of RNA. There is no special limitation on the length of any aptamer listed in the present application, and it can be set to 8 - 150 nt according to needs, such as aptamers with any length range of 10 - 100 nt, 15 - 95 nt, 18 - 90 nt, 20 - 88 nt, 25 - 85 nt, 25 - 80 nt, 25 - 75 nt, 25 - 70 nt, 25 - 65 nt, 25 - 60 nt, 25 - 55 nt, 25 - 50 nt, 25 - 45 nt, 25 - 40 nt, etc.

[1713] In some embodiments, aptamers in the form of DNA include aptamers with sequences shown in the following table, or sequences having at least 85% (such as at least over 90%, at least over 95%, or at least over 99%) identity with the shown sequences.

[1714] As used herein, an aptamer refers to a nucleic acid molecule (DNA or RNA) having binding activity to a specific target molecule (such as CD40 or PD - L1). The aptamer can bind to a specific target molecule, thereby inhibiting the activity of the target molecule by, for example, blocking the binding of the target molecule to its cognate ligand, causing a conformational change of the target molecule, and / or blocking the active center of the target molecule. The aptamers of the present application can be in linear or circular form, can be RNA or DNA (such as single - stranded DNA), and can also be modified nucleic acids or mixtures thereof.

[1715] SEQ ID NO:134: GGCAGGAAGACAAACAAGCTTGGCGGCGGGAAGGTGTTTAAATTCCCGGGTCTGCGTGGTCTGT GGTGCTGT

[1716] Table 3:

[1717]

[1718]

[1719]

[1720]

[1721]

[1722]

[1723]

[1724]

[1725] The nucleic acid aptamer in the form of RNA includes aptamers with sequences shown in the following table, or sequences having at least 85% (such as at least over 90%, at least over 95%, or at least over 99%) identity with the shown sequences.

[1726] Table 4:

[1727]

[1728]

[1729]

[1730] In some preferred embodiments, the nucleic acid drug only contains small molecule compounds with targeting effects, while in other preferred embodiments, it only contains nucleic acid aptamers with targeting effects. In still other embodiments, it has both nucleic acid aptamers and small molecule compounds with targeting effects. Specific small molecule compounds with targeting effects include, but are not limited to, one or more of folic acid, biotin, vitamin B12, and mannose. The small molecule compounds with targeting effects are located at the 5' end or 3' end of at least one of the a sequence, b sequence, and c sequence. When it is biotin or folic acid, its role is to make the nucleic acid nanoparticles have targeting properties, such as specifically targeting cancer cells. Malignant tumor tissues require more vitamin B12, and its related receptor (transcobalamin Ⅱ receptor, CD320) is overexpressed in many cancer cells. Therefore, vitamin B12 is a very suitable medium for in vivo tumor diagnosis and treatment. Coupling vitamin B12 to the surface of nucleic acid nanoparticles is a practical method to achieve safety and improve efficiency, including in imaging and therapeutic applications. Mannose itself has the effect of inhibiting cancer cell proliferation.

[1731] It should be noted that various different oligonucleotide effector molecules, according to factors such as single-stranded or double-stranded, sequence length, and secondary structure, when being mounted on the nucleic acid carrier, in order to improve the stability of the carrier after loading the drug or maintain the inherent three-dimensional conformation, are independently mounted on the nucleic acid carrier by any one or more of the following methods: 1) single-stranded adhesive bridge sequence; 2) complementary sequence of the single-stranded adhesive bridge sequence; 3) transition sequence, where the single-stranded adhesive bridge sequence and the transition sequence are the single-stranded adhesive bridge sequence and the transition sequence in the aforementioned nucleic acid carrier.

[1732] The above-mentioned several targeting molecules and attachment methods are helpful to further improve the reliability of targeted delivery of oligonucleotide effector molecules, making them have more superior specificity. Moreover, it also has a further promoting effect on aspects such as attachment...

Claims

1. A nucleic acid vector, characterized in that the nucleic acid vector comprises an a sequence, a b sequence and a c sequence, and the a sequence, the b sequence and the c sequence serve as the backbone sequences of the nucleic acid vector. Any one of the following groups is respectively selected for the self-assembled backbone sequences of the nucleic acid vector: 1) a sequence: SEQ ID NO:21: GCGACGCCCACGAGCGTTCCGGGAGAGGAG, b sequence: SEQ ID NO:22: CTCCTCTCCCGGTTCGCCGCGAGCCGCG, c sequence: SEQ ID NO:23: CGCGGCACGCGGCCATAGCCGTGGGCGTCGC; 2) a sequence: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT, b sequence: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG, c sequence: SEQ ID NO:23: CGCGGCACGCGGCCATAGCCGTGGGCGTCGC; 3) a sequence: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT, b sequence: SEQ ID NO:25: GCTCCTCTCCCGGTTCGCCGCGAGCCGCGT, c sequence: SEQ ID NO:26: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGCT; 4) a sequence: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT, b sequence: SEQ ID NO:25: GCTCCTCTCCCGGTTCGCCGCGAGCCGCGT, c sequence: SEQ ID NO:27: CGCGGCACGCGGCCATAGCCGTGGGCGTCGCT; 5) a sequence: SEQ ID NO:28: GACGCCCACGAGCGTTCCGGGAGAGG, b sequence: SEQ ID NO:29: CCTCTCCCGGTTCGCCGCGAGCC, c sequence: SEQ ID NO:30: GGCTCGCGGCCATAGCCGTGGGCGTC; 6) a sequence: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC, b sequence: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG, c sequence: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC; 7) Sequence a: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT, sequence b: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG, sequence c: SEQ ID NO:26: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGCT; 8) Sequence a: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT, sequence b: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG, sequence c: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC; 9) Sequence a: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT, sequence b: SEQ ID NO:25: GCTCCTCTCCCGGTTCGCCGCGAGCCGCGT, sequence c: SEQ ID NO:26: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGCT; 10) Sequence a: SEQ ID NO:24: GCGACGCCCACGAGCGTTCCGGGAGAGGAGCT, sequence b: SEQ ID NO:25: GCTCCTCTCCCGGTTCGCCGCGAGCCGCGT, sequence c: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC; 11) Sequence a: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC; sequence b: SEQ ID NO:25: GCTCCTCTCCCGGTTCGCCGCGAGCCGCGT; sequence c: SEQ ID NO:26: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGCT; 12) Sequence a: SEQ ID NO:32: CGACGCCCACGAGCGTTCCGGGAGAGGAGC; sequence b: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG; sequence c: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC; 13) Sequence a: SEQ ID NO:33: GCGGCGCCCACGAGCGTTCCGGGAGC; sequence b: SEQ ID NO:34: GCTCCCGGTTCGCCGCCAGCCGCC; c sequence: SEQ ID NO:35: GGCGGCAGGCGGCCATAGCCGTGGGCGCCGC; 14) a sequence: SEQ ID NO:36: GCGGCGCCCACGAGCGTTCCGGGAGAGGCC; b sequence: SEQ ID NO:37: GGCCTCTCCCGGTTCGCCGCCAGCCGCC; c sequence: SEQ ID NO:38: GGCGGCTGGCGGCCATAGCCGTGGGCGCCGC; 15) a sequence: SEQ ID NO:39: GCGGCGCCCACGAGCGTTCCGGGAGAGGCCT; b sequence: SEQ ID NO:40: GGCCTCTCCCGGTTCGCCGCCAGCCGCCT; c sequence: SEQ ID NO:41: GGCGGCTGGCGGCCATAGCCGTGGGCGCCGCT; 16) a sequence: SEQ ID NO:42: GCGGCGCCCACGAGCGUUCCGGGAGAGGCC; b sequence: SEQ ID NO:43: GGCCUCUCCCGGUUCGCCGCCAGCCGCC; c sequence: SEQ ID NO:44: GGCGGCUGGCGGCCAUAGCCGUGGGCGCCGC; 17) a sequence: SEQ ID NO:45: CGACGCCCACGAGCGTTCCGGGAGAGGAG; b sequence: SEQ ID NO:46: CTCCTCTCCCGGTTCGCCGCCAGCCGCC; c sequence: SEQ ID NO:35: GGCGGCAGGCGGCCATAGCCGTGGGCGCCGC; 18) a sequence: SEQ ID NO:36: GCGGCGCCCACGAGCGTTCCGGGAGAGGCC; b sequence: SEQ ID NO:43: GGCCUCUCCCGGUUCGCCGCCAGCCGCC; c sequence: SEQ ID NO:44: GGCGGCUGGCGGCCAUAGCCGUGGGCGCCGC; 19) a sequence: SEQ ID NO:36: GCGGCGCCCACGAGCGTTCCGGGAGAGGCC; b sequence: SEQ ID NO:40: GGCCTCTCCCGGTTCGCCGCCAGCCGCCT; c sequence: SEQ ID NO:38: GGCGGCTGGCGGCCATAGCCGTGGGCGCCGC; 20) Sequence a: SEQ ID NO:36: GCGGCGCCCACGAGCGTTCCGGGAGAGGCC; Sequence b: SEQ ID NO:40: GGCCTCTCCCGGTTCGCCGCCAGCCGCCT; Sequence c: SEQ ID NO:41: GGCGGCTGGCGGCCATAGCCGTGGGCGCCGCT; 21) Sequence a: SEQ ID NO:36: GCGGCGCCCACGAGCGTTCCGGGAGAGGCC; Sequence b: SEQ ID NO:37: GGCCTCTCCCGGTTCGCCGCCAGCCGCC; Sequence c: SEQ ID NO:44: GGCGGCUGGCGGCCAUAGCCGUGGGCGCCGC; 22) Sequence a: SEQ ID NO:33: GCGGCGCCCACGAGCGTTCCGGGAGC; Sequence b: SEQ ID NO:46: CTCCTCTCCCGGTTCGCCGCCAGCCGCC; Sequence c: SEQ ID NO:35: GGCGGCAGGCGGCCATAGCCGTGGGCGCCGC; 23) Sequence a: SEQ ID NO:47: GCGGCGCCCACGAGCGTTCCGGGAGAGGAG; Sequence b: SEQ ID NO:46: CTCCTCTCCCGGTTCGCCGCCAGCCGCC; Sequence c: SEQ ID NO:35: GGCGGCAGGCGGCCATAGCCGTGGGCGCCGC; 24) Sequence a: SEQ ID NO:48: CGCCCACGAGCGTTCCGGGAGA; Sequence b: SEQ ID NO:49: TCTCCCGGTTCGCCGCGAG; Sequence c: SEQ ID NO:50: CTCGCGGCCATAGCCGTGGGCG; 25) Sequence a: SEQ ID NO:51: UCGCCCACGAGCGUUCCGGGAGA; Sequence b: SEQ ID NO:52: UCUCCCGGUUCGCCGCGAG; Sequence c: SEQ ID NO:53: UCUCGCGGCCAUAGCCGUGGGCG; 26) Sequence a: SEQ ID NO:54: GCGCCCACGAGCGTTCCGGGAGAGC; Sequence b: SEQ ID NO:55: CCCUGCTCTCCCGGTTCGCCGCCAGCCGCC; Sequence c: SEQ ID NO:56: GGCGGCAGGCGGCCATAGCCGTGGGCGC.

2. The nucleic acid vector according to claim 1, characterized in that The nucleic acid vector further includes a single-stranded bonding bridge sequence and / or a transition sequence, wherein, the single-stranded bonding bridge sequence is selected from any one or more of the following: 1) Located at the 3' end of the backbone sequence of the a sequence: SEQ ID NO:7: TGTAGCACGGTGGC or its complementary sequence SEQ ID NO:8: GCCACCGTGCTACA; 2) Located at the 3' end of the backbone sequence of the b sequence: SEQ ID NO:9: TCGGCGCGGCCGTG or its complementary sequence SEQ ID NO:10: CACGGCCGCGCCGA; 3) Located at the 3' end of the backbone sequence of the c sequence: i) SEQ ID NO:11: TGCTGCTGCTGCTG or its complementary sequence SEQ ID NO:12: CAGCAGCAGCAGCA; ii) SEQ ID NO:13: CGCGGCTCGCGGCT or its complementary sequence SEQ ID NO:14: AGCCGCGAGCCGCG; wherein, the transition sequence is a sequence formed by consecutive n U, T or A, n is a natural number from 2 to 8, or a sequence of random combination of A, U, T, C and / or G, and the transition sequence is located at the 5' end or 3' end of the backbone sequence.

3. The nucleic acid vector according to claim 2, wherein, n is a natural number from 3 to 6.

4. The nucleic acid vector according to any one of claims 1 to 3, wherein, at least one of the bases, riboses and phosphate esters in the a sequence, the b sequence and the c sequence has at least one modifiable site, and any of the modifiable sites has at least one of the following modifications: -F, methyl, amino, disulfide, carbonyl, carboxyl, mercapto, aldehyde and thio.

5. The nucleic acid vector according to claim 4, wherein, the partial phosphate backbone in the a sequence, b sequence and c sequence has thio modification.

6. The nucleic acid vector according to claim 5, wherein, when the nucleic acid vector is an RNA vector or a DNA-RNA hybrid vector, C and U in the RNA-form sequence in the nucleic acid vector have 2'-F substitution modification, and A and G have 2'-OMe modification.

7. A nucleic acid drug, wherein, the nucleic acid drug is selected from any one of the following: Drug 1): 3*CpG2006-DNA vector, wherein, the DNA vector is the 13) group in the nucleic acid vector according to claim 1, and 3 CpG2006 are respectively connected to the 5' ends of the a sequence, the b sequence and the c sequence through a transition sequence; the sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is thio modification in the phosphate backbone between adjacent two nucleotides; the transition sequence is TTTTT; Drug 2): 2*CpG1826-2*mannose-DNA vector, wherein the DNA vector is the first group of the nucleic acid vectors described in claim 1, and the 2 CpG1826 are respectively connected to the 5'-ends of the a sequence and the c sequence through a linker sequence, and the 2 mannoses are respectively located at the 5'-end and the 3'-end of the b sequence; The linker sequence is TTTTT; The sequence of the CpG1826 is: SEQ ID NO:59: TCCATGACGTTCCTGACG, and there is a thiophosphate modification in the phosphate backbone between adjacent nucleotides; Drug 3): 2*CpG1826-CD40 aptamer-DNA vector, wherein the DNA vector is the first group of the nucleic acid vectors described in claim 1, and the 2 CpG1826 are respectively connected to the 5'-ends of the a sequence and the c sequence through a linker sequence, and the CD40 aptamer is connected to the 5'-end of the b sequence through the linker sequence; The sequence of the CpG1826 is: SEQ ID NO:59: TCCATGACGTTCCTGACG, and there is a thiophosphate modification in the phosphate backbone between adjacent nucleotides; The linker sequence is TTTTT; The sequence of the CD40 aptamer is SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG; Drug 4): 2*CpG2006-CD40 aptamer-DNA vector, wherein the DNA vector is the first group of the nucleic acid vectors described in claim 1, and the 2 CpG2006 are respectively connected to the 5'-ends of the a sequence and the c sequence through a linker sequence, and the CD40 aptamer is connected to the 5'-end of the b sequence through the linker sequence; The sequence of the CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a thiophosphate modification in the phosphate backbone between adjacent nucleotides; The linker sequence is TTTTT; The sequence of the CD40 aptamer is SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG; Drug 5): 4*CpG2006-CD40 aptamer-DNA vector, wherein the DNA vector is the first group of the nucleic acid vectors described in claim 1, and the 2 CpG2006 are concatenated into a CpG2006 dimer, and the 2 CpG2006 dimers are respectively connected to the 5'-ends of the a sequence and the c sequence, and the CD40 aptamer is connected to the 5'-end of the b sequence through a linker sequence; The sequence of the CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a thiophosphate modification in the phosphate backbone between adjacent nucleotides; The linker sequence is TTTTT; The sequence of the CD40 aptamer is SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG; Drug 6): 2*CpG1826 - CD40 aptamer - 2*mannose - DNA vector, wherein the DNA vector is the first group of the nucleic acid vectors described in claim 1, and the two CpG1826 are respectively connected to the 5'-ends of the a sequence and the c sequence through a linker sequence, the CD40 aptamer is connected to the 5'-end of the b sequence through the linker sequence, and the two mannoses are respectively located at the 3'-ends of the b sequence and the c sequence; The sequence of the CpG1826 is: SEQ ID NO:59: TCCATGACGTTCCTGACG, and there is a phosphorothioate modification in the phosphate backbone between adjacent two nucleotides; The linker sequence is TTTTT; The sequence of the CD40 aptamer is SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a phosphorothioate modification in the phosphate backbone between the first three nucleotides at the 5'-end; Drug 7): CpG1826 - CD40 aptamer - mannose - MUC1 aptamer - DNA vector, wherein the DNA vector is the first group of the nucleic acid vectors described in claim 1, the CpG1826 is connected to the 5'-end of the a sequence through a linker sequence, the CD40 aptamer is connected to the 5'-end of the b sequence through the linker sequence, the MUC1 aptamer is connected to the 5'-end of the c sequence through the linker sequence, and the mannose is located at the 3'-end of the c sequence; The sequence of the CpG1826 is: SEQ ID NO:59: TCCATGACGTTCCTGACG, and there is a phosphorothioate modification in the phosphate backbone between adjacent two nucleotides; The linker sequence is TTTTT; The sequence of the CD40 aptamer is SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG; The sequence of the MUC1 aptamer is: SEQ ID NO:208: GCAGTTGATCCTTTGGATACCCTGG; Drug 8) 2*CpG2006 - CD40 aptamer - A - miR21 - 3*mannose - DNA vector, wherein the DNA vector is the first group of the nucleic acid vectors described in claim 1, the two CpG2006 are respectively connected to the 5'-ends of the a sequence and the c sequence through a linker sequence, the CD40 aptamer is connected to the 5'-end of the b sequence through the linker sequence, the A - miR21 is directly connected to the 3'-end of the b sequence, and the three mannoses are respectively connected to the 3'-ends of the a sequence, the A - miR21 and the c sequence; The sequence of the CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent two nucleotides; The transition sequence is TTTTT; The sequence of the CD40 aptamer is SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG; The sequence of the A-miR21 is GATAAGCT, where each position is modified with locked nucleic acid; Drug 9): 2*CpG2006 - CD40 aptamer - CD16a aptamer - CTLA-4 aptamer - DNA vector, wherein the DNA vector is the 2) group of the nucleic acid vectors described in claim 1, and the 2 CpG2006 are respectively connected to the 5' ends of the a sequence and the c sequence through the transition sequence, the CD40 aptamer is connected to the 3' end of the b sequence through the transition sequence, the CD16a aptamer is connected to the 5' end of the b sequence through the transition sequence, and the CTLA-4 aptamer is connected to the 3' end of the c sequence through the transition sequence; The sequence of the CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a thiophosphate modification in the phosphate backbone between adjacent nucleotides; The transition sequence is TTTTT; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, with a thiophosphate modification between the first 2 positions at the 5' end; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a thiophosphate modification in the phosphate backbone between the last 2 nucleotides at the 3' end; The sequence of the CTLA-4 aptamer is: SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, and there is a thiophosphate modification in the phosphate backbone between the 2nd and 3rd nucleotides starting from the 3' end; Drug 10): 2*CpG2006 - CTLA-4 aptamer - PD-L1 aptamer - DNA vector, wherein, The DNA vector is the 3) group of the nucleic acid vectors described in claim 1, the 2 CpG2006 are concatenated into a CpG2006 dimer, the CpG2006 dimer is connected to the 5' end of the a sequence through the transition sequence, the PD-L1 aptamer is connected to the 5' end of the c sequence through the transition sequence, and the CTLA-4 aptamer is connected to the 5' end of the b sequence through the transition sequence; The sequence of the CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a thiophosphate modification in the phosphate backbone between adjacent nucleotides; The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, with a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end; The sequence of the CTLA-4 aptamer is: SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, with a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end; The sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, with a phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The transition sequence is TTTTT; Drug 11): CpG2006-CD40 aptamer-PD-L1 aptamer-DNA vector, selected from any one of the following structures: i) CCPD3: The DNA vector is the 12)th group of the nucleic acid vectors described in claim 1. The CpG2006 is linked to the 5'-end of the a sequence through the transition sequence, the PD-L1 aptamer is linked to the 5'-end of the c sequence through the transition sequence, and the CD40 aptamer is linked to the 5'-end of the b sequence through the transition sequence; wherein, In the DNA vector, there is a phosphorothioate modification in the phosphate backbone between the first 3 nucleotides at the 3'-ends of the a sequence, the b sequence, and the c sequence; The sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, with a phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, with a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5'-end; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, with a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5'-end; The transition sequence is TTTTT; Or ii) CCPD3 variant 1: The DNA vector is the 12)th group of the nucleic acid vectors described in claim 1. The CpG2006 is linked to the 5'-end of the a sequence through the transition sequence TTTTT, and the CD40 aptamer is linked to the 5'-end of the b sequence through the transition sequence TTTTT; the PD-L1 aptamer is linked to the 5'-end of the c sequence through the transition sequence ATTT, wherein, In the DNA vector, there is a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 3'-ends of the a sequence, the b sequence, and the c sequence; The sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent two nucleotides; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5'-end; The sequence of the PD-L1 aptamer is: SEQ ID NO:238: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGG, and there is a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; Or iii) CCPD3 variant 2: The sequence of the DNA vector is: a sequence: SEQ ID NO:295: GCCCACGAGCGTTCCGGGAGA; b sequence: SEQ ID NO:49: TCTCCCGGTTCGCCGCGAG; c sequence: SEQ ID NO:296: CTCGCGGCCATAGCCGTGGGC; The CpG2006 is linked to the 5'-end of the a sequence through the spacer sequence TTTT, the CD40 aptamer is linked to the 5'-end of the b sequence through the spacer sequence TTTT, and the PD-L1 aptamer is linked to the 5'-end of the c sequence through the spacer sequence TTTT, The sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent two nucleotides; The sequence of the CD40 aptamer is: SEQ ID NO:156: GCCAACGAGTAGGCGATAGCGCGTGGC, and there is a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a phosphorothioate modification in the phosphate backbone between the first 5 adjacent nucleotides at the 5'-end; Or iv) CCPD3 variant 3: The sequence of the DNA vector is: a sequence: SEQ ID NO:295: GCCCACGAGCGTTCCGGGAGA; b sequence: SEQ ID NO:49: TCTCCCGGTTCGCCGCGAG; c sequence: SEQ ID NO:296: CTCGCGGCCATAGCCGTGGGC; The CpG2006 is linked to the 5'-end of the a sequence through the spacer sequence TTTT, the CD40 aptamer is linked to the 5'-end of the b sequence through the spacer sequence TTTT; the PD-L1 aptamer is linked to the 5'-end of the c sequence through the spacer sequence TTTT, The sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, with phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The sequence of the CD40 aptamer is: SEQ ID NO:156: GCCAACGAGTAGGCGATAGCGCGTGGC, with phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; The sequence of the PD-L1 aptamer is: SEQ ID NO:246: GGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCC, with phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; v) CCPD3 variant 4: The sequence of the DNA vector is: a sequence: SEQ ID NO:295: GCCCACGAGCGTTCCGGGAGA; b sequence: SEQ ID NO:49: TCTCCCGGTTCGCCGCGAG; c sequence: SEQ ID NO:296: CTCGCGGCCATAGCCGTGGGC; The CpG2006 is linked to the 5'-end of the a sequence through the spacer sequence TTTT, and the CD40 aptamer is linked to the 5'-end of the b sequence through the spacer sequence TTTT; the PD-L1 aptamer is linked to the 5'-end of the c sequence through the spacer sequence TTTT, The sequence of CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, with phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The sequence of the CD40 aptamer is: SEQ ID NO:156: GCCAACGAGTAGGCGATAGCGCGTGGC, with phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; The sequence of the PD-L1 aptamer is: SEQ ID NO:248: TACAGGTTCTGGGGGGTGGGTGGGGAACCTGTT, with phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; vi) CCPD3 variant 5: The sequence of the DNA vector is: a sequence: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC; b sequence: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG; c sequence: SEQ ID NO:20: CAGCAGCAGCAGCA CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC, wherein, SEQID NO:12: CAGCAGCAGCAGCA is a single-stranded linker sequence; The CpG2006 is connected to the 5'-end of the a sequence through the spacer sequence TTTT, the CD40 aptamer is connected to the 5'-end of the b sequence through the spacer sequence TTTTT, the PD-L1 aptamer is connected to the 3'-end of the complementary sequence of the single-stranded linker sequence through the spacer sequence TTTTT, and is connected to the 5'-end of the c sequence through complementary base pairing between the single-stranded linker sequence and its complementary sequence; The sequence of the CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a phosphorothioate modification in the phosphate backbone between the first 5 adjacent nucleotides at the 5'-end; The complementary sequence of the single-stranded linking bridge sequence - the sequence of the PD-L1 aptamer is: SEQ ID NO: 297: TGCTG CTGCTGCTG TTTTTACGGGCCACATCAACTCATTGATAGACAATGCGTCCAC TGCCCGT, with phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 3' end, where SEQ ID NO:11: TGCTGCTGCTGCTG is The complementary sequence of the single-stranded linker sequence; vii) CCPD3 variant 6: The sequence of the DNA vector is: a sequence: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC; b sequence: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG; c sequence: SEQ ID NO:20: CAGCAGCAGCAGCA CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC, wherein, SEQ ID NO:12: CAGCAGCAGCAGCA is the single-stranded linker sequence; The CpG2006 is connected to the 5'-end of the a sequence through the spacer sequence TTTT, the CD40 aptamer is connected to the 5'-end of the b sequence through the spacer sequence TTTTT, the PD-L1 aptamer is connected to the 3'-end of the complementary sequence of the single-stranded linker sequence through the spacer sequence TTTTT, and is connected to the 5'-end of the c sequence through complementary base pairing between the single-stranded linker sequence and its complementary sequence; The sequence of the CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a phosphorothioate modification in the phosphate backbone between the first 5 adjacent nucleotides at the 5'-end; The complementary sequence of the single-stranded linker sequence -TTTTT- the sequence of the PD-L1 aptamer is: SEQ ID NO:298: TGCTGCTGCTGCTG TTTTTTACAGGTTCTGGGGGGTGGGTGGGGAACCTGTT, there is a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 3' end, where SEQ ID NO:11: TGCTGCTGCTGCTG is The complementary sequence of the single-stranded linker sequence; viii) CCPD3 variant 7: The sequence of the DNA vector is: a sequence: SEQ ID NO:15: GACGCCCACGAGCGTTCCGGGAGAGGTGTAGCACGGTGGC, wherein, SEQ ID NO:7: TGTAGCACGGTGGC is single-stranded linker bridge sequence A; b sequence: SEQ ID NO:16: CCTCTCCCGGTTCGCCGCGAGCCTCGGCGCGGCCGTG, wherein, SEQ ID NO:9: TCGGCGCGGCCGTG is single-stranded linker bridge sequence B; c sequence: SEQ ID NO:17: GGCTCGCGGCCATAGCCGTGGGCGTCTGCTGCTGCTGCTG, wherein, SEQ IDNO:11: TGCTGCTGCTGCTG is single-stranded linker bridge sequence C; The CpG2006 is connected to the 5'-end of the complementary sequence C' of the single-stranded linker bridge C sequence through a transition sequence, and the CpG2006 is connected to the 3'-end of the c sequence through complementary base pairing between the complementary sequence C' and the single-stranded linker bridge C sequence; The PD-L1 aptamer is sequentially connected to the transition sequence and the complementary sequence B' of the single-stranded linker bridge sequence B, and the PD-L1 aptamer is connected to the 3'-end of the b sequence through complementary base pairing between the complementary sequence B' and the single-stranded linker bridge sequence B; The CD40 aptamer is sequentially connected to the transition sequence and the complementary sequence A' of the single-stranded linker bridge sequence A, and the CD40 aptamer is connected to the 3'-end of the a sequence through complementary base pairing between the complementary sequence A' and the single-stranded linker bridge sequence A; The sequence of the CpG2006 is: SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a thiophosphate modification in the phosphate backbone between adjacent nucleotides; The sequence of the CD40 aptamer is: SEQ ID NO:156: GCCAACGAGTAGGCGATAGCGCGTGGC, and there is a thiophosphate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a thiophosphate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; The transition sequence is TTTTT; iv) CCPD3 - variant 8, a sequence is: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC; b sequence is: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG; c sequence is: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC; The CpG2006 is connected to the 5'-end of the a sequence through a linker sequence, the CD40 aptamer is connected to the 5'-end of the b sequence through the linker sequence, and the PD-L1 aptamer is connected to the 5'-end of the c sequence through the linker sequence shown. The sequence of the CpG2006 is: SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent nucleotides. The sequence of the CD40 aptamer is: SEQ ID NO:156: GCCAACGAGTAGGCGATAGCGCGTGGC, and there is a 2'-O-MOE modification on the ribose of the first 4 nucleotides at the 5'-end, and there is a 5-methyl modification on the base of the nucleotide corresponding to Cm. The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a 2'-O-MOE modification on the ribose of the first 4 nucleotides at the 5'-end, and there is a 5-methyl modification on the base of the nucleotide corresponding to Cm. The linker sequence is TTTTT. v) CCPD3-variant 9 The a sequence is: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC. The b sequence is: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG. The c sequence is: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC. The CpG2006 is connected to the 5'-end of the a sequence through a linker sequence, the CD40 aptamer is connected to the 5'-end of the b sequence through the linker sequence, and the PD-L1 aptamer is connected to the 5'-end of the c sequence through the linker sequence shown. The sequence of the CpG2006 is: SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent nucleotides. The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a 2'-O-MOE modification on the ribose of the first 5 nucleotides at the 5'-end, and there is a 5-methyl modification on the bases of the nucleotides corresponding to 3 Cm. The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a 2'-O-MOE modification on the ribose of the first 5 nucleotides at the 5'-end, and there is a 5-methyl modification on the base of the nucleotide corresponding to 1 Cm. The linker sequence is TTTTT. v) CCPD3-variant 10 The sequence of a is: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC; The sequence of b is: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG; The sequence of c is: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC; The CpG2006 is connected to the 5'-end of the a sequence through a spacer sequence, the CD40 aptamer is connected to the 5'-end of the b sequence through the spacer sequence, and the PD-L1 aptamer is connected to the 5'-end of the c sequence through the spacer sequence shown. The sequence of the CpG2006 is: SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a 2'-O-MOE modification on the ribose of the first 5 nucleotides at the 5'-end, and there is a 5-methyl modification on the bases of the nucleotides corresponding to 3 Cm; The sequence of the PD-L1 aptamer is: SEQ ID NO:249: CTACGAGACGAACTTATGCGTAATAATGACTGTCGTAG, and there is a 2'-O-MOE modification on the ribose of the first 5 nucleotides at the 5'-end, and there is a 5-methyl modification on the bases of the nucleotides corresponding to 1 Cm; The spacer sequence is TTTTT; vii) CCPD3-variant 11, The sequence of a is: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC; The sequence of b is: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG; The sequence of c is: SEQ ID NO:299: CGCGGCTCGCGGCT CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC, with the underlined part being the linker sequence; The CpG2006 is connected to the 5'-end of the a sequence through a spacer sequence, the CD40 aptamer is connected to the 5'-end of the b sequence through the spacer sequence, and the PD-L1 aptamer is connected to the 3'-end of the complementary sequence SEQ ID NO:14: AGCCGCGAGCCGCG of the linker sequence and is connected to the 5'-end of the c sequence through complementary base pairing with the complementary sequence of the linker sequence. The sequence of the CpG2006 is: SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a 2'-O-MOE modification on the ribose of the first 5 nucleotides at the 5'-end; The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a 2'-O-MOE modification on the ribose of the first 1-5 nucleotides at the 3' end; The transition sequence is TTTTT; viii) CCPD3 - Variant 12, The a sequence is: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC; The b sequence is: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG; The c sequence is: SEQ ID NO:299: CGCGGCTCGCGGCT CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC, where the underlined part is the linker sequence; CpG2006 is connected to the 5' end of the a sequence through the transition sequence, the CD40 aptamer is connected to the 5' end of the b sequence through the transition sequence, the PD-L1 aptamer is connected to the 3' end of the complementary sequence SEQ ID NO:14: AGCCGCGAGCCGCG of the linker sequence through the transition sequence, and is connected to the 5' end of the c sequence by complementary base pairing with the complementary sequence of the linker sequence; The sequence of the CpG2006 is: SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification on the phosphate backbone between adjacent nucleotides; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a 2'-O-MOE modification on the ribose of the first 5 nucleotides at the 5' end; The sequence of the PD-L1 aptamer is: SEQ ID NO:249: CTACGAGACGAACTTATGCGTAATAATGACTGTCGTAG, and there is a 2'-O-MOE modification on the ribose of the first 1-5 nucleotides at the 3' end; The transition sequence is TTTTT; Drug 12): CD16a aptamer - CTLA4 aptamer - CpG2006 - DNA vector, wherein, The DNA vector is selected from Group 4) of the nucleic acid vectors described in Claim 1. The CD16a aptamer is connected to the 5' end of the a sequence through the transition sequence, and the CTLA-4 aptamer is connected to the 5' end of the b sequence through the transition sequence; the CpG2006 is connected to the 5' end of the c sequence through the transition sequence, wherein, In the DNA vector, there is a phosphorothioate modification on the phosphate backbone between the 3' end of the a sequence, the 3' end of the b sequence and the first 2 nucleotides at the 3' end of the c sequence; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is a phosphorothioate modification on the phosphate backbone between the first 2 nucleotides at the 5' end; The sequence of the CTLA-4 aptamer is: SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end, C and U are 2'-F modifications, and A and G are 2'-OME modifications; The sequence of the CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, with a phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The transition sequence is TTTTT; Drug 13): 2*CpG2006-CD40 aptamer-PD-L1 aptamer-C12 aptamer-DNA vector, where The DNA vector is selected from group 5) of the nucleic acid vectors described in claim 1. The two CpG2006 are respectively connected to the 5'-ends of the a sequence and the c sequence through the transition sequence. The CD40 aptamer is located at the 5'-end of the b sequence, where In the DNA vector, there is a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 3'-ends of the a sequence, the b sequence, and the c sequence; The PD-L1 aptamer is successively connected to the complementary sequence B' of the transition sequence and the single-stranded linker sequence B. The single-stranded linker sequence B is located at the 3'-end of the b sequence. The PD-L1 aptamer is connected to the 3'-end of the b sequence through the complementary pairing of the complementary sequence B' with the single-stranded linker sequence B. The C12 aptamer is successively connected to the complementary sequence C' of the transition sequence and the single-stranded linker sequence C. The single-stranded linker sequence C is located at the 3'-end of the c sequence. The C12 aptamer is connected to the 3'-end of the c sequence through the complementary pairing of the complementary sequence C' with the single-stranded linker sequence C; The sequence of the CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, with a phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The transition sequence is TTTTT; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, with a phosphorothioate modification in the phosphate backbone between the first three adjacent nucleotides at the 5'-end; The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, with a phosphorothioate modification in the phosphate backbone between the first three adjacent nucleotides at the 5'-end; The sequence of the C12 aptamer is: SEQ ID NO:164: GTGGATTGTTGTGTTCTGTTGGTTTTTGTGTTGTC, with a phosphorothioate modification in the phosphate backbone between the first three adjacent nucleotides at the 5'-end; The single-stranded linker bridge sequence B is: SEQ ID NO:7: TGTAGCACGGTGGC, and the complementary sequence B' is SEQ ID NO:8: GCCACCGTGCTACA; The single-stranded linker bridge sequence C is: SEQ ID NO:11: TGCTGCTGCTGCTG, and the complementary sequence C' is SEQ ID NO:12: CAGCAGCAGCAGCA; Drug 14): CpG2006-C12 aptamer-CD47 siRNA-PD-L1 aptamer-PD-L1 siRNA-DNA vector, wherein, the DNA vector is selected from Group 6) of the nucleic acid vectors described in Claim 1, the CpG2006 is linked to the 5' end of the a sequence through a transition sequence, the C12 aptamer is linked to the antisense strand of the CD47 siRNA through a transition sequence, the sense strand of the CD47 siRNA is located at the 5' end of the b sequence, the antisense strand of the CD47 siRNA links the C12 aptamer and the CD47 siRNA to the 5' end of the b sequence by complementarity with the sense strand of the CD47 siRNA, the sense strand of the PD-L1 siRNA is linked to the 5' end of the c sequence, and the PD-L1 aptamer is linked to the antisense strand of the PD-L1 siRNA through the transition sequence, wherein, in the DNA vector, there is a phosphorothioate modification in the phosphate backbone between the 3' ends of the a sequence, the 3' ends of the b sequence, and the first 3 nucleotides before the 3' ends of the c sequence; The sequence of the C12 aptamer is: SEQ ID NO:164: GTGGATTGTTGTGTTCTGTTGGTTTTTGTGTTGTC, and there is a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5' end; The antisense strand of the CD47 siRNA is: SEQ ID NO:79: AUAUCUCUGGGUAAUCACCUU, the sense strand is: SEQ ID NO:78: GGUGAUUACCCAGAGAUAUUU, there is a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5' end of the antisense strand of the CD47 siRNA, there is a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5' end of the sense strand of the CD47 siRNA, and there is a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 3' end; The sequence of the PD-L1 aptamer is: SEQ ID NO:239: GCCCCAGTTATGCTTTCCCCCTCTGTCTCTTTG, and there is a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5' end; The sense strand of the PD-L1 siRNA is: SEQ ID NO:94: CCAGCACACUGAGAAUCAAUU, and the antisense strand is: SEQ ID NO:95: UUGAUUCUCAGUGUGCUGGUU. There is a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5' end of the sense strand of the PD-L1 siRNA, and there is a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 3' end; there is a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5' end of the antisense strand of the PD-L1 siRNA; The sequence of the CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent two nucleotides; The transition sequence is TTTTT; Drug 15): 2*CpG2006-CD40 aptamer-CD16a aptamer-DNA vector, wherein, The DNA vector is selected from Group 7) of the nucleic acid vectors described in Claim 1. The 2 CpG2006 are respectively connected to the 5' ends of the a sequence and the c sequence through the transition sequence. The CD40 aptamer is connected to the 5' end of the b sequence through the transition sequence. The CD16a aptamer is connected to the 3' end of the b sequence through the transition sequence, wherein, There is a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 3' ends of the a sequence and the c sequence of the DNA vector; The sequence of the CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent two nucleotides; The transition sequence is TTTTT; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 3' end; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a phosphorothioate modification in the phosphate backbone between the last 2 nucleotides at the 5' end; Drug 16): 2*CpG2006-CD40 aptamer-CD16a aptamer-FAP aptamer-DNA vector, wherein, The DNA vector is selected from Group 8) of the nucleic acid vectors described in Claim 1. The 2 CpG2006 are respectively connected to the 5' ends of the a sequence and the c sequence through the transition sequence. The CD40 aptamer is connected to the 5' end of the b sequence through the transition sequence. The CD16a aptamer is connected to the 3' end of the b sequence through the transition sequence. The FAP aptamer is connected to the 3' end of the c sequence through the transition sequence, wherein, There is a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 3'-end of the a sequence of the DNA vector; The sequence of the CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The transition sequence is TTTTT; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 3'-end; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a phosphorothioate modification in the phosphate backbone between the last 2 nucleotides at the 5'-end; The sequence of the FAP aptamer is: SEQ ID NO:188: CCGCTCGAGCTAGTCTGACAAAGAGAAACAC, and there is a phosphorothioate modification in the phosphate backbone between the last 2 nucleotides at the 3'-end; Drug 17): 2*CpG2006-VEGF aptamer-CD40 aptamer-PD-L1 aptamer-CD16a aptamer-DNA vector, wherein, The DNA vector is selected from group 6) of the nucleic acid vectors described in claim 1. The 2 CpG2006 are respectively connected to the 5'-ends of the a sequence and the c sequence through the transition sequence. The CD40 aptamer is connected to the 5'-end of the b sequence through the transition sequence. The PD-L1 aptamer is connected to the 3'-end of the b sequence through the transition sequence. The CD16a aptamer is connected to the 3'-end of the c sequence through the transition sequence. The VEGF aptamer is connected to the 3'-end of the a sequence through the transition sequence. The sequence of the CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and there is a phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The VEGF aptamer: SEQ ID NO:279: GGTGGGGGTGGACGGGCCGGGTAGA, and there is a phosphorothioate modification in the phosphate backbone between the last 2 nucleotides at the 3'-end; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end; The sequence of the PD-L1 aptamer is SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a phosphorothioate modification in the phosphate backbone between the last 2 nucleotides at the 3'-end; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, with a phosphorothioate modification in the phosphodiester backbone between the last two nucleotides at the 3'-end; Drug 18): 2*A-miR21-TTA1 aptamer-DNA vector, wherein the DNA vector is the 13th group among the nucleic acid vectors described in claim 1, and the two A-miR21 are directly connected to the 5'-ends of the a sequence and the c sequence respectively, and the TTA1 aptamer is connected to the 5'-end of the b sequence through a spacer sequence, The spacer sequence is TTTTT; The sequence of the A-miR21 is GATAAGCT, and each nucleotide has a locked nucleic acid modification; The sequence of the TTA1 aptamer is: SEQ ID NO:266: CTGCACTTGGCTTGGATTTCAGAAGGGAGACCC; Drug 19): 2*A-miR21-3*biotin-DNA vector, wherein, The DNA vector is the 13th group among the nucleic acid vectors described in claim 1, and the two A-miR21 are directly connected to the 5'-ends of the a sequence and the c sequence respectively, and the three biotins are connected to the 5'-end, 3'-end of the b sequence and the 3'-end of the c sequence respectively, The sequence of the A-miR21 is GATAAGCT, and each position has a locked nucleic acid modification; Drug 20): 2*A-miR21-4*biotin-DNA vector, wherein, The DNA vector is the 13th group among the nucleic acid vectors described in claim 1, and the two A-miR21 are directly connected to the 5'-ends of the a sequence and the c sequence respectively, and the four biotins are connected to the 3'-end of the a sequence, the 5'-end and 3'-end of the b sequence and the 3'-end of the c sequence respectively, The sequence of the A-miR21 is GATAAGCT, and each position has a locked nucleic acid modification; Drug 21): 2*A-miR21-AS1411 aptamer-DNA vector, wherein, The DNA vector is the 1st group among the nucleic acid vectors described in claim 1, and the two A-miR21 are directly connected to the 5'-ends of the a sequence and the c sequence respectively, and the AS1411 aptamer is connected to the 5'-end of the b sequence through a spacer sequence, The spacer sequence is TTTTT; The sequence of the A-miR21 is GATAAGCT, and each position has a locked nucleic acid modification; The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG; Drug 22): 2*A-miR21-AS1411 aptamer-DNA vector, wherein, The DNA vector is the 23rd group among the nucleic acid vectors described in claim 1, and the two A-miR21 are directly connected to the 5'-ends of the a sequence and the c sequence respectively, and the AS1411 aptamer is connected to the 5'-end of the b sequence through a spacer sequence, The transition sequence is TTTTT; The sequence of A-miR21 is GATAAGCT, where the 1st, 3rd - 5th positions have 2'-OME modification, and the 2nd, 6th - 8th positions have 2'-F substitution modification; The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG; Drug 23): 2*A-miR21-AS1411 aptamer-biotin-DNA vector, where the DNA vector is the 13th group of the nucleic acid vectors described in claim 1, two A-miR21 are directly connected to the 5' ends of the a sequence and the c sequence respectively, the AS1411 aptamer is connected to the 5' end of the b sequence through a transition sequence, and the biotin is connected to the 3' end of the c sequence; The transition sequence is TTTTT; The sequence of A-miR21 is GATAAGCT, where each position has locked nucleic acid modification; The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG; Drug 24): 2*A-miR21-CD40 aptamer-DNA vector, where the DNA vector is the 13th group of the nucleic acid vectors described in claim 1, two A-miR21 are directly connected to the 5' ends of the a sequence and the c sequence respectively, and the CD40 aptamer is connected to the 5' end of the b sequence through a transition sequence; The transition sequence is TTTTT; The sequence of A-miR21 is GATAAGCT, where each position has locked nucleic acid modification; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG; Drug 25): 2*A-miR21-MUC1 aptamer-3*biotin-DNA vector, where the DNA vector is the 13th group of the nucleic acid vectors described in claim 1, two A-miR21 are directly connected to the 5' ends of the a sequence and the c sequence respectively, and the MUC1 aptamer is connected to the 5' end of the b sequence through a transition sequence; The transition sequence is TTTTT; The sequence of A-miR21 is GATAAGCT, where each position has locked nucleic acid modification; The sequence of the MUC1 aptamer is: SEQ ID NO:208: GCAGTTGATCCTTTGGATACCCTGG; Drug 26): A-miR21-AS1411 aptamer-A15 aptamer-2*biotin-DNA vector, where The DNA vector is the 13th group among the nucleic acid vectors described in claim 1. The A-miR21 is directly linked to the 5'-end of the a sequence. The AS1411 aptamer and the A15 aptamer are respectively linked to the 5'-end of the b sequence and the 5'-end of the c sequence through a spacer sequence. Two of the biotins are respectively linked to the 3'-end of the b sequence and the 3'-end of the c sequence; The spacer sequence is TTTTT; The sequence of the A-miR21 is GATAAGCT, with each position being a locked nucleic acid modification; The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG; The sequence of the A15 aptamer is: SEQ ID NO:129: CCCTCCTACATAGGG; Drug 27): 2*mannose-2*A-miR21-DNA vector, wherein, The DNA vector is the 13th group among the nucleic acid vectors described in claim 1. Two of the mannoses are respectively linked to the 5'-end and the 3'-end of the b sequence. Two of the A-miR21s are respectively directly linked to the 5'-ends of the a sequence and the c sequence; The sequence of the A-miR21 is GATAAGCT, with each position being a locked nucleic acid modification; Drug 28): 2*mannose-A15 aptamer-2*A-miR21-DNA vector, wherein, The DNA vector is the 13th group among the nucleic acid vectors described in claim 1. The A15 aptamer is linked to the 5'-end of the b sequence through a spacer sequence. Two of the mannoses are respectively linked to the 5'-end of the A15 aptamer and the 3'-end of the b sequence. Two of the A-miR21s are respectively directly linked to the 5'-ends of the a sequence and the c sequence; The sequence of the A-miR21 is GATAAGCT, with each position being a locked nucleic acid modification; The sequence of the A15 aptamer is: SEQ ID NO:129: CCCTCCTACATAGGG; Drug 29): 2*mannose-survivin siRNA-DNA vector, wherein, The DNA vector is the 13th group among the nucleic acid vectors described in claim 1. Two of the mannoses are respectively linked to the 5'-end and the 3'-end of the b sequence. The sense strand of the survivin siRNA is linked to the 3'-end of the c sequence. The antisense strand of the survivin siRNA is linked to the 3'-end of the c sequence by complementary base pairing with the sense strand of the survivin siRNA; The sense strand of the survivin siRNA is: SEQ ID NO:104: UGCAGGUUCCUUAUCUGUCATT, The antisense strand of the survivin siRNA is: SEQ ID NO:105: UGACAGAUAAGGAACCUGCTT, and the 3'-terminal TT of both the sense strand and the antisense strand of the survivin siRNA is modified with dTdT; Drug 30): 2*mannose-A15 aptamer-survivin siRNA-DNA vector, wherein, the DNA vector is the 22) group in the nucleic acid vector described in claim 1, the A15 aptamer is connected to the 5'-end of the b sequence through the linker sequence TTTTT, 2 mannoses are respectively connected to the 5'-end of the A15 aptamer and the 3'-end of the b sequence, the sense strand of the survivin siRNA is connected to the 3'-end of the c strand, and the antisense strand of the survivin siRNA is connected to the 3'-end of the c strand by complementary pairing with the sense strand of the survivin siRNA; the sense strand of the survivin siRNA is: SEQ ID NO:104: UGCAGGUUCCUUAUCUGUCATT; the antisense strand of the survivin siRNA is: SEQ ID NO:105: UGACAGAUAAGGAACCUGCTT; the TT at the 3'-ends of the antisense strand and the sense strand of the survivin siRNA are both modified with dTdT; the sequence of the A15 aptamer is: SEQ ID NO:129: CCCTCCTACATAGGG; Drug 31): AS1411 aptamer-survivin siRNA-PSMA aptamer-3*A-miR21-RNA vector, wherein, the DNA vector is the 16) group in the nucleic acid vector described in claim 1, the PSMA aptamer is connected to the 3'-end of the a sequence through the linker sequence AA, 3 A-miR21 are connected in series to the 3'-end of the b sequence through the linker sequence AA, the sense strand of the survivin siRNA is connected to the 3'-end of the c sequence through the linker sequence AAA, the AS1411 aptamer is connected to the antisense strand of the survivin siRNA through the linker sequence TT, and is connected to the 3'-end of the c sequence by complementary pairing of the antisense strand of the survivin siRNA and the sense strand of the survivin siRNA, wherein, the first 2 nucleotides at the 5'-ends of the a sequence, the b sequence and the c sequence of the DNA vector each independently have a thiophosphate modification; the sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG; The sense strand of the survivin siRNA is: SEQ ID NO:100: GCAGGUUCCUUAUCUGUCACAUU, and the antisense strand of the survivin siRNA is: SEQ ID NO:300: UGUGACAGAUAAGGAACCUGCAG. The sense strand and the antisense strand of the survivin siRNA both have thiophosphate modifications between the first 3 positions at the 5'-end and the last 3 positions at the 3'-end; The sequence of the PSMA aptamer is: SEQ ID NO:234: GGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUCCC, and there is a thiophosphate modification in the phosphate backbone between the last 2 nucleotides at the 3'-end; The sequence of the A-miR21 is: GAUAAGCU, and there is a thiophosphate modification in the phosphate backbone between adjacent nucleotides; Drug 32): 3*A-miR21-ATP aptamer-FGF2 aptamer-DNA vector, wherein, The DNA vector is the 15th group in the nucleic acid vectors described in claim 1. Three A-miR21s are connected in series directly to the 5'-end of the a sequence. The ATP aptamer is connected to the 5'-end of the b sequence through the linker sequence TTTTT. The FGF2 aptamer is connected to the 5'-end of the c sequence through U, wherein, The first 2 nucleotides at the 3'-ends of the a sequence, the b sequence and the c sequence of the DNA vector each independently have thiophosphate modifications; The sequence of the ATP aptamer is: SEQ ID NO:135: ACCTGGGGAGTATTGGGGAGGAAGG, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end; The sequence of the FGF2 aptamer is: SEQ ID NO:183: GGGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCCC, and there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end; The sequence of the A-miR21 is: GATAAGCT, and there is a thiophosphate modification in the phosphate backbone between adjacent nucleotides; Drug 33): AS1411 aptamer-Survivin siRNA-PSMA aptamer-3*A-miR21-DNA-RNA hybrid vector, wherein, The DNA-RNA hybrid vector is the 18th group among the nucleic acid vectors described in claim 1. The PSMA aptamer is linked to the 3'-end of the a sequence through the spacer sequence AA. Three tandem A-miR21 are linked to the 3'-end of the b sequence through the spacer sequence AA. The sense strand of the Survivin siRNA is linked to the 3'-end of the c sequence through the spacer sequence AAAA. The AS1411 aptamer is linked to the 5'-end of the antisense strand of the Survivin siRNA through the spacer sequence AA. The antisense strand of the Survivin siRNA is complementary base-paired with the sense strand of the Survivin siRNA. Among them, The first two nucleotides at the 5'-ends of the b sequence and the c sequence of the DNA vector each independently have phosphorothioate modification; The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, and there is phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end; The antisense strand of the Survivin siRNA is: SEQ ID NO:300: UGUGACAGAUAAGGAACCUGCAG; the sense strand is: SEQ ID NO:100: GCAGGUUCCUUAUCUGUCACAUU; there is phosphorothioate modification in the phosphate backbone between the first three adjacent nucleotides at the 5'-end and between the last three adjacent nucleotides at the 3'-end of both the sense strand and the antisense strand of the Survivin siRNA; The sequence of the PSMA aptamer is: SEQ ID NO:234: GGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUCCC, C and U have 2'-F modification, A and G have 2'-OME modification, and there is phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 3'-end; The sequence of the A-miR21 is: GAUAAGCU, and there is phosphorothioate modification in the phosphate backbone between adjacent nucleotides; Drug 34): 3*A-miR21-AS1411 aptamer-FAP aptamer-DNA vector, where, The RNA vector is the 15th group among the nucleic acid vectors described in claim 1. Three tandem A-miR21 are linked to the 5'-end of the a sequence through the spacer sequence TTTTTT. The AS1411 aptamer is linked to the 5'-end of the b sequence through the spacer sequence TTTTT. The FAP aptamer is linked to the 5'-end of the c sequence through the spacer sequence TTTTT; The sequence of the A-miR21 is: GATAAGCT, and there is phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, and there is phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end; The sequence of the FAP aptamer is: SEQ ID NO:188: CCGCTCGAGCTAGTCTGACAAAGAGAAACAC, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end; Drug 35): AS1411 aptamer - Survivin siRNA - EpCAM aptamer - 3*A-miR21 - DNA vector, wherein, the DNA vector is the 14th group among the nucleic acid vectors described in claim 1. The AS1411 aptamer is linked to the 5'-end of the antisense strand of the Survivin siRNA through the linker sequence AA. The sense strand of the Survivin siRNA is linked to the 3'-end of the c sequence through the linker sequence AAAA. The antisense strand of the Survivin siRNA is complementarily paired and linked to the sense strand of the Survivin siRNA. Three A-miR21 are tandemly linked to the 3'-end of the b sequence through the linker sequence AA, and the EpCAM aptamer is linked to the 3'-end of the a sequence through the linker sequence AA, wherein, the first two nucleotides at the 5'-end of the b sequence of the DNA vector each independently have a phosphorothioate modification; The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end; The antisense strand of the Survivin siRNA is: SEQ ID NO:300: UGUGACAGAUAAGGAACCUGCAG, and the sense strand of the Survivin siRNA is: SEQ ID NO:100: GCAGGUUCCUUAUCUGUCACAUU. There are phosphorothioate modifications between the first three adjacent nucleotides at the 5'-end and between the last three adjacent nucleotides at the 3'-end of the sense and antisense strands of the Survivin siRNA. The 2nd, 6th, 8th, 9th, 12th, 14th, and 16th positions at the 5'-end of the antisense strand of the Survivin siRNA have 2'-F modification, and the rest have 2'-OMe modification. The 7th, 9th, 10th, and 11th positions of the sense strand of the Survivin siRNA have 2'-F modification, and the rest have 2'-OMe modification; The sequence of the A-miR21 is: GATAAGCT, with a phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The sequence of the EpCAM aptamer is: SEQ ID NO:179: GCGACUGGUUACCCGGUCG, with C and U having 2'-F modification and A and G having 2'-OME modification; There is a phosphorothioate modification in the phosphate backbone between the first three adjacent nucleotides at the 5'-end and between the last three adjacent nucleotides at the 3'-end; Drug 36): IL-4RA aptamer - TGF-β aptamer - PD-L1 aptamer - 2*A-miR21 - DNA vector, wherein, The DNA vector is the 15th group among the nucleic acid vectors described in claim 1. The IL-4RA aptamer is linked to the 5'-end of the a sequence through one A-miR21. The TGF-β aptamer is linked to the 5'-end of the b sequence through the transition sequence TTTTT. The PD-L1 aptamer is linked to the 5'-end of the c sequence through one A-miR21, wherein, The first two nucleotides at the 3'-ends of the a sequence, the b sequence and the c sequence of the DNA vector each independently have phosphorothioate modifications; The sequence of the IL-4RA aptamer is: SEQ ID NO:203: AAAAAGCAACAGGGUGCUCCAUGCGCAUGGAACCUGCGCG, and there is a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; The sequence of the TGF-β aptamer is: SEQ ID NO:269: ACATTGCTGCGTGATCGCCTCACATGGGTTTGTCTGGTCGATTTGGAGGTGGTGGGTGGC, and there is a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; The sequence of the A-miR21 is: GATAAGCT, and there is a phosphorothioate modification in the phosphate backbone between adjacent nucleotides; Drug 37): AS1411 aptamer - ATAD2 siRNA - GPC3 aptamer - 5*AimR-21 - DNA vector, wherein, The DNA vector is the 19th group among the nucleic acid vectors described in claim 1. The AS1411 aptamer is linked to the 5'-end of the antisense strand of the ATAD2 siRNA through one AimR-21. The sense strand of the ATAD2 siRNA is linked to the 3'-end of the c sequence through one AimR-21. The antisense strand of the ATAD2 siRNA is complementary base-paired and linked to the sense strand of the ATAD2 siRNA. One AimR-21 is linked to the 3'-end of the a sequence. The GPC3 aptamer is linked to the 5'-end of the b sequence through one AimR-21. One AimR-21 is linked to the 5'-end of the c sequence, wherein, The first two nucleotides at the 5'-end of the b sequence of the DNA vector each independently have phosphorothioate modifications; The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, and there is a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end; The antisense strand of the ATAD2 siRNA is: SEQ ID NO:68: GCGUCGAAGUUGUAGGAUUUU, and the sense strand is: SEQ ID NO:69: AAUCCUACAACUUCGACGCUU. The sense strand and antisense strand of the ATAD2 siRNA have phosphorothioate modifications between the first 3 adjacent nucleotides at the 5'-end and between the last 3 adjacent nucleotides at the 3'-end. The 2nd, 6th, 8th, 9th, 12th, 14th, and 16th positions from the 5'-end have 2'-F modifications, and the rest have 2'-OME modifications; The sequence of the GPC3 aptamer is: SEQ ID NO:190: TAACGCTGACCTTAGCTGCATGGCTTTACATGTTCCA, and there is a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5'-end; The sequence of the A-miR21 is: GATAAGCT, and there is a phosphorothioate modification in the phosphate backbone between adjacent nucleotides; Drug 38): Vap7 aptamer - TGF-β aptamer - Act-12c aptamer - 3*A-miR21 - DNA vector, where, The DNA vector is the 15th group of the nucleic acid vectors described in claim 1. The Vap7 aptamer is connected to the 5'-end of the a sequence through two tandem A-miR21s. The TGF-β aptamer is connected to the 5'-end of the b sequence through the spacer sequence TTTTT. The Act-12c aptamer is connected to the 5'-end of the c sequence through 1 A-miR21, where, The first 2 nucleotides at the 3'-end of the a sequence, b sequence, and c sequence of the DNA vector each independently have phosphorothioate modifications; The sequence of the Vap7 aptamer is: SEQ ID NO:277: TGGTGGGGGTGGACGGGCCGGGTAGA, and there is a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; The sequence of the A-miR21 is: GATAAGCT, and there is a phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The sequence of the TGF-β aptamer is: SEQ ID NO:269: ACATTGCTGCGTGATCGCCTCACATGGGTTTGTCTGGTCGATTTGGAGGTGGTGGGT GGC, and there is a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; The sequence of the Act-12c aptamer is: SEQ ID NO:137: CGGGGAAAGTCACGGGGGGTTTCAGATGTTCTGATCGGTGTGGAG, and there is a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; Drug 39): AS1411 aptamer - 3*A-miR21 - IL-4RA aptamer - VCAM-1 aptamer - DNA vector, where, The DNA vector is the 15th group among the nucleic acid vectors described in claim 1. The AS1411 aptamer is sequentially connected to the 5'-end of the a sequence through the spacer sequence TTTTT and three tandem AmiRs. The IL-4RA aptamer and the VCAM-1 aptamer are respectively connected to the 5'-end of the b sequence and the 5'-end of the c sequence through the spacer sequence TTTTT. Among them, The first two nucleotides at the 3'-ends of the a sequence, the b sequence and the c sequence of the DNA vector each independently have phosphorothioate modification; The sequence of the AS1411 aptamer is: SEQ ID NO:131: G*GTGGTGGTGGTTGTGGTGGTGGTGG, and there is phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end; The sequence of the A-miR21 is: GATAAGCT, and there is phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The sequence of the IL-4RA aptamer is: SEQ ID NO:203: AAAAAGCAACAGGGUGCUCCAUGCGCAUGGAACCUGCGCG, and there is phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end, and C or U has 2'-F modification, and A or G has 2'-OME modification; The sequence of the VCAM-1 aptamer is: SEQ ID NO:284: GGACACGGCAAAGGGGTATAGCCTACCGGACCGTGAACATGGAATGGTGTGCTGCG TGG, and there is phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end; Drug 40): GPC1 aptamer-AS1411 aptamer-EpCAM aptamer-2*A-miR21-DNA vector, where The DNA vector is the 14th group among the nucleic acid vectors described in claim 1. The GPC1 aptamer is connected to the 5'-end of the a sequence through one A-miR21. The AS1411 aptamer is connected to the 5'-end of the b sequence through the spacer sequence TTTTT. The EpCAM aptamer is connected to the 5'-end of the c sequence through one A-miR21. Among them, The first three nucleotides at the 3'-ends of the a sequence, the b sequence and the c sequence of the DNA vector each independently have phosphorothioate modification, and the first two nucleotides at the 3'-ends each independently have 2'-O-MOE modification; The sequence of the GPC1 aptamer is: SEQ ID NO:189: AACGGAGTGTGGCTAACTCGA, and there is phosphorothioate modification in the phosphate backbone between the first four adjacent nucleotides at the 5'-end; The sequence of the A-miR21 is: GATAAGCT, and there is phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, and there is a thiophosphate modification in the phosphate backbone between the 1st - 2nd, 3rd - 4th, 13th - 14th, 16th - 17th, and 24th - 25th nucleotides from the 5' end; The sequence of the EpCAM aptamer is: SEQ ID NO:179: GCGACUGGUUACCCGGUCG, there is a thiophosphate modification in the phosphate backbone between the 4 adjacent nucleotides at the 5' end, and C or U has a 2'-F modification, and A or G has a 2'-OME modification; Drug 41): 3*A - miR21 - AS1411 aptamer - CD40 aptamer - 2*biotin - DNA vector, where the DNA vector is selected from the 1st group of the nucleic acid vectors described in claim 1, 3 of the said A - miR21 are respectively connected to the 5' end of the a sequence, the 3' end of the a sequence, and the 3' end of the b sequence, the AS1411 aptamer is connected to the 5' end of the b sequence through the transition sequence TTTTT, the CD40 aptamer is connected to the 5' end of the c sequence through the transition sequence TTTTT, 1 biotin is modified at the 3' end of the A - miR21 located at the 3' end of the a sequence, and the other biotin is modified at the 3' end of the c sequence; The sequence of the A - miR21 is: GATAAGCT, and each nucleotide has a locked nucleic acid modification; The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG; Drug 42): IL - 4RA aptamer - VCAM - 1 2d aptamer - PD - L1 aptamer - 3*A - miR21 - DNA vector, where the DNA vector is selected from the 3rd group of the nucleic acid vectors described in claim 1, the IL - 4RA aptamer is connected to the 5' end of the a sequence through the first A - miR21, the VCAM - 1 aptamer is connected to the 5' end of the b sequence through the second A - miR21, the PD - L1 aptamer is connected to the 5' end of the c sequence through the third A - miR21, where there is a thiophosphate modification independently between the first 2 nucleotides at the 3' ends of the a sequence, the b sequence, and the c sequence of the DNA vector; The sequence of the IL - 4RA aptamer is: SEQ ID NO:203: AAAAAGCAACAGGGUGCUCCAUGCGCAUGGAACCUGCGCG, there is a thiophosphate modification in the phosphate backbone between the 4 adjacent nucleotides at the 5' end, and C or U has a 2'-F modification, and A or G has a 2'-OME modification; The sequence of the VCAM - 1 2d aptamer is: SEQ ID NO:285: AGGGAATCTTGCCTAGGGAGGGAGTAGCGAAAGGGCTCA, with a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, with a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; The sequence of the A-miR21 is: GATAAGCT, with a phosphorothioate modification in the phosphate backbone between adjacent nucleotides; Drug 43): TAPsiRNA-3*A-miR21-2*AS1411 aptamer-DNA vector, wherein, the DNA vector is selected from Group 6) of the nucleic acid vectors described in Claim 1. The sense strand of the TAPsiRNA is linked to the 3'-end of the c sequence through the transition sequence AAAA. One AS1411 aptamer is linked to the antisense strand of the TAPsiRNA through the transition sequence AAAA, and the AS1411 aptamer is linked to the 3'-end of the c sequence through the complementary pairing of the antisense strand and the sense strand. Another AS1411 aptamer is linked to the 3'-end of the a sequence through the transition sequence AAAA. 3 A-miR21s are tandemly linked to the 3'-end of the b sequence through the transition sequence AA. The first 2 nucleotides at the 5'-ends of the a sequence, the b sequence, and the c sequence of the DNA vector each independently have a phosphorothioate modification; The sense strand sequence of the TAPsiRNA is: SEQ ID NO:301: GCUGCACACGGUUCAGAAU, and the antisense strand sequence is: SEQ ID NO:109: AUUCUGAACCGUGUGCAGCUU. There are phosphorothioate modifications between the first 3 bases at the 5'-end and the last 3 bases at the 3'-end of the sense strand and the antisense strand of the TAPsiRNA. The 2nd, 6th, 8th, 9th, 12th, 14th, and 16th positions at the 5'-end of the antisense strand of the TAPsiRNA are 2'-F modifications, and the rest are 2'-OME modifications. The 7th, 9th, 10th, and 11th positions at the 5'-end of the sense strand of the TAPsiRNA are 2'-F modifications, and the rest are 2'-OME modifications; The sequence of the A-miR21 is: GATAAGCT, with a phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The sequence of the AS1411 is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, with a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end; Drug 44): PD-1 aptamer-AS1411 aptamer-PD-L1 aptamer-3*A-miR21-DNA vector, wherein, The DNA vector is selected from group 3) of the nucleic acid vectors described in claim 1. The PD-1 aptamer is linked to the 5'-end of the a sequence through one A-miR21. The AS1411 aptamer is linked to the 5'-end of the b sequence through one A-miR21. The PD-L1 aptamer is linked to the 5'-end of the c sequence through one A-miR21. The first two nucleotides at the 3'-ends of the a sequence, the b sequence and the c sequence of the DNA vector each independently have phosphorothioate modification; The sequence of the PD-1 aptamer is: SEQ ID NO:253: AGCGGTGACGGCACAGACGGTACAGTTCCCGTCCCTGCACTACACGTATGCCGCT, and there is phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, and there is phosphorothioate modification in the phosphate backbone between the first 2 adjacent nucleotides at the 5'-end; The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; The sequence of the A-miR21 is: GATAAGCT, and there is phosphorothioate modification in the phosphate backbone between adjacent nucleotides; Drug 45): CPG1826-CD40 aptamer-A-miR21-3* biotin-DNA vector, wherein, The DNA vector is group 13) of the nucleic acid vectors described in claim 1. The CpG1826 is linked to the 5'-end of the a sequence through a transition sequence. The CD40 aptamer is linked to the 5'-end of the b sequence through the transition sequence. The A-miR21 is linked to the 5'-end of the c sequence through the transition sequence. The 3 biotins are respectively linked to the 3'-ends of the a sequence, the b sequence and the c sequence; The sequence of the CpG1826 is: SEQ ID NO:59: TCCATGACGTTCCTGACG, and there is phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The transition sequence is TTTTT; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG; The sequence of the A-miR21 is GATAAGCT, and each nucleotide has locked nucleic acid modification; Drug 46): ATP aptamer-A-miR21-FGF2 aptamer-A-miR-1306-DNA vector, wherein, In the DNA vector, the a sequence is: SEQ ID NO:18: GCGACGCCCACGAGCGTTCCGGGAGAGGAGC; the b sequence is: SEQ ID NO:19: GCTCCTCTCCCGGTTCGCCGCGAGCCGCG; the c sequence is: SEQ ID NO:31: CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC; the ATP aptamer is connected to the 5'-end of the a sequence through the spacer sequence TTTTT, the FGF2 aptamer is connected to the 5'-end of the b sequence through the spacer sequence U, and the A-miR-1306 and the A-miR21 are successively connected to the 5'-end of the c sequence. The sequence of the ATP aptamer is SEQ ID NO:136: GGGAGGACGATGCGGAGGAAGGGTAGG, and there is a thiophosphate modification on the phosphate backbone between the first 4 nucleotides at the 5'-end. The sequence of the FGF2 aptamer is SEQ ID NO:183: GGGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCCC, wherein C and U have 2'-F modification. The sequence of the A-miR-1306 is: SEQ ID NO:127: CATCACCACCAGAGCCAACGTC, wherein there is a thiophosphate modification on the phosphate backbone between the first 5 nucleotides at the 5'-end. The sequence of the A-miR21 is: GATAAGCT, and each nucleotide is a locked nucleic acid modification. Drug 47): CD16a aptamer-CTLA-4 aptamer-PD-L1 aptamer-DNA vector, wherein the DNA vector is selected from Group 9) of the nucleic acid vectors described in Claim 1, the CD16a aptamer is connected to the 5'-end of the a sequence through a spacer sequence, the CTLA-4 aptamer is connected to the 5'-end of the b sequence through the spacer sequence, the PD-L1 aptamer is connected to the 5'-end of the c sequence, and there is a thiophosphate modification independently between the first 2 nucleotides at the 3'-ends of the a sequence, the b sequence and the c sequence of the DNA vector. The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is a thiophosphate modification on the phosphate backbone between the first 2 nucleotides at the 5'-end. The sequence of the CTLA-4 aptamer is: SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, there is a thiophosphate modification on the phosphate backbone between the first 2 nucleotides at the 5'-end, and C or U has 2'-F modification, and A or G has 2'-OME modification. The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end; Drug 48): CD16a aptamer - Act-12c aptamer - PD-L1 aptamer - DNA vector, wherein, the DNA vector is selected from Group 9) of the nucleic acid vectors described in Claim 1, the CD16a aptamer is linked to the 5'-end of the a sequence through a transition sequence, the Act-12c aptamer is linked to the 5'-end of the b sequence through the transition sequence, the PD-L1 aptamer is linked to the 5'-end of the c sequence, and there is a phosphorothioate modification independently between the first two nucleotides at the 3'-ends of the a sequence, the b sequence, and the c sequence of the DNA vector; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end; The sequence of the Act-12c aptamer is: SEQ ID NO:137: CGGGGAAAGTCACGGGGGGTTTCAGATGTTCTGATCGGTGTGGAG, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end; The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end; Drug 49): CTLA-4 aptamer - PD-L1 aptamer - PD1 aptamer - DNA vector, wherein, the DNA vector is selected from Group 5) of the nucleic acid vectors described in Claim 1, the PD-L1 aptamer is sequentially linked to the complementary sequence A' of the transition sequence and the single-stranded linker sequence A. The single-stranded linker sequence A is located at the 3'-end of the a sequence, and the PD-L1 aptamer is linked to the 3'-end of the a sequence through the complementary base pairing between the complementary sequence A' and the single-stranded linker sequence A; the PD1 aptamer is sequentially linked to the complementary sequence B' of the transition sequence and the single-stranded linker sequence B. The single-stranded linker sequence B is located at the 3'-end of the b sequence, and the PD-L1 aptamer is linked to the 3'-end of the b sequence through the complementary base pairing between the complementary sequence B' and the single-stranded linker sequence B; the CTLA-4 aptamer is linked to the complementary sequence C' of the single-stranded linker sequence C. The single-stranded linker sequence C is located at the 3'-end of the c sequence, and the PD-L1 aptamer is linked to the 3'-end of the c sequence through the complementary base pairing between the complementary sequence C' and the single-stranded linker sequence C; The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, with a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5'-end; The sequence of the PD1 aptamer is: SEQ ID NO:254: ACCGACAGTGAAGGACTCAGCGAACTCTCAGACTCGGTTC, with a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5'-end; The sequence of the CTLA-4 aptamer is: SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, with a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5'-end, and a 2'-O-MOE modification on the ribose of the first 2 nucleotides at the 5'-end, and a 2'-F modification on the remaining C or U; The single-stranded linker sequence A is: SEQ ID NO:7: TGTAGCACGGTGGC, and the complementary sequence A' is SEQ ID NO:8: GCCACCGTGCTACA; The single-stranded linker sequence B is: SEQ ID NO:7: TGTAGCACGGTGGC, and the complementary sequence B' is SEQ ID NO:8: GCCACCGTGCTACA; The single-stranded linker sequence C is: SEQ ID NO:11: TGCTGCTGCTGCTG, and the complementary sequence C' is SEQ ID NO:12: CAGCAGCAGCAGCA; The transition sequence is: TTTTTT; Drug 50): PD1 aptamer - IL-4Ra aptamer - OX40 aptamer - DNA vector, wherein, The DNA vector is selected from Group 6) of the nucleic acid vectors described in Claim 1. The PD1 aptamer is linked to the 5'-end of the a sequence through the transition sequence AAA. The IL-4Ra aptamer is linked to the 5'-end of the b sequence through the transition sequence AAA. The OX40 aptamer is linked to the 5'-end of the c sequence through the transition sequence AAA. The first 3 nucleotides at the 3'-ends of the a sequence, the b sequence, and the c sequence of the DNA vector each independently have a phosphorothioate modification; The sequence of the PD1 aptamer is: SEQ ID NO:253: AGCGGTGACGGCACAGACGGTACAGTTCCCGTCCCTGCACTACACGTATGCCGCT, with a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; The sequence of the IL-4Ra aptamer is: SEQ ID NO:203: AAAAAGCAACAGGGUGCUCCAUGCGCAUGGAACCUGCGCG, with a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; The sequence of the OX40 aptamer is: SEQ ID NO:229: CAGUCUGCAUCGUAGGAAUCGCCACCGUAUACUUUCCCAC. There is a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end, and the ribose of the first 3 nucleotides at the 5'-end has a 2'-O-MOE modification. The remaining C or U has a 2'-F modification, and A or G has a 2'-OME modification; Drug 51): CD16a aptamer - OX40 aptamer - PD-L1 aptamer - DNA vector, wherein, the DNA vector is selected from Group 3) of the nucleic acid vectors described in Claim 1. The CD16a aptamer is linked to the 5'-end of the a sequence through a transition sequence. The OX40 aptamer is linked to the 5'-end of the b sequence through a transition sequence. The PD-L1 aptamer is linked to the 5'-end of the c sequence through a transition sequence. There is an independent phosphorothioate modification between the first 2 nucleotides at the 3'-ends of the a sequence, the b sequence and the c sequence of the DNA vector; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG. There is a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end; The sequence of the OX40 aptamer is: SEQ ID NO:230: GGGAUGCGGAAAAAAGAACACUUCCGAUUAGGGCCCACCCUAACGGCCGCAGAC. C or U has a 2'-F modification, A or G has a 2'-OME modification. There is a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end; The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT. There is a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end; Drug 52): CD16a aptamer - VEGF165 aptamer - PD-L1 aptamer - DNA vector, wherein, the DNA vector is selected from Group 3) of the nucleic acid vectors described in Claim 1. The CD16a aptamer is linked to the 5'-end of the a sequence through a transition sequence. The VEGF165 aptamer is linked to the 5'-end of the b sequence through a transition sequence. The PD-L1 aptamer is linked to the 5'-end of the c sequence through a transition sequence. There is an independent phosphorothioate modification between the first 2 nucleotides at the 3'-ends of the a sequence, the b sequence and the c sequence of the DNA vector; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG. There is a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end; The sequence of the VEGF165 aptamer is: SEQ ID NO:280: CGGAAUCAGUGAAUGCUUAUACAUCCG, where C or U has a 2'-F modification, A or G has a 2'-OME modification, and there is a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5' end; The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5' end; Drug 53): CD16a aptamer - CTLA4 aptamer - TIM3 aptamer - DNA vector, where the DNA vector is selected from Group 3) of the nucleic acid vectors described in Claim 1, the CD16a aptamer is connected to the 5' end of the a sequence through a transition sequence, the CTLA4 aptamer is connected to the 5' end of the b sequence through a transition sequence, the TIM3 aptamer is connected to the 5' end of the c sequence through a transition sequence, and there is a phosphorothioate modification independently between the first two nucleotides at the 3' ends of the a sequence, the b sequence, and the c sequence of the DNA vector; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5' end; The sequence of the CTLA4 aptamer is: SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, there is a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5' end, C or U has a 2'-F modification, and A or G has a 2'-OME modification; The sequence of the TIM3 aptamer is: SEQ ID NO:270: GGGAGAGGACCAGUAGCCACUAUGGUGUUGGAGCUAGCGGCAGAGCGUCGCGGU CCCUCCC, there is a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5' end, C or U has a 2'-F modification, and A or G has a 2'-OME modification; Drug 54): PD-1 aptamer - CTLA-4 aptamer - LAG-3 aptamer - DNA vector, where the DNA vector is selected from Group 3) of the nucleic acid vectors described in Claim 1, the PD-L1 aptamer is connected to the 5' end of the a sequence through a transition sequence, the CTLA-4 aptamer is connected to the 5' end of the b sequence through a transition sequence, the LAG-3 aptamer is connected to the 5' end of the c sequence through a transition sequence, and there is a phosphorothioate modification independently between the first two nucleotides at the 3' ends of the a sequence, the b sequence, and the c sequence of the DNA vector; The sequence of the PD-1 aptamer is: SEQ ID NO:253: AGCGGTGACGGCACAGACGGTACAGTTCCCGTCCCTGCACTACACGTATGCCGCT, there is a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end; The sequence of the CTLA-4 aptamer is: SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, there is a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end, C or U has a 2'-F modification, and A or G has a 2'-OME modification; The sequence of the LAG-3 aptamer is: SEQ ID NO:206: GGGAGAGAGAUAUAAGGGCCUCCUGAUACCCGCUGCUAUCUGGACCGAUCCCAU UACCAAAUUCUCUCCC, there is a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end, C or U has a 2'-F modification, and A or G has a 2'-OME modification; Drug 55): CD16a aptamer - Act-12c aptamer - MUC1 aptamer - DNA vector, wherein, The DNA vector is selected from Group 3) of the nucleic acid vectors described in Claim 1. The CD16a aptamer is linked to the 5'-end of the a sequence through a transition sequence. The Act-12c aptamer is linked to the 5'-end of the b sequence through the transition sequence. The MUC1 aptamer is linked to the 5'-end of the c sequence through the transition sequence. There is a phosphorothioate modification independently between the first two nucleotides at the 3'-ends of the a sequence, the b sequence, and the c sequence of the DNA vector; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, there is a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end; The sequence of the Act-12c aptamer is: SEQ ID NO:137: CGGGGAAAGTCACGGGGGGTTTCAGATGTTCTGATCGGTGTGGAG, there is a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end; The sequence of the MUC1 aptamer is: SEQ ID NO:209: GAAGTGAAAATGACAGAACACAACA; Drug 56): CD16a aptamer - TGF-β aptamer - PD-L1 aptamer - DNA vector, wherein, The DNA vector is selected from the group 3) of the nucleic acid vectors described in claim 1. The CD16a aptamer is linked to the 5'-end of the a sequence through a transition sequence. The TGF-β aptamer is linked to the 5'-end of the b sequence through the transition sequence. The PD-L1 aptamer is linked to the 5'-end of the a sequence through a transition sequence. The first 2 nucleotides at the 3'-ends of the a sequence, the b sequence and the c sequence of the DNA vector each independently have phosphorothioate modification; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end; The sequence of the TGF-β aptamer is: SEQ ID NO:269: ACATTGCTGCGTGATCGCCTCACATGGGTTTGTCTGGTCGATTTGGAGGTGGTGGGT GGC, and there is phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end; The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end; Drug 57): CD16a aptamer - CD40 aptamer - CTLA-4 aptamer - DNA vector, wherein, The DNA vector is selected from the group 3) of the nucleic acid vectors described in claim 1. The CD16a aptamer is linked to the 5'-end of the a sequence through a transition sequence. The CD40 aptamer is linked to the 5'-end of the b sequence through the transition sequence. The CTLA-4 aptamer is linked to the 5'-end of the c sequence through a transition sequence. The first 2 nucleotides at the 3'-ends of the a sequence, the b sequence and the c sequence of the DNA vector each independently have phosphorothioate modification; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, and there is phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end; The sequence of the CTLA-4 aptamer is: SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, and there is phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end, C or U has 2'-F modification, and A or G has 2'-OME modification; Drug 58): HER2 aptamer-HER3 aptamer-CD40 aptamer-CD16a aptamer-DNA vector, wherein, the DNA vector is selected from Group 7) of the nucleic acid vectors described in Claim 1, the HER3 aptamer is connected to the 5'-end of the a sequence through the linker sequence AA, the HER2 aptamer is connected to the 5'-end of the c sequence through the linker sequence AA, the CD40 aptamer and the CD16a aptamer are respectively connected to the 5'-end and 3'-end of the b sequence through the linker sequence AA, and there is a thiophosphate modification independently between the first 2 nucleotides at the 3'-ends of the a sequence and the c sequence of the DNA vector; The sequence of the HER2 aptamer is: SEQ ID NO:194: AGCCGCGAGGGGAGGGAUAGGGUAGGGCGCGGCU, there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end, C or U has a 2'-F modification, and A or G has a 2'-OME modification; The sequence of the HER3 aptamer is: SEQ ID NO:197: CAGCGAAAGUUGCGUAUGGGUCACAUCGCAGGCACAUGUCAUCUGGGCG, there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end, C or U has a 2'-F modification, and A or G has a 2'-OME modification; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end; Drug 59): CD16a aptamer-Act-12c aptamer-CTLA-4 aptamer-GPC1 aptamer-DNA vector, wherein, the DNA vector is selected from Group 10) of the nucleic acid vectors described in Claim 1, the CD16a aptamer is connected to the 5'-end of the a sequence through the linker sequence TTTTT, the Act-12c aptamer is connected to the 5'-end of the b sequence through the linker sequence TTTTT, the CTLA-4 aptamer and the GPC1 aptamer are respectively connected to the 5'-end and 3'-end of the c sequence through the linker sequence TTT, and there is a thiophosphate modification independently between the first 2 nucleotides at the 3'-ends of the a sequence and the b sequence of the DNA vector; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, there is a thiophosphate modification in the phosphate backbone between the first 2 nucleotides at the 5'-end; The sequence of the Act-12c aptamer is: SEQ ID NO:137: CGGGGAAAGTCACGGGGGGTTTCAGATGTTCTGATCGGTGTGGAG, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end; The sequence of the CTLA-4 aptamer is: SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end, and C or U has a 2'-F modification, and A or G has a 2'-OME modification; The sequence of the GPC1 aptamer is: SEQ ID NO:189: AACGGAGTGTGGCTAACTCGA, with a phosphorothioate modification in the phosphate backbone between the last two nucleotides at the 3'-end; Drug 60): CD16a aptamer - HER3 aptamer - VEGF165 aptamer - DNA vector, wherein, The DNA vector is selected from Group 3) of the nucleic acid vectors described in Claim 1. The CD16a aptamer is linked to the 5'-end of the a sequence through the spacer sequence TTTTT. The HER3 aptamer is linked to the 5'-end of the b sequence through the spacer sequence TTTTT. The VEGF165 aptamer is linked to the 5'-end of the c sequence through the spacer sequence TTTTT. The phosphate backbones between the first two nucleotides at the 3'-ends of the a sequence, the b sequence, and the c sequence of the DNA vector each independently have a phosphorothioate modification; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end; The sequence of the HER3 aptamer is: SEQ ID NO:197: CAGCGAAAGUUGCGUAUGGGUCACAUCGCAGGCACAUGUCAUCUGGGCG, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end, and C or U has a 2'-F modification, and A or G has a 2'-OME modification; The sequence of the VEGF165 aptamer is: SEQ ID NO:280: CGGAAUCAGUGAAUGCUUAUACAUCCG, with a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end, and C or U has a 2'-F modification, and A or G has a 2'-OME modification; Drug 61): VEGF aptamer - GPC1 aptamer - PD-L1 aptamer - CD16a aptamer - DNA vector, wherein, The DNA vector is selected from group 11) of the nucleic acid vectors described in claim 1. The VEGF aptamer and the GPC1 aptamer are respectively connected to the 5'-end and 3'-end of the a sequence through the transition sequence TTTTT. The PD-L1 aptamer and the CD16a aptamer are respectively connected to the 5'-end of the b sequence and the 5'-end of the c sequence through the transition sequence TTTTT. The first two nucleotides at the 3'-ends of the b sequence and the c sequence of the DNA vector independently have phosphorothioate modifications; The sequence of the VEGF aptamer is: SEQ ID NO:279: GGTGGGGGTGGACGGGCCGGGTAGA, and there is a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end; The sequence of the GPC1 aptamer is: SEQ ID NO:189: AACGGAGTGTGGCTAACTCG*A, and there is a phosphorothioate modification in the phosphate backbone between the last two nucleotides at the 3'-end; The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is a phosphorothioate modification in the phosphate backbone between the first two nucleotides at the 5'-end; Drug 62): PD-1 aptamer - PD-L1 aptamer - 2*A-miR21 - Act-12c aptamer - DNA vector, wherein, The DNA vector is selected from group 3) of the nucleic acid vectors described in claim 1. The PD-1 aptamer is connected to the 5'-end of the a sequence through an A-miR21. The PD-L1 aptamer is connected to the 5'-end of the b sequence through another A-miR21. The Act-12c aptamer is connected to the 5'-end of the c sequence through the transition sequence TTTTT. The first two nucleotides at the 3'-ends of the a sequence, the b sequence and the c sequence of the DNA vector independently have phosphorothioate modifications; The sequence of the PD-1 aptamer is: SEQ ID NO:253: AGCGGTGACGGCACAGACGGTACAGTTCCCGTCCCTGCACTACACGTATGCCGCT, and there is a phosphorothioate modification in the phosphate backbone between the first four adjacent nucleotides at the 5'-end; The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a phosphorothioate modification in the phosphate backbone between the first four adjacent nucleotides at the 5'-end; The sequence of the Act-12c aptamer is: SEQ ID NO:137: CGGGGAAAGTCACGGGGGGTTTCAGATGTTCTGATCGGTGTGGAG, there is a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end; The sequence of the A-miR21 is: GATAAGCT, and there is a phosphorothioate modification in the phosphate backbone between adjacent nucleotides; Drug 63): Her3 aptamer-EGFR siRNA-AS1411 aptamer-Survivin siRNA-Her2 aptamer-DNA vector, wherein, The DNA vector is the 14th group in the nucleic acid vectors described in claim 1. The AS1411 aptamer is connected to the 3'-end of the a sequence through the spacer sequence AAAA. The Her2 aptamer is connected to the 3'-end of the b sequence through the spacer sequence AAAA. The sense strand of the EGFR siRNA is connected to the 3'-end of the c sequence through the spacer sequence AAAA; the sense strand of the Survivin siRNA is connected to the 3'-end of the b sequence through the spacer sequence AAAA. There is a phosphorothioate modification independently between the first 2 nucleotides at the 5'-ends of the a sequence, the b sequence and the c sequence of the DNA vector; The Her3 aptamer is connected to the antisense strand of the EGFR siRNA through the spacer sequence AA, and is connected to the 3'-end of the c sequence through complementary pairing with the sense strand of the EGFR siRNA through the antisense strand of the EGFR siRNA; The Her2 aptamer is connected to the antisense strand of the Survivin siRNA through the spacer sequence AA, and is connected to the 3'-end of the b sequence through complementary pairing of the antisense strand of the Survivin siRNA with the sense strand of the Survivin siRNA; The sequence of the Her3 aptamer is: SEQ ID NO:197: CAGCGAAAGUUGCGUAUGGGUCACAUCGCAGGCACAUGUCAUCUGGGCG, and there is a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5'-end, The antisense strand of the EGFR siRNA is: SEQ ID NO:302: AAUUAGAUAAGACUGCUAAGGCA, and the sense strand is: SEQ ID NO:82: CCUUAGCAGUCUUAUCUAAUU. There are phosphorothioate modifications both between the first 3 adjacent nucleotides at the 5'-end and between the last 3 adjacent nucleotides at the 3'-end of the antisense strand and the sense strand of the EGFR siRNA; The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, and there is a phosphorothioate modification in the phosphate backbone between the last 2 nucleotides at the 3'-end; The sense strand of the Survivin siRNA is: SEQ ID NO:303: GCAGGUUCCUUAUCUGUCACA, The antisense strand of the Survivin siRNA is: SEQ ID NO:300: UGUGACAGAUAAGGAACCUGCAG, wherein, There is a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5' end, and there is a phosphorothioate modification in the phosphate backbone between the last 3 adjacent nucleotides at the 3' end; The sequence of the Her2 aptamer is: SEQ ID NO:194: AGCCGCGAGGGGAGGGAUAGGGUAGGGCGCGGCU, and there is a phosphorothioate modification in the phosphate backbone between the first 2 nucleotides at the 5' end; C or U has a 2'-F modification, and A or G has a 2'-OME modification; Drug 64): Survivin siRNA-TFRA3 aptamer-AS1411 aptamer-3*A-miR21-DNA vector, wherein, The DNA vector is the 17th group in the nucleic acid vectors described in claim 1. The TFRA3 aptamer is connected to the 5' end of the a sequence through one A-miR21, the FA is connected to the 3' end of the a sequence, the AS1411 aptamer is connected to the 5' end of the b sequence through one A-miR21, the sense strand of the Survivin siRNA is connected to the 5' end of the c sequence through one A-miR21, and the antisense strand of the Survivin siRNA is complementary paired and connected to the sense strand of the Survivin siRNA; The sequence of the TFRA3 aptamer is: SEQ ID NO:262: GCGTGGTCACACGC; The sequence of the A-miR21 is: GATAAGCT; The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG; The sense strand of the Survivin siRNA is: SEQ ID NO:304: GCAGGUUCCUUAUCUGUCA, wherein, There is a phosphorothioate modification in the phosphate backbone between the first 3 adjacent nucleotides at the 5' end, and there is a phosphorothioate modification in the phosphate backbone between the last 3 adjacent nucleotides at the 3' end. From the 5' end, the 7th, 9th - 11th positions have 2'-F modifications, and the rest have 2'-OMe modifications; The antisense strand of the Survivin siRNA is: SEQ ID NO:305: UGACAGAUAAGGAACCUGCAGUU, and there is a phosphorothioate modification between the 5' end and the first 3 positions at the 3' end. From the 5' end, the 2nd, 6th, 8th, 9th, 12th, 14th, 16th positions have 2'-F modifications, and the rest have 2'-OMe modifications; Drug 65): AS1411 aptamer - EGFR siRNA - VEGF165 aptamer - PD - L1 aptamer - RNA vector, wherein, the RNA vector is the 16th group of the nucleic acid vectors described in claim 1, the VEGF165 aptamer is connected to the 3' end of the a sequence through the linker sequence AA, the PD - L1 aptamer is connected to the 3' end of the b sequence through the linker sequence AA, the sense strand of the EGFR siRNA is connected to the 3' end of the c sequence through the linker sequence AA, the AS1411 aptamer is connected to the 5' end of the antisense strand of the EGFR siRNA through the linker sequence AA, the antisense strand of the EGFR siRNA is complementary base - paired and connected to the sense strand of the EGFR siRNA, and there is a thiophosphate modification independently between the first two nucleotides at the 5' end of the a sequence of the DNA vector; the sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, and there is a thiophosphate modification in the phosphate backbone between the first two nucleotides at the 5' end; the sense strand of the EGFR siRNA is: SEQ ID NO:82: CCUUAGCAGUCUUAUCUAAUU, and there is a thiophosphate modification in the phosphate backbone between the last three adjacent nucleotides at the 3' end; the antisense strand of the EGFR siRNA is: SEQ ID NO:302: AAUUAGAUAAGACUGCUAAGGCA, and there are thiophosphate modifications both between the first three nucleotides at the 5' end and between the last three adjacent nucleotides at the 3' end; the sequence of the VEGF165 aptamer is: SEQ ID NO:280: CGGAAUCAGUGAAUGCUUAUACAUCCG, wherein, C and U have 2'-F modification, A and G have 2'-OME modification, and there is a thiophosphate modification in the phosphate backbone between the last two nucleotides at the 3' end; the sequence of the PD - L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, wherein, C and U have 2'-F modification, A and G have 2'-OME modification, and there is a thiophosphate modification in the phosphate backbone between the last two nucleotides at the 3' end; Drug 66): CEA aptamer - CD16a - aptamer - Act - 12c aptamer - PD - L1 aptamer - DNA vector, wherein, The DNA vector is the 20) group in the nucleic acid vector described in claim 1. The CEA aptamer is linked to the 5'-end of the a sequence through the linker sequence AA. The CD16a-aptamer is linked to the 3'-end of the a sequence through the linker sequence AA. The Act-12c aptamer and the PD-L1 aptamer are respectively linked to the 5'-ends of the b sequence and the c sequence through the linker sequence AA. There is a thiophosphate modification independently between the first 2 nucleotides at the 3'-ends of the b sequence and the c sequence of the DNA vector; The sequence of the CEA aptamer is: SEQ ID NO:150: TTAACTTATTCGACCATA, and there is a thiophosphate modification in the phosphate backbone between the 1st and 2nd nucleotides at the 5'-end; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and there is a thiophosphate modification in the phosphate backbone between the last 1st and 2nd nucleotides at the 3'-end; The sequence of the Act-12c aptamer is: SEQ ID NO:137: CGGGGAAAGTCACGGGGGGTTTCAGATGTTCTGATCGGTGTGGAG, and there is a thiophosphate modification in the phosphate backbone between the 1st and 2nd nucleotides at the 5'-end; The sequence of the PD-L1 aptamer is: SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT, and there is a thiophosphate modification in the phosphate backbone between the 1st and 2nd nucleotides at the 5'-end; Drug 67): AS1411 aptamer-TAP siRNA-CD16a aptamer-CTLA-4 aptamer-DNA vector, wherein, The DNA vector is the 14) group in the nucleic acid vector described in claim 1. The CD16a aptamer is linked to the 3'-end of the a sequence through the linker sequence AAAA. The CTLA-4 aptamer is linked to the 3'-end of the b sequence through the linker sequence AAAA. The sense strand of the TAP siRNA is linked to the 3'-end of the c sequence through the linker sequence AAAA. The AS1411 aptamer is linked to the 5'-end of the antisense strand of the TAP siRNA through the linker sequence AAA. The antisense strand of the TAP siRNA is complementary paired and linked to the sense strand of the TAP siRNA. There is a thiophosphate modification independently between the first 2 nucleotides at the 5'-ends of the a sequence, the b sequence and the c sequence of the DNA vector; The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, and there is a thiophosphate modification in the phosphate backbone between the 1st and 2nd nucleotides at the 5'-end; The sense strand of the TAP siRNA is: SEQ ID NO:301: GCUGCACACGGUUCAGAAU, with phosphorothioate modifications between the 1-3 positions at the 5'-end and the 1-3 positions at the end of the 3'-end, 2'-F modifications at the 7th and 9-11th nucleotides from the 5'-end, and 2'-OME modifications for the remaining nucleotides; The antisense strand of the TAP siRNA is: SEQ ID NO:109: AUUCUGAACCGUGUGCAGCUU, with phosphorothioate modifications between the 1-3 positions at the 5'-end and the 1-3 positions at the end of the 3'-end, 2'-F modifications at the 2nd, 6th, 8th, 9th, 12th, 14th, and 16th nucleotides from the 5'-end, and 2'-OME modifications for the remaining nucleotides; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, with phosphorothioate modifications between the 1-2 positions at the 5'-end and the 1-2 positions at the end of the 3'-end; The sequence of the CTLA-4 aptamer is: SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, with a phosphorothioate modification in the phosphate backbone between the 1-2 nucleotides at the end of the 3'-end, 2'-F modifications for C and U, and 2'-OME modifications for A and G; Drug 68): AS1411 aptamer - TAP siRNA - CD16a aptamer - Act-12c aptamer - DNA vector, wherein, The DNA vector is the 14th group of the nucleic acid vectors described in claim 1. The CD16a aptamer is connected to the 3'-end of the a sequence through the linker sequence AAAA. The Act-12c aptamer is connected to the 3'-end of the b sequence through the linker sequence AAAA. The sense strand of the TAP siRNA is connected to the 3'-end of the c sequence through the linker sequence AAAA. The AS1411 aptamer is connected to the 5'-end of the antisense strand of the TAP siRNA through the linker sequence AAA. The antisense strand of the TAP siRNA is complementary base-paired and connected to the sense strand of the TAP siRNA. There are phosphorothioate modifications independently between the first 2 nucleotides at the 5'-ends of the a sequence, the b sequence, and the c sequence of the DNA vector; The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, with a phosphorothioate modification in the phosphate backbone between the 1-2 nucleotides at the 5'-end; The sense strand of the TAP siRNA is: SEQ ID NO:301: GCUGCACACGGUUCAGAAU, with a phosphorothioate modification in the phosphate backbone between the adjacent nucleotides at the 1-3 positions at the 5'-end and the 1-3 positions at the 3'-end, 2'-F modifications at the 7th and 9-11th nucleotides from the 5'-end, and 2'-OME modifications for the remaining nucleotides; The antisense strand of the TAP siRNA is: SEQ ID NO:109: AUUCUGAACCGUGUGCAGCUU, with phosphorothioate modifications in the phosphate backbone between adjacent nucleotides at positions 1-3 at the 5'-end and positions 1-3 at the 3'-end, and 2'-F modifications at nucleotides 2, 6, 8, 9, 12, 14, and 16 from the 5'-end, and 2'-OME modifications for the remaining nucleotides; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTG*G, with a phosphorothioate modification in the phosphate backbone between nucleotides 1-2 at the 3'-end; The sequence of the Act-12c aptamer is: SEQ ID NO:137: CGGGGAAAGTCACGGGGGGTTTCAGATGTTCTGATCGGTGTGGAG, with a phosphorothioate modification in the phosphate backbone between nucleotides 1-2 at the 3'-end; Drug 69): CD16a aptamer - AS1411 aptamer - TAP siRNA - OX40 aptamer - Act-12c aptamer - DNA vector, wherein, The DNA vector is the 14th group among the nucleic acid vectors described in claim 1. Therefore, the CD16a aptamer is linked to the 5'-end of the a sequence through the linker sequence AA, the sense strand of the TAP siRNA is linked to the 3'-end of the a sequence through the linker sequence AA, the AS1411 aptamer is linked to the 5'-end of the antisense strand of the TAP siRNA through the linker sequence AAA, the antisense strand of the TAP siRNA is complementary base-paired and linked to the sense strand of the TAP siRNA, the OX40 aptamer is linked to the 3'-end of the b sequence through the linker sequence AA, the Act-12c aptamer is linked to the 5'-end of the c sequence through the linker sequence AAAA, and there are phosphorothioate modifications independently between the first 2 nucleotides at the 5'-ends of the b sequence and the c sequence of the DNA vector; The sequence of the CD16a aptamer is: SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, with a phosphorothioate modification in the phosphate backbone between nucleotides 1-2 at the 5'-end; The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, with a phosphorothioate modification in the phosphate backbone between nucleotides 1-2 at the 5'-end; The sense strand of the TAP siRNA is: SEQ ID NO:301: GCUGCACACGGUUCAGAAU, with phosphorothioate modifications in the phosphate backbone between adjacent nucleotides at positions 1-3 at the 5'-end and positions 1-3 at the 3'-end, and 2'-F modifications at nucleotides 7, 9, 10, and 11 from the 5'-end, and 2'-OME modifications for the remaining nucleotides; The antisense strand of the TAP siRNA is: SEQ ID NO:109: AUUCUGAACCGUGUGCAGCUU, with phosphorothioate modifications in the phosphate backbone between adjacent nucleotides at positions 1-3 at the 5'-end and 1-3 at the 3'-end, 2'-F modifications at nucleotides 2, 6, 8, 9, 12, 14, 16 from the 5'-end, and '-OME modifications for the remaining nucleotides; The sequence of the OX40 aptamer is: SEQ ID NO:228: GGGAGGACGAUGCGGCAGUCUGCAUCGUAGGAAUCGCCACCGUAUACUUUCCCA CCAGACGACUCGCUG, with phosphorothioate modifications in the phosphate backbone between nucleotides 1-2 at the 3'-end, 2'-F modifications for C and U, and 2'-OMe modifications for A and G; The sequence of the Act-12c aptamer is: SEQ ID NO:137: CGGGGAAAGTCACGGGGGGTTTCAGATGTTCTGATCGGTGTGGAG, with phosphorothioate modifications at positions 1-2 at the 5'-end; Drug 70): CTLA-4 aptamer - CD40 aptamer - FAP aptamer - DNA vector, wherein, The DNA vector is the 15th group of the nucleic acid vectors described in claim 1. The CTLA-4 aptamer is linked to the 5'-end of the a sequence through the transition sequence TTTTT, the CD40 aptamer is linked to the 5'-end of the b sequence through the transition sequence TTTTT, the FAP aptamer is linked to the 5'-end of the c sequence through the transition sequence TTTTT, and there are phosphorothioate modifications independently between the first 2 nucleotides at the 3'-ends of the a sequence, the b sequence, and the c sequence of the DNA vector; The sequence of the CTLA-4 aptamer is: SEQ ID NO:141: GGUGGAAGAGGGAUGGGCCGACGUGCCGCAU, with phosphorothioate modifications in the phosphate backbone between nucleotides 1-2 at the 5'-end, 2'-F modifications for C and U, and 2'-OMe modifications for A and G; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, with phosphorothioate modifications in the phosphate backbone between nucleotides 1-2 at the 5'-end; The sequence of the FAP aptamer is: SEQ ID NO:188: CCGCTCGAGCTAGTCTGACAAAGAGAAACAC, with phosphorothioate modifications in the phosphate backbone between nucleotides 1-2 at the 5'-end; Drug 71): VEGF165 aptamer - ASAP1 siRNA - CD24A-2 aptamer - SARS-CoV-2-N48 aptamer - DNA vector, wherein, The DNA vector is the 14) group in the nucleic acid vectors described in claim 1. The sense strand of the ASAP1 siRNA is linked to the 3'-end of the c sequence through the linker sequence AA. The VEGF165 aptamer is linked to the 5'-end of the antisense strand of the ASAP1 siRNA through the linker sequence AA. The antisense strand of the ASAP1 siRNA is complementary base-paired and linked to the sense strand of the ASAP1 siRNA. The CD24 A-2 aptamer is linked to the 3'-end of the b sequence through the linker sequence AA. The SARS-CoV-2-N48 aptamer is linked to the 3'-end of the a sequence through the linker sequence AA. There is a phosphorothioate modification independently between the first two nucleotides at the 5'-ends of the b sequence and the c sequence of the DNA vector; The sequence of the VEGF165 aptamer is: SEQ ID NO:280: CGGAAUCAGUGAAUGCUUAUACAUCCG. There is a phosphorothioate modification in the phosphate backbone between the 1st and 2nd nucleotides at the 5'-end. C and U have 2'-F modification, and A and G have 2'-OME modification; The antisense strand of the ASAP1 siRNA is: SEQ ID NO:65: UGAUAUUAUGGAAGCAAAUUU. There is a phosphorothioate modification in the phosphate backbone between the 1st - 3rd nucleotides at the 5'-end and the 1st - 3rd nucleotides at the 3'-end. The 2nd, 6th, 8th, 9th, 12th, 14th, and 16th nucleotides at the 5'-end have 2'-F modification, and the rest have 2'-OME modification; The sense strand of the ASAP1 siRNA is: SEQ ID NO:64: AUUUGCUUCCAUAAUAUCAUU. There is a phosphorothioate modification in the phosphate backbone between the 1st - 3rd nucleotides at the 5'-end and the 1st - 3rd nucleotides at the 3'-end. The 7th and 9th - 11th nucleotides at the 5'-end have 2'-F modification, and the rest have 2'-OME modification; The sequence of the SARS-CoV-2-N48 aptamer is: SEQ ID NO:222: GCTGGATGTCGCTTACGACAATATTCCTTAGGGGCACCGCTACATTGACACATCCA GC. There is a phosphorothioate modification in the phosphate backbone between the 1st and 2nd nucleotides at the 3'-end; The sequence of the CD24 A-2 aptamer is: SEQ ID NO:167: ATCCAGAGTGACGCAGCATATGTGGGTGGGTGGGCGGTTATGCTGAGTCAGCCTTG CTTGGACACGGTGGCTTAGT. There is a phosphorothioate modification in the phosphate backbone between the 1st and 2nd nucleotides at the 5'-end; Drug 72): 3*FGF5 aptamer - DNA vector, wherein, The DNA vector is the 15th group among the nucleic acid vectors described in claim 1. Each of the 3 FGF5 aptamers is connected to the 5' end of the a sequence, the 5' end of the b sequence, and the 5' end of the c sequence through U. There is a phosphorothioate modification independently between the first 2 nucleotides at the 3' ends of the a sequence, the b sequence, and the c sequence of the DNA vector; The sequence of the FGF5 aptamer is: SEQ ID NO:186: GGGCGACCUCUCCGUACUGACCUACAGAGCGACAUACUAGUGUAUCCAGAUCGCCC. There is a phosphorothioate modification in the phosphate backbone between the 1st and 2nd nucleotides at the 5' end. C and U have 2'-F modification, and A and G have 2'-OMe modification; Drug 73): AS1411 aptamer - ASAP1 siRNA - VEGF165 aptamer - SARS-CoV-2-N48 aptamer - RNA vector, where The DNA vector is the 21st group among the nucleic acid vectors described in claim 1. The VEGF165 aptamer is connected to the 3' end of the a sequence through the linker sequence AA. The SARS-CoV-2-N48 aptamer is connected to the 3' end of the b sequence through the linker sequence AA. The sense strand of the ASAP1 siRNA is connected to the 3' end of the c sequence. The AS1411 aptamer is connected to the 5' end of the antisense strand of the ASAP1 siRNA through the linker sequence AA. The antisense strand of the ASAP1 siRNA is complementary paired and connected to the sense strand of the ASAP1 siRNA. There is a phosphorothioate modification independently between the first 2 nucleotides at the 5' ends of the a sequence, the b sequence, and the c sequence of the DNA vector. In the c sequence, A and G have 2'-OME modification, and C and U have 2'-F modification; The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG. There is a phosphorothioate modification in the phosphate backbone between the 1st and 2nd nucleotides at the 5' end; The antisense strand of the ASAP1 siRNA is: SEQ ID NO:65: UGAUAUUAUGGAAGCAAAUUU. There is a phosphorothioate modification in the phosphate backbone between the 1st - 3rd nucleotides at the 5' end and between the 1st - 3rd adjacent nucleotides at the 3' end. The 2nd, 6th, 8th, 9th, 12th, 14th, and 16th positions from the 5' end have 2'-F modification, and the rest have 2'-OME modification; The sense strand of the ASAP1 siRNA is: SEQ ID NO:64: AUUUGCUUCCAUAAUAUCAUU. There is a phosphorothioate modification in the phosphate backbone between the 1st - 3rd nucleotides at the 5' end and between the 1st - 3rd adjacent nucleotides at the 3' end; The sequence of the VEGF165 aptamer is: SEQ ID NO:280: CGGAAUCAGUGAAUGCUUAUACAUCCG, where C and U are modified with 2'-F, and A and G are modified with 2'-OMe; The sequence of the SARS-CoV-2-N48 aptamer is: SEQ ID NO:222: GCTGGATGTCGCTTACGACAATATTCCTTAGGGGCACCGCTACATTGACACATCCA GC, with a phosphorothioate modification in the phosphate backbone between the 1st and 2nd nucleotides at the 3' end; Drug 74): CpG2006-CD40 aptamer-PD1 aptamer-DNA vector, where the DNA vector is the 6th group of the nucleic acid vectors described in claim 1, the CpG2006 is linked to the 5' end of the a sequence through a linker sequence, the CD40 aptamer is linked to the 5' end of the b sequence through the linker sequence, and the PD-1 aptamer is linked to the 5' end of the c sequence through the linker sequence; The sequence of the CpG2006 is: SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, with a phosphorothioate modification in the phosphate backbone between adjacent nucleotides; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, with the 2-position of the ribose of the first 4 nucleotides at the 5' end modified with MOE, and a phosphorothioate modification in the phosphate backbone between the first 5 nucleotides at the 5' end; The sequence of the PD1 aptamer is: SEQ ID NO:254: ACCGACAGTGAAGGACTCAGCGAACTCTCAGACTCGGTTC, with the 2-position of the ribose of the first 4 nucleotides at the 5' end modified with MOE, and a phosphorothioate modification in the phosphate backbone between the first 5 nucleotides at the 5' end; Drug 75): CD24 aptamer-CpG2006 variant-CD40 aptamer-PD-L1 aptamer-DNA vector, where the DNA vector is the 6th group of the nucleic acid vectors described in claim 1, the CD24 aptamer is linked to the 5' end of the a sequence through the CpG2006 variant sequence GTCGTT, the CD40 aptamer is linked to the 5' end of the b sequence through the linker sequence TTTTT, and the PD-L1 aptamer is linked to the 5' end of the c sequence through the linker sequence TTTTT; The sequence of the CD24 aptamer is: SEQ ID NO:166: TATGTGGGTGGGTGGGCGGTTATGCTGAGTCAGCCTTGCT, with a phosphorothioate modification in the phosphate backbone of the first 4 nucleotides at the 5' end; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, with a phosphorothioate modification in the phosphate backbone between the first 5 nucleotides at the 5' end; The sequence of the PD-L1 aptamer is: SEQ ID NO:238: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGG, and the ribose of the first 6 nucleotides at the 5'-end has 2'-O-MOE modification; The transition sequence TTTTT is PEG-modified TTTTT; Drug 76): HBsAg aptamer-HBV siRNA-miR-34-PD-L1 aptamer-miR-542-AS1411 aptamer-DNA vector, wherein, The DNA vector is the 24th group of the nucleic acid vectors described in claim 1. The sense strand of the HBV siRNA is linked to the 3'-end of the a sequence. The HBsAg aptamer is linked to the antisense strand of the HBV siRNA and is located at the 5'-end of the antisense strand of the HBV siRNA. The PD-L1 aptamer is linked to the 3'-end of the b sequence via the miR-34. The AS1411 aptamer is linked to the 3'-end of the c sequence via the miR-542; The sense strand of the siRNA of HBV is: SEQ ID NO:88: GGACUUCUCUCAAUUUUCUUU, and the antisense strand is: SEQ ID NO:89: AGAAAAUUGAGAGAAGUCCUU, wherein, C and U in the sense strand and antisense strand of the siRNA of HBV have 2'-F substitution modification, and the phosphate backbone between the 1st to 3rd nucleotides at the 3'-end has phosphorothioate modification; The sequence of the HBsAg aptamer is: SEQ ID NO:192: CACAGCGAACAGCGGCGGACATAATAGTGCTTACTACGAC, and the phosphate backbone of the first 4 nucleotides at the 5'-end has thiolation modification; The sequence of the miR-34 is: TGTGACAG; The sequence of the PD-L1 aptamer is: SEQ ID NO:238: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGG, and the ribose of the 3 nucleotides at the 3'-end has 2'-O-MOE modification; The sequence of the miR-542 is: TGGCAGTGT; The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG, and the phosphate backbone between the 4 nucleotides at the 3'-end has 2'-O-MOE thiolation modification; Drug 77): IL-4Ra aptamer-TIMC-d aptamer-4*miR-126-RNA vector, wherein, The RNA vector is the 25th group of the nucleic acid vectors described in claim 1. The IL-4Ra aptamer is directly linked to the 5'-end of the a sequence. The TIMC-d aptamer is directly linked to the 5'-end of the b sequence. 4 miR-126 are tandemly linked to the 5'-end of the c sequence, The sequence of the IL-4Ra aptamer is: SEQ ID NO:203: AAAAAGCAACAGGGUGCUCCAUGCGCAUGGAACCUGCGCG, with phosphorothioate modifications at the phosphate backbones of the first 4 nucleotides at the 5'-end; The sequence of the TIMC-d aptamer is: SEQ ID NO:272: AAGCAACACUUAGUCGCGAUUGAUACGUGCGCAGUCAU, with phosphorothioate modifications at the phosphate backbones of the first 4 nucleotides at the 5'-end; The sequence of the miR-126 is: UCGUACC, with phosphorothioate modifications at the phosphate backbones between adjacent nucleotides; Drug 78): CD3-4 aptamer - PD-1 aptamer - BCMA aptamer - DNA vector, wherein, the DNA vector is the 24) group in the nucleic acid vector described in claim 1, the CD3-4 aptamer is connected to the complementary sequence A' of the single-stranded linker sequence A in the a sequence through the transition sequence TTTTTT, and is connected to the 3'-end of the a sequence through complementary base pairing with the complementary sequence A'; the PD-1 aptamer is connected to the complementary sequence B' of the single-stranded linker sequence B in the b sequence through the transition sequence TTTTT, and is connected to the 3'-end of the b sequence through complementary base pairing with the complementary sequence B'; the BCMA aptamer is connected to the complementary sequence C' of the single-stranded linker sequence C in the c sequence, and is connected to the 3'-end of the c sequence through complementary base pairing with the complementary sequence C'; The a sequence is: SEQ ID NO:15: GACGCCCACGAGCGTTCCGGGAGAGG TGTAGCACGGTGGC, Wherein, The underlined part is the single-stranded linker sequence A; The sequence of the CD3-4 aptamer - transition sequence - complementary sequence A' of the single-stranded linker sequence A is: SEQ ID NO:306: TCTCGGACGCGTGTGGTCGGCCGAGTGGCCCACGGTAGAAGGGTTAGAACTGC TGGTTGGTGAATCTCGCTGCCTGGCCCTAGAGTGTTTTTT GCCACCGTGCTACA; The b sequence in the DNA vector is: SEQ ID NO:16: CCTCTCCCGGTTCGCCGCGAGCCTCGGCGCGGCCGTG, wherein, The underlined part is the single-stranded linker sequence B; The sequence of the PD-1 aptamer - transition sequence TTTTT - complementary sequence B' of the single-stranded linker sequence B is: SEQ IDNO:307: ACCGACAGTGAAGGACTCAGCGAACTCTCAGACTCGGTTCTTTTT CACGGCCGCGCCGA ; there is a phosphorothioate modification in the phosphate backbone between the first 5 nucleotides at the 5' end; The c sequence is: SEQ ID NO:17: GGCTCGCGGCCATAGCCGTGGGCG TCTGCTGCTGCTGCTG, Among them, The underlined part is the single-stranded linker sequence C; The complementary sequence C' of the BCMA aptamer - transition sequence U - single - strand linker sequence C: SEQ ID NO:308: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUACU CAGCAGCAGCAGCA , the underlined part is the complementary sequence C' of the single - strand linker sequence C, there is a phosphorothioate modification in the phosphate backbone between the 3' - terminal 3 nucleotides, the ribose of the first 4 nucleotides at the 5' end has a 2'-O-MOE modification, and C and U in the remaining nucleotides have a 2'F modification; Drug 79): CpG2006 - CD38 aptamer - PD-L1 aptamer - DNA vector; wherein, The DNA vector is the 6) group in the nucleic acid vector described in claim 1. The CpG2006 is linked to the 5'-end of the a sequence through the transition sequence TTTTT. The CD38 aptamer is linked to the 5'-end of the b sequence through the transition sequence TTTTT. The PD-L1 aptamer is linked to the 5'-end of the c sequence through the transition sequence TTTTT. The CpG2006 - the transition sequence TTTTT - the a sequence is: SEQ ID NO:309: TCGTCGTTTTGTCGTTTTGTCGTTTTTTTGCGACGCCCACGAGCGTTCCGGGAGAGGAGC, and the phosphate backbone of adjacent nucleotides of the CpG2006 has a thiophosphate modification. The CD38 aptamer - the transition sequence TTTTT - the b sequence is: SEQ ID NO:310: TACGTGAATCTCGTACGATACTCTGTAAGCGTTTTTTGCTCCTCTCCCGGTTCGCCGCGAGCCGCG, and the ribose of the first 3 nucleotides at the 5'-end has a 2'-O-MOE modification. The PD-L1 aptamer - the transition sequence TTTTT - the c sequence is: SEQ ID NO:311: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGGTTTTTCGCGGCTCGCGGCCATAGCCGTGGGCGTCGC, and the ribose of the first 6 nucleotides at the 5'-end has a 2'-O-MOE modification. Drug 80): CD20 aptamer - CpG - BYZD - CD38 aptamer - miR - 34 - CD3 aptamer - DNA vector; wherein, The DNA vector is the 6) group in the nucleic acid vector described in claim 1. The CD20 aptamer is linked to the 5'-end of the a sequence through the sequence AGCGAA of the CpG - BYZD. The CD38 aptamer is linked to the 5'-end of the b sequence through the miR - 34. The CD3 aptamer is linked to the 5'-end of the c sequence through the transition sequence TTTTT. The CD20 aptamer - the CpG-BYZD - the a sequence is: SEQ ID NO: 312: TGCGTGTGTAGTGTGTCT GTTTTTTATCTTCTTTTATCTACTCTTAGGGATTTGGGCGG AGCGAAGCGACGCCCACGAGCGTTCCGGGAGAGGAGC, SEQ ID NO: 165: TGCGTGTGTAGTGTGTCTGTTTTTTATCTTCTTTTATCTACTCTTAGGGATTTGGGCGG is the CD20 aptamer, AGCGAA is the CpG-BYZD, and there is a phosphorothioate modification in the phosphate backbone between the first 4 nucleotides at the 5' end; The CD38 aptamer - the miR-34 - the b sequence is: SEQ ID NO: 313: TACGTGAATCTCGTACGATA CTCTGTAAGCGT TGTGACAGGCTCCTCTCCCGGTTC GCCGCGAGCCGCG, with a 2'-O-MOE modification on the ribose of the first 3 nucleotides at the 5' end, TGTGACAG is the miR-34, the sequence before TGTGACAG is the CD38 aptamer, and the sequence after TGTGACAG is the b sequence; The CD3 aptamer - the transition sequence TTTTT - the c sequence is: SEQ ID NO:314: GCCGCGGGGTGGGTCTAGTGTGGATGTTTAGGGGGCGGCTTTTTCGCGGCTCGCGGCCATAGCCGTGGGCGTCGC, and there is a 2'-O-MOE modification on the ribose of the first 4 nucleotides at the 5'-end. Drug 81): CpG2006-CD38 aptamer-miR-126-PD-L1 aptamer-DNA vector; wherein, the DNA vector is the 6) group in the nucleic acid vector described in claim 1, the CpG2006 is connected to the 5' end of the a sequence through the linker sequence TTTTT, the CD38 aptamer is connected to the 5' end of the b sequence through the miR-126, and the PD-L1 aptamer is connected to the 5' end of the c sequence through the linker sequence TTTTT. The CpG2006 - the linker sequence TTTTT - the a sequence is: SEQ ID NO:309: TCGTCGTTTTGTCGTTTTGTCGTTTTTTTGCGACGCCCACGAGCGTTCCGGGAGA GGAGC, there is a phosphorothioate modification on the phosphate backbone between adjacent nucleotides of the CpG2006, and there is a phosphorothioate modification on the phosphate backbone between the two nucleotides at the 3' end of the a sequence. The CD38 aptamer - the miR-126 - the b sequence is: SEQ ID NO:315: TACGTGAATCTCGTACGATACTCTGTAAGCGT UCGUACCG GCTCCTCTCCCGGTTCG CCGCGAGCCGCG, wherein, The sequence of the CD38 aptamer is SEQ ID NO:170: TACGTGAATCTCGTACGATACTCTGTAAGCGT, and the ribose of the first 3 nucleotides at the 5' end has a 2'-O-MOE modification; UCGUACCG is the sequence of the miR-126, and the ribose of each nucleotide has a 2'-O-MOE modification. The PD-L1 aptamer - the linker sequence TTTTT - the c sequence is: SEQ ID NO:311: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGGTTTTTCGCGGCTCGCGGCCATAGCCGTGGGCGTCGC, and the ribose of the first 6 nucleotides at the 5' end of the PD-L1 aptamer has a 2'-O-MOE modification. Drug 82): BCMA aptamer-miR-126-CD38 aptamer-miR-122-CD3 aptamer-miR-34-DNA vector; wherein, the DNA vector is the 6) group in the nucleic acid vector described in claim 1, the BCMA aptamer is connected to the 5' end of the a sequence through the linker sequence U and the miR-126, the CD38 aptamer is connected to the 5' end of the b sequence through the miR-122, and the CD3 aptamer is connected to the 5' end of the c sequence through the miR-34. The BCMA aptamer - linker sequence U - the miR-126 - the a sequence is: SEQ ID NO:316: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUACU CGTACCG GCGACGCCCACGAGCGTTCCGGGAGAGGAGC, wherein, CGTACCG is the sequence of the miR-126, the BCMA aptamer sequence is before CGTACCG, the a sequence is after CGTACCG, and the ribose of the first 4 nucleotides at the 5' end in the BCMA aptamer sequence has a 2'-O-MOE, and C and U in the remaining positions have a 2'F modification. The CD38 aptamer - the miR-122 - the b sequence is: SEQ ID NO:317: TmAmCmGTGAATCTCGTACGATACTCTGTAAGCGT GGAAGTGT GCTCCTCTCCCGGTTCGCCGCGAGCCGCG, the ribose of the first 3 nucleotides at the 5' end has a 2'-O-MOE modification, GGAAGTGT is the sequence of the miR-122, the sequence before GGAAGTGT is the sequence of the CD38 aptamer, and the sequence after GGAAGTGT is the b sequence. The CD3 aptamer - the miR-34 - the c sequence is: SEQ ID NO:318: AmGmCmCmGCGGGGTGGGTCTAGTGTGGATGTTTAGGGGGCGGCT TGTGACA GCG CGGCTCGCGGCCATAGCCGTGGGCGTCGC, the riboses of the first 4 nucleotides at the 5' end have 2'-O-MOE modification, TGTGACA is the sequence of the miR-34, the sequence before TGTGACA is the sequence of the CD3 aptamer, and the sequence after TGTGACA is the c sequence; Drug 83): GPC3 aptamer - A - miR21 - CD38 aptamer - miR - 122 - PD - L1 aptamer - miR - 34 - DNA vector; wherein, the DNA vector is the 6) group in the nucleic acid vector described in claim 1, the GPC3 aptamer is connected to the 5' end of the a sequence through the A - miR21, the CD38 aptamer is connected to the 5' end of the b sequence through the miR - 122, and the PD - L1 aptamer is connected to the 5' end of the c sequence through the miR - 34; The GPC3 aptamer - the A-miR21 - the a sequence is: SEQ ID NO: 319: TAACGCTGACCTTAGCTGCATGGCTTTACATGTTCCA GATAAGCT GCGACGCCCAC GAGCGTTCCGGGAGAGGAGC, the phosphate backbone between the first 4 nucleotides at the 5' end has a thiophosphate modification, GATAAGCT is the sequence of the A-miR21, the sequence before GATAAGCT is the sequence of the GPC3 aptamer, and the sequence after GATAAGCT is the a sequence; The CD38 aptamer - the miR-122 - the b sequence is: SEQ ID NO: 317: TACGTGAATCTCGTACGATACTCTGTAAGCGT GGAAGTGT GCTCCTCTCCCGGTTC GCCGCGAGCCGCG, the phosphate backbone between the first 4 nucleotides at the 5' end has a thiophosphate modification; GGAAGTGT is the sequence of the miR-122, the sequence before GGAAGTGT is the sequence of the CD38 aptamer, and the sequence after GGAAGTGT is the b sequence; The PD-L1 aptamer - the miR-34 - the c sequence is: SEQ ID NO:320: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGG TGTGACAG CGCGGCT CGCGGCCATAGCCGTGGGCGTCGC, the ribose of the first 6 nucleotides at the 5' end has 2'-O-MOE modification; TGTGACAG is the sequence of the miR-34, the sequence before TGTGACAG is the sequence of the PD-L1 aptamer, and the sequence after TGTGACAG is the c sequence; Drug 84): CpG2006 - VEGF165 aptamer - miR - 122 - PD - L1 aptamer - DNA vector; wherein, the DNA vector is the 6) group in the nucleic acid vector described in claim 1, the CpG2006 is connected to the 5' end of the a sequence through the transition sequence TTTTT, the VEGF165 aptamer is connected to the 5' end of the b sequence through the miR - 122, and the PD - L1 aptamer is connected to the 5' end of the c sequence through the transition sequence TTTTT; The CpG2006 - the transition sequence TTTTT - the a sequence is: SEQ ID NO:309: TCGTCGTTTTGTCGTTTTGTCGTT TTTTT GCGACGCCCACGAGCGTTCCGGGAGAGG AGC; the phosphate backbone between adjacent nucleotides of the CpG2006 has a thiophosphate modification; The VEGF165 aptamer - the miR-122 - the b sequence is: SEQ ID NO: 321: CGGAAUCAGUGAAUGCUUAUACAUCCG GGAAGTGT GCTCCTCTCCCGGTTCGCCG CGAGCCGCG, the ribose of the first 4 nucleotides at the 5' end has 2'-O-MOE modification, and C and U in the remaining RNA have 2'F modification; GGAAGTGT is the sequence of the miR-122, the sequence before GGAAGTGT is the sequence of the VEGF165 aptamer, and the sequence after GGAAGTGT is the b sequence; The PD - L1 aptamer - the transition sequence TTTTT - the c sequence is: SEQ ID NO:311: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGGTTTTTCGCGGCTCGCGGCCATAGCCGTGGGCGTCGC, the ribose of the first 6 nucleotides at the 5' end has 2'-O - MOE modification; Drug 85): CpG2006 - HBsAg aptamer - miR - 122 - PD - L1 aptamer - DNA vector; wherein, the DNA vector is the 6) group in the nucleic acid vector described in claim 1, the CpG2006 is connected to the 5' end of the a sequence through the transition sequence TTTTT, the HBsAg aptamer is connected to the 5' end of the b sequence through the miR - 122, and the PD - L1 aptamer is connected to the 5' end of the c sequence through the transition sequence TTTTT; The CpG2006 - the transition sequence TTTTT - the a sequence is: SEQ ID NO:309: TCGTCGTTTTGTCGTTTTGTCGTTTTTTTGCGACGCCCACGAGCGTTCCGGGAGAGGAGC; the phosphate backbone between adjacent nucleotides of the CpG2006 has a thiophosphate modification; The HBsAg aptamer - the miR-122 - the b sequence is: SEQ ID NO: 322: CACAGCGAACAGCGGCGGACATAATAGTGCTTACTACGAC GGAAGTGT GCTCCTCTCCCGGTTCGCCGCGAGCCGCG, the phosphate backbone between the first 4 nucleotides at the 5' end has a thiophosphate modification; GGAAGTGT is the sequence of the miR-122, the sequence before GGAAGTGT is the sequence of the HBsAg aptamer, and the sequence after GGAAGTGT is the b sequence; The PD-L1 aptamer - the transition sequence TTTTT - the c sequence is: SEQ ID NO:311: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGGTTTTTCGCGGCTCGCGGCCATAGCCGTGGGCGTCGC, and the ribose of the first 6 nucleotides at the 5'-end has 2'-O-MOE modification; Drug 86): ASO-GSK836-HBsAg aptamer-miR-122-PD-L1 aptamer-DNA vector; wherein, The DNA vector is the 6th group of the nucleic acid vectors described in claim 1. The ASO-GSK836 is linked to the 5'-end of the a sequence through the transition sequence TTTTT. The HBsAg aptamer is linked to the 5'-end of the b sequence through the miR-122. The PD-L1 aptamer is linked to the 5'-end of the c sequence through the transition sequence TTTTT; The ASO-GSK836 - the transition sequence TTTTT - the a sequence is: SEQ ID NO:323: GCAGAGGTGAAGCGAAGTCGTTTTTGCGACGCCCACGAGCGTTCCGGGAGAGGAGC, and the phosphate backbone between adjacent nucleotides of the first 6 nucleotides at the 5'-end has thiophosphate modification; The HBsAg aptamer - the miR-122 - the b sequence is: SEQ ID NO: 322: CACAGCGAACAGCGGCGGACATAATAGTGCTTACTACGAC GGAAGTGT GCTCCTCTCCCGGTTCGCCGCGAGCCGCG, the phosphate backbone between the first 4 nucleotides at the 5' end has a thiophosphate modification; GGAAGTGT is the sequence of the miR-122, the sequence before GGAAGTGT is the sequence of the HBsAg aptamer, and the sequence after GGAAGTGT is the b sequence; The PD-L1 aptamer - the transition sequence TTTTT - the c sequence is: SEQ ID NO:311: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGGTTTTTCGCGGCTCGCGGCCATAGCCGTGGGCGTCGC, and the ribose of the first 6 nucleotides at the 5'-end has 2'-O-MOE modification; Drug 87): BCMA aptamer-CD38 aptamer-miR-126-PD-L1 aptamer-miR-34-DNA vector; wherein, The DNA vector is the 6th group of the nucleic acid vectors described in claim 1. The BCMA aptamer is linked to the 5'-end of the a sequence through the transition sequence UU. The CD38 aptamer is linked to the 5'-end of the b sequence through the miR-126. The PD-L1 aptamer is linked to the 5'-end of the c sequence through the miR-34; The BCMA aptamer - transition sequence UU - the a sequence is: SEQ ID NO:324: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUACUUGC GACGCCCACGAGCGTTCCGGGAGAGGAGC, wherein, SEQ ID NO:140: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUAC is the BCMA aptamer in the form of RNA, all nucleotides of which have 2'-F modification, and the rest is the a sequence. The CD38 aptamer - the miR-126 - the b sequence is: SEQ ID NO:325: TACGTGAATCTCGTACGATACTCTGTAAGCGT GTCGTT GCTCCTCTCCCGGTTCGCC GCGAGCCGCG, the phosphate backbone between the first 4 nucleotides at the 5' end has a thiophosphate modification, GTCGTT is the sequence of the miR-126, the sequence before GTCGTT is the CD38 aptamer, and the sequence after GTCGTT is the b sequence; The PD-L1 aptamer - the miR-34 - the c sequence is: SEQ ID NO:320: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGG TGTGACAG CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC, the ribose of the first 6 nucleotides at the 5' end has 2'-O-MOE modification, TGTGACAG is the sequence of the miR-34, the sequence before TGTGACAG is the sequence of the PD-L1 aptamer, and the sequence after TGTGACAG is the c sequence; Drug 88): AS1411 aptamer - FGF2 aptamer - 3*A - miR21 - DNA vector; the AS1411 aptamer is connected to the 5' end of the a sequence of the DNA vector through the transition sequence TTTTT, the FGF2 aptamer is connected to the 5' end of the b sequence of the DNA vector through the transition base U, and 3 of the A - miR21 are directly connected in series to the 5' end of the c sequence of the DNA vector. AS1411 aptamer - the transition sequence TTTTT - the a sequence is: SEQ ID NO:326: GGTGGTGGTGGTTGTGGTGGTGGTGGTTTTTGCGCCCACGAGCGTTCCGGGAG AGC; FGF2 aptamer - the transition base U - the b sequence is: SEQ ID NO:327: GGGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCCCUCCCUGCTCTCCCGGTTCG CCGCCAGCCGCC, where SEQ ID NO:183: GGGAUACUAGGGCAUUAAUGUUACCAGUGUAGUCCC is the FGF2 aptamer in the form of RNA, and the C and U bases in the RNA have 2'-F modification, and the rest is the b sequence; 3*A - miR21 - the c sequence is: SEQ ID NO:328: GATAAGCTGATAAGCTGATAAGCTGGCGGCAGGCGGCCATAGCCGTGGGCGC, GATAAGCT is the sequence of the A - miR21, and the phosphate backbone of adjacent nucleotides has thiophosphate modification; Drug 89): HBsAg aptamer - CD40 aptamer - PD - L1 aptamer - DNA vector, the HBsAg aptamer is connected to the 5' end of the a sequence of the DNA vector through the transition sequence TTTTT, the CD40 aptamer is connected to the 5' end of the b sequence of the DNA vector through the transition sequence TTTTT, and the PD - L1 aptamer is connected to the 5' end of the c sequence of the DNA vector through the transition sequence TTTTT. The HBsAg aptamer - the transition sequence TTTTT - the a sequence is: SEQ ID NO:329: CACAGCGAACAGCGGCGGACATAATAGTGCTTACTACGAC TTTTT GCGACGCCCACGAGCGTTCCGGGAGAGGAGC, the phosphate backbone of the first 4 nucleotides at the 5'-end has a thiophosphate modification. The sequence before the transition sequence TTTTT is the sequence of the HBsAg aptamer, and the sequence after the transition sequence TTTTT is the a sequence; The CD40 aptamer - the transition sequence TTTTT - the b sequence is: SEQ ID NO:330: CCAACGAGTAGGCGATAGCGCGTGG TTTTT GCTCCTCTCCCGGTTCGCCGCGAGCCGCG, with phosphorothioate modifications on the phosphate backbone between the first three nucleotides at the 5'-end and between the first three nucleotides at the 3'-end. The sequence before the transition sequence TTTTT is the sequence of the CD40 aptamer, and the sequence after the transition sequence TTTTT is the b sequence; The PD - L1 aptamer - the transition sequence TTTTT - the c sequence is: SEQ ID NO:331: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT TTTTT CGCGGCTCGCGGCCATAGCCGTGGGCGTCGC. The phosphate backbone between the first three nucleotides at the 5'-end and between the first three nucleotides at the 3'-end has a thiophosphate modification. The sequence before the transition sequence TTTTT is the sequence of the PD-L1 aptamer, and the sequence after the transition sequence TTTTT is the c sequence; Drug 90): HBsAg aptamer - CD40 aptamer - PD - L1 aptamer - DNA vector, which is the same as Drug 89) except for the different sequence of the PD - L1 aptamer. Among them, the PD - L1 aptamer - the transition sequence TTTTT - the c sequence is: SEQ ID NO:311: AACAACGTATAACAATGCCCACGTCACCAGAGTACTATGGTTTTTCGCGGCTCGCGGCCATAGCCGTGGGCGTCGC. The ribose of the first 6 nucleotides at the 5' end has 2'-O-MOE modification. The sequence before the transition sequence TTTTT is the sequence of the PD - L1 aptamer, and the sequence after the transition sequence TTTTT is the c sequence; Drug 91): BCMA aptamer - CD38 aptamer - CpG - BYZD - CD19 aptamer - A - miR21 - DNA vector, where the a sequence, b sequence and c sequence of the DNA vector are as follows: the a sequence is: SEQ ID NO:15: GACGCCCACGAGCGTTCCGGGAGAGG TGTAGCACGGTGGC, Among them, the underlined part is the single-stranded linker bridge sequence A; the b sequence is: SEQ ID NO:16: CCTCTCCCGGTTCGCCGCGAGCC TCGGCGCGGCCGTG, Among them, The underlined part is the single - strand linker sequence B; the c sequence is: SEQ ID NO:17: GGCTCGCGGCCATAGCCGTGGGCGTC TGCTGCTGCTGCTG, Among them, The underlined part is the single - strand linker sequence C; The CD38 aptamer is connected to the complementary sequence A' of the single - strand linker sequence A through the transition sequence TT and CpG - BYZD. The complementary sequence A' is complementary to the single - strand linker sequence A. Among them, The CD38 aptamer-CpG-BYZD-the complementary sequence A' is: SEQ ID NO: 332: TACGTGAATCTCGTACGATACTCTGTAAGCGTTT AGCGAA GCCACCGTGCTACA, wherein, SEQ ID NO:170: TACGTGAATCTCGTACGATACTCTGTAAGCGT is the CD38 aptamer, and the phosphate backbone between the first 4 nucleotides at the 5' end has sulfur modification; SEQ ID NO:8: GCCACCGTGCTACA is the complementary sequence A', TT is the transition sequence, and AGCGAA is the CpG - BYZD; The CD19 aptamer is connected to the 5' end of the complementary sequence B' of the single - strand linker sequence B through the A - miR21. The complementary sequence B' is complementary to the single - strand linker sequence B. Among them, The CD19 aptamer - the A-miR21 - the complementary sequence B' is: SEQ ID NO:333: UGAGCCCUGUUCGACAGGAGGCUCA GAUAAGCU CACGGCCGCGCCGA, wherein, SEQ ID NO:160: UGAGCCCUGUUCGACAGGAGGCUCA is the sequence of the CD19 aptamer, and the C and U - bases have 2'F modification; GAUAAGCU is the sequence of the A - miR21, and C and U have 2'F modification; SEQ ID NO:10: CACGGCCGCGCCGA is the complementary sequence B'; The BCMA aptamer is connected to the 5' end of the complementary sequence C' of the single - strand linker sequence C through the transition sequence AA. The complementary sequence C' is complementary to the single - strand linker sequence C. Among them, The BCMA aptamer - the transition sequence AA - the complementary sequence C' is: SEQ ID NO: 334: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUAC AA CA GCAGCAGCAGCA, Among them, SEQ ID NO:12: CAGCAGCAGCAGCA is the complementary sequence C', SEQ ID NO:140: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUAC is the sequence of the BCMA aptamer, and C and U bases in the RNA sequence of the BCMA aptamer have 2'-F modification; Drug 92): BCMA aptamer-CD38 aptamer-CD19 aptamer-A-miR21-DNA vector, wherein, The a sequence, b sequence and c sequence of the DNA vector are as follows: The a sequence is: SEQ ID NO:15: GACGCCCACGAGCGTTCCGGGAGAGG TGTAGCACGGTGGC, Among them, the underlined part is the single-stranded linking bridge sequence A; the b sequence is: SEQ ID NO:16: CCTCTCCCGGTTCGCCGCGAGCC TCGGCGCGGCCGTG, Among them, The underlined part is the single-stranded linker sequence B; the c sequence is: SEQ ID NO:17: GGCTCGCGGCCATAGCCGTGGGCGTC TGCTGCTGCTGCTG, Among them, The underlined part is the single-stranded linker sequence C; The CD38 aptamer is connected to the complementary sequence A' of the single-stranded linker sequence A through the transition sequence TTTTT, and the complementary sequence A' is complementary to the single-stranded linker sequence A, wherein, The sequence of the CD38 aptamer - the transition sequence TTTTT - the complementary sequence A' is: SEQ ID NO:335: TACGTGAATCTCGTACGATACTCTGTAAGCGT T TTTT GCCACCGTGCTACA, SEQ ID NO:170: TACGTGAATCTCGTACGATACTCTGTAAGCGT is the sequence of the CD38 aptamer, and the phosphate backbone between the first 4 nucleotides at the 5' end has a thiophosphate modification; SEQ ID NO:8: GCCACCGTGCTACA is the complementary sequence A' of the single-stranded linker sequence A; The CD19 aptamer is connected to the complementary sequence B' of the single-stranded linker sequence B through the A-miR21, and the complementary sequence B' is complementary to the single-stranded linker sequence B, wherein, The sequence of the CD19 aptamer - the A-miR21 - the complementary sequence B' is: SEQ ID NO:333: UGAGCCCUGUUCGACAGGAGGCUCA GAUAAGCU CACGGCCGCGCCGA, wherein, SEQ ID NO:160: UGAGCCCUGUUCGACAGGAGGCUCA is the sequence of the CD19 aptamer, and C and U have 2'-F modification; GAUAAGCU is the sequence of the A-miR21, and C and U have 2'-F modification; SEQ ID NO:10: CACGGCCGCGCCGA is the complementary sequence B'; The BCMA aptamer is connected to the 5' end of the complementary sequence C' of the single-stranded linker sequence C through the transition sequence AA, and the complementary sequence C' is complementary to the single-stranded linker sequence C, wherein, The BCMA aptamer - the transition sequence AA - the complementary sequence C’ is: SEQ ID NO:334: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUAC AA CA GCAGCAGCAGCA, Wherein, SEQ ID NO:12: CAGCAGCAGCAGCA is the complementary sequence C', SEQ ID NO:140: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUAC is the sequence of the BCMA aptamer, and C and U bases in the RNA sequence of the BCMA aptamer have 2'-F modification; Drug 93): CpG2006-CD38 aptamer-PD-L1 aptamer-DNA vector, wherein, The a sequence, b sequence and c sequence of the DNA vector are as follows: The a sequence is: SEQ ID NO:15: GACGCCCACGAGCGTTCCGGGAGAGG TGTAGCACGGTGGC, Among them, the underlined part is the single-stranded linker bridge sequence A; The b sequence is: SEQ ID NO:16: CCTCTCCCGGTTCGCCGCGAGCC TCGGCGCGGCCGTG, Among them, The underlined part is the single-stranded linker sequence B; The c sequence is: SEQ ID NO:17: GGCTCGCGGCCATAGCCGTGGGCGTC TGCTGCTGCTGCTG, Among them, The underlined part is the single-stranded linker sequence C; The CD38 aptamer is linked to the complementary sequence A' of the single-stranded linker sequence A through the spacer sequence TTTTT. The complementary sequence A' is complementary paired with the single-stranded linker sequence A and linked to the 3' end of the a sequence. Among them, The sequence of the CD38 aptamer - the spacer sequence TTTTT - the complementary sequence A' is: SEQ ID NO:335: TACGTGAATCTCGTACGATACTCTGTAAGCGT TTTTT GCCACCGTGCTACA, SEQ ID NO: 170: TACGTGAATCTCGTACGATACTCTGTAAGCGT is the sequence of the CD38 aptamer, and the phosphate backbone between the first 4 nucleotides at the 5' end has a thiophosphate modification; SEQ ID NO: 8: GCCACCGTGCTACA is the complementary sequence A' of the single-stranded linker sequence A; The PD-L1 aptamer is linked to the 5' end of the complementary sequence B' of the single-stranded linker sequence B through the spacer sequence TTTTT. The PD-L1 aptamer is complementary paired with the single-stranded linker sequence B through the complementary sequence B' and linked to the 3' end of the b sequence. The CpG2006 is linked to the 5' end of the complementary sequence C' of the single-stranded linker C sequence through the spacer sequence TTTTT. The CpG2006 is complementary paired with the single-stranded linker C sequence through the complementary sequence C' and linked to the 3' end of the c sequence; The sequence of the PD-L1 aptamer - the transition sequence TTTTT - the complementary sequence B' is: SEQ ID NO: 336: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT TTTTT CACG GCCGCGCCGA, and there is a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5' end; wherein, SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT is the sequence of the PD-L1 aptamer, and SEQ ID NO:10: CACGGCCGCGCCGA is the complementary sequence B'; The sequence of the CpG2006 - the transition sequence TTTTT - the complementary sequence C’ is: SEQ ID NO:337: TCGTCGTTTTGTCGTTTTGTCGTT TTTTT CAGCAGCAGCAGCA, where SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT is the sequence of the CpG2006. There is a phosphorothioate modification in the phosphate backbone between adjacent nucleotides in the sequence of the CpG2006; SEQ ID NO:12: CAGCAGCAGCAGCA is the complementary sequence C'; Drug 94): BCMA aptamer - CD38 aptamer - CpG - BYZD - PD-L1 aptamer - DNA vector, where, The a sequence, b sequence and c sequence of the DNA vector are as follows: The a sequence is: SEQ ID NO:15: GACGCCCACGAGCGTTCCGGGAGAGG TGTAGCACGGTGGC, Among them, the underlined part is the single-stranded linker bridge sequence A; The b sequence is: SEQ ID NO:16: CCTCTCCCGGTTCGCCGCGAGCC TCGGCGCGGCCGTG, Among them, The underlined part is the single-stranded linker sequence B; The c sequence is: SEQ ID NO:17: GGCTCGCGGCCATAGCCGTGGGCGTC TGCTGCTGCTGCTG, Among them, The underlined part is the single-stranded linker sequence C; The CD38 aptamer is linked to the complementary sequence A' of the single-stranded linker sequence A through CpG - BYZD. The complementary sequence A' is complementary paired with the single-stranded linker sequence A and linked to the 3' end of the a sequence. Among them, The sequence of the CD38 aptamer - CpG - BYZD - the complementary sequence A' is: SEQ ID NO:332: TACGTGAATCTCGTACGATACTCTGTAAGCGT TT AGCGAAGCCACCGTGCTACA, SEQ ID NO:170: TACGTGAATCTCGTACGATACTCTGTAAGCGT is the sequence of the CD38 aptamer, and the phosphate backbone between the first 4 nucleotides at the 5' end has a thiophosphate modification; SEQ ID NO:8: GCCACCGTGCTACA is the complementary sequence A' of the single-stranded linker sequence A; TT is the transition sequence, and AGCGAA is the CpG-BYZD; The PD-L1 aptamer is connected to the 5'-end of the complementary sequence B' of the single-stranded linker sequence B through the spacer sequence TTTTT. The PD-L1 aptamer is connected to the 3'-end of the b sequence through complementary base pairing between the complementary sequence B' and the single-stranded linker sequence B. The BCMA aptamer is directly connected to the 5'-end of the complementary sequence C' of the single-stranded linker sequence C. The BCMA aptamer is connected to the 3'-end of the c sequence through complementary base pairing between the complementary sequence C' and the single-stranded linker sequence C. The sequence of the PD-L1 aptamer - the spacer sequence TTTTT - the complementary sequence B' is: SEQ ID NO:336: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGTTTTTTCACG GCCGCGCCGA, and there is a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5'-end. Among them, SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT is the sequence of the PD-L1 aptamer, and SEQ ID NO:10: CACGGCCGCGCCGA is the complementary sequence B'. The sequence of the BCMA aptamer - the spacer sequence AA - the complementary sequence C' is: SEQ ID NO:334: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUACA ACAGCAGCAGCAGCA, where SEQ IDNO:140: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUAC is the BCMA aptamer, and the C and U bases in the RNA sequence of the BCMA aptamer have 2'-F modification; SEQ ID NO:12: CAGCAGCAGCAGCA is the complementary sequence C'. Drug 95): BCMA aptamer - CD40 aptamer - PD-L1 aptamer - DNA vector, where The a sequence, b sequence, and c sequence of the DNA vector are as follows: The a sequence is: SEQ ID NO:15: GACGCCCACGAGCGTTCCGGGAGAGG TGTAGCACGGTGGC, Among them, the underlined part is the single-stranded linker bridge sequence A; The b sequence is: SEQ ID NO:16: CCTCTCCCGGTTCGCCGCGAGCC TCGGCGCGGCCGTG, Among them, The underlined part is the single-stranded linker sequence B. The c sequence is: SEQ ID NO:17: GGCTCGCGGCCATAGCCGTGGGCGTC TGCTGCTGCTGCTG, Among them, The underlined part is the single-stranded linker sequence C. The CD40 aptamer is connected to the complementary sequence A' of the single-stranded linker sequence A through the spacer sequence TTTTT. The complementary sequence A' is connected to the 3'-end of the a sequence through complementary base pairing with the single-stranded linker sequence A. Among them, The sequence of the CD40 aptamer - the transition sequence TTTTT - the complementary sequence A' is: SEQ ID NO:338: GCCAACGAGTAGGCGATAGCGCGTGGC TTTTT GCCACCGTGCTACA, wherein, SEQ ID NO:156: GCCAACGAGTAGGCGATAGCGCGTGGC is the CD40 aptamer, and the phosphate backbone between the first 4 nucleotides at the 5' end has a thiophosphate modification; SEQ ID NO:8: GCCACCGTGCTACA is the complementary sequence A'. The PD-L1 aptamer is connected to the 5' end of the complementary sequence B' of the single-stranded linker sequence B through the transition sequence TTTTT, and the PD-L1 aptamer is connected to the 3' end of the b sequence through complementary base pairing with the complementary sequence B'. The BCMA aptamer is directly connected to the 5' end of the complementary sequence C' of the single-stranded linker C sequence, and the BCMA aptamer is connected to the 3' end of the c sequence through complementary base pairing between the complementary sequence C' and the single-stranded linker C sequence; The sequence of the PD-L1 aptamer - the transition sequence TTTTT - the complementary sequence B' is: SEQ ID NO: 336: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT TTTTT CACG GCCGCGCCGA, and there is a phosphorothioate modification in the phosphate backbone between the first 4 adjacent nucleotides at the 5' end; wherein, SEQ ID NO:241: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT is the sequence of the PD-L1 aptamer, and SEQ ID NO:10: CACGGCCGCGCCGA is the complementary sequence B'. The sequence of the BCMA aptamer - the transition sequence AA - the complementary sequence C' is: SEQ ID NO:334: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUACA ACAGCAGCAGCAGCA, wherein, SEQ ID NO:140: AGUGCAAGACGUUCGCAGAUUAGCGAAAAGAGGGUCUCAUUGACUAGUAC is the BCMA aptamer, and the C and U bases in the RNA sequence of the BCMA aptamer have 2'-F modification; SEQ ID NO:12: CAGCAGCAGCAGCA is the complementary sequence C'. Drug 96): A-miR21-AS1411 aptamer - CD40 aptamer - 2*biotin - DNA vector, wherein, The DNA vector is selected from the first group of the nucleic acid vectors described in claim 1, the A-miR21 is connected to the 5' end of the a sequence, the AS1411 aptamer is connected to the 5' end of the b sequence through the transition sequence TTTTT, the CD40 aptamer is connected to the 5' end of the c sequence through the transition sequence TTTTT, one biotin is modified at the 3' end of the a sequence, and the other biotin is modified at the 3' end of the c sequence; The sequence of the A-miR21 is GATAAGCT, and each nucleotide has a locked nucleic acid modification; The sequence of the AS1411 aptamer is: SEQ ID NO:131: GGTGGTGGTGGTTGTGGTGGTGGTGG; The sequence of the CD40 aptamer is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG; Drug 97): 2*A-miR21-4*biotin-DNA vector; Wherein, the DNA vector is the 11)th group of the nucleic acid vectors described in claim 1, two A-miR21 are directly connected to the 5' ends of the a sequence and the c sequence respectively, and four biotins are connected to the 3' end of the a sequence, the 5' end and the 3' end of the b sequence, and the 3' end of the c sequence respectively, the sequence of the A-miR21 is GATAAGCT, and each position is locked nucleic acid modified; Drug 99): TTA1 aptamer-2*Survivin siRNA-DNA vector; Wherein the DNA vector is the 13)th group of the nucleic acid vectors described in claim 1, the TTA1 aptamer is connected to the 5' end of the b sequence through a transition sequence, the sense strands of two Survivin siRNAs are connected to the 3' ends of the b sequence and the c sequence, and the antisense strands of two Survivin siRNAs are connected to the 3' ends of the b sequence and the c strand by complementary pairing with the sense strands of the Survivin siRNAs; The TTA1 aptamer is: SEQ ID NO:265: CCTGCACTTGGCTTGGATTTCAGAAGGGAGACCC; The antisense strand of the Survivin siRNA is: SEQ ID NO:300: UGUGACAGAUAAGGAACCUGCAG; The sense strand of the Survivin siRNA is: SEQ ID NO:100: GCAGGUUCCUUAUCUGUCACAUU; The sense strand and the antisense strand of the Survivin siRNA both have phosphorothioate modifications in the phosphate backbone between the first 3 adjacent nucleotides at the 5' end and the last 3 adjacent nucleotides at the 3' end; Drug 100): CD16a aptamer-CD40 aptamer-CpG2006-DNA vector, wherein the DNA vector is the 6)th group of the nucleic acid vectors described in claim 1, the CD16a aptamer is connected to the 5' end of the a sequence through a transition sequence, the CD40 aptamer is connected to the 3' end of the b sequence through the transition sequence, and the CpG2006 is connected to the 5' end of the c sequence through the transition sequence; The sequence of the CD16a aptamer is SEQ ID NO:157: CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGG, and the phosphate backbone at the 5' end positions 1-3 is phosphorothioate modified; The sequence of the CD40 aptamer is SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG, with the 1-3rd phosphate backbone at the 5'-end being phosphorothioate modified; The sequence of the CpG2006 is SEQ ID NO:57: TCGTCGTTTTGTCGTTTTGTCGTT, and the phosphate backbone between adjacent nucleotides is phosphorothioate modified; The transition sequence is TTTTT.

8. A pharmaceutical composition, characterized in that, it comprises any one or more of the nucleic acid drugs described in claim 7, and optionally a pharmaceutically acceptable carrier and / or excipient.

9. The composition according to claim 8, characterized in that, at least one drug in the pharmaceutical composition is selected from the nucleic acid drugs described in claim 7, and the pharmaceutical composition is selected from any of the following combinations; Combination 1): the drug 2) + the drug 21); Combination 2): the drug 6) + the drug 26); Combination 3): the drug 6) + the OX40 aptamer in RNA form; Combination 4): the drug 3) + the drug 26); Combination 5): the drug 3) + the drug 21) + the OX40 aptamer in DNA form; Combination 6): the drug 4) + the drug 21) + the OX40 aptamer in DNA form; Combination 7): the drug 4) + the drug 21); Combination 8): the drug 3) + the drug 23); Combination 9): the drug 4) + the drug 23); Combination 10): the drug 3) + the drug 24) + the OX40 aptamer in DNA form; Combination 11): the drug 3) + the drug 41); Combination 12): the drug 5) + the drug 41); Combination 13): the drug 5) + the drug 96); Combination 14): the drug 96) + the drug 41); Combination 15): the drug 3) + the drug 97) + the OX40 aptamer in DNA form; Combination 16): the drug 4) + the drug 20) + the OX40 aptamer in DNA form; Combination 17): the drug 4) + the drug 20); Combination 18): the drug 7) + the drug 25) + the OX40 aptamer in DNA form; Combination 19): the drug 1) + the drug 18) + the drug 98); Combination 20): the drug 1) + the drug 18) + the OX40 aptamer in DNA form + the drug 99); Combination 21): the drug 3) + the drug 18) + the OX40 aptamer in DNA form; Combination 22): the drug 3) + the drug 18); Combination 23): the drug 3) + the OX40 aptamer in DNA form; Combination 24): the drug 3) + the drug 18) + the OX40 aptamer in locked nucleic acid form; Combination 25): the drug 3) + the drug 18) + the OX40 aptamer in RNA form; Combination 26): the drug 3) + the drug 18) + the CD40 aptamer in DNA form Combination 27): said drug 3) + said drug 20) + the OX40 aptamer in the form of RNA; Combination 28): said drug 4) + said drug 19) + the OX40 aptamer in the form of DNA; Wherein, the sequence of the OX40 aptamer in the form of DNA is: SEQ ID NO:227: CAGTCTGCATCGTAGGATTAGCCACCGUATCTTTCCCAC; The sequence of the OX40 aptamer in the form of RNA is: SEQ ID NO:226: GGGAGGACGAUGCGGCAGUCUGCAUCGUAGGAAUCGCCACCGUAUACUUUCCCACCAGACGACUCGCUGAGGAUCCGAGA; The locked nucleic acid form of the OX40 aptamer is that the first 5 nucleotides at the 5' end and the first 4 nucleotides at the 3' end of the sequence of the OX40 aptamer in the form of DNA have locked nucleic acid modifications; The sequence of the CD40 aptamer in the form of DNA is: SEQ ID NO:154: CCAACGAGTAGGCGATAGCGCGTGG.

10. Use of the nucleic acid carrier according to any one of claims 1 to 6 as a delivery carrier for oligonucleotide drugs.

11. Use of the nucleic acid drug according to claim 7 or the pharmaceutical composition according to claim 8 in the preparation of a drug for treating tumors, wherein, the nucleic acid drug is drug 3) - drug 70), drug 74) - drug 75), drug 77) - drug 87), drug 91) - drug 97), drug 99) or drug 100) in claim 7.

12. According to the use described in claim 11, characterized in that, the tumor is colon cancer, lymphoma, glioma, melanoma or breast cancer.

13. According to the use described in claim 12, characterized in that, the administration mode of the drug is intratumoral administration, intravenous administration or intraperitoneal administration.

14. According to the use described in claim 12, characterized in that, the daily administration dose of the drug is 0.1 μg / Kg to 100 mg / Kg.

15. A preparation method of the nucleic acid drug according to claim 7, characterized in that, the preparation method includes obtaining the nucleic acid drug by self-assembly of at least three strands of a nucleic acid carrier containing an a sequence, a b sequence and a c sequence and at least one oligonucleotide effector molecule mounted on the nucleic acid carrier.

16. According to the preparation method described in claim 15, characterized in that, the nucleic acid drug is obtained by self-assembly of 3 to 6 strands.

17. According to the preparation method described in claim 16, characterized in that, the nucleic acid drug is CpG2006 - CD40 aptamer - PD - L1 aptamer - DNA carrier, and the preparation method includes any one of the following self-assembly methods; 1) Self-assembly of 3 strands, wherein the 3 strands are respectively: CpG2006 - a sequence: SEQ ID NO:309: TCGTCGTTTTGTCGTTTTGTCGTT TTTTT GCGACGCCCACGAGCGTTCCGGGAGAGGAGC, with a phosphorothioate modification on the phosphate backbone between the 1st and 24th adjacent nucleotides at the 5' end. TTTTT is a transition sequence. The sequence before TTTTT is the sequence of the CpG2006, and the sequence after TTTTT is the sequence of the a sequence; CD40 aptamer-b sequence: SEQ ID NO: 330: CCAACGAGTAGGCGATAGCGCGTGGTTTTTGCTCCTCTCCCGGTTCGCCGCGAG CCGCG, with a phosphorothioate modification on the phosphate backbone between the 1st and 5th adjacent nucleotides at the 5'-end, TTTTT is a transition sequence, the sequence before TTTTT is the sequence of the CD40 aptamer, and the sequence after TTTTT is the b sequence; and PD-L1 aptamer-c sequence: SEQ ID NO: 331: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGTTTTTTCGCGGCTCGCGGCCATAGCCGTGGGCGTCGC, with a phosphorothioate modification on the phosphate backbone between the 1st and 5th adjacent nucleotides at the 5'-end, TTTTT is a transition sequence, the sequence before TTTTT is the sequence of the PD-L1 aptamer, and the sequence after TTTTT is the c sequence; 2) Self-assembly of 6 strands, where the 6 strands are respectively: a sequence: SEQ ID NO: 15: GACGCCCACGAGCGTTCCGGGAGAGGTGTAGCACGGTGGC; b sequence: SEQ ID NO: 16: CCTCTCCCGGTTCGCCGCGAGCCTCGGCGCGGCCGTG; c sequence: SEQ ID NO: 17: GGCTCGCGGCCATAGCCGTGGGCGTCTGCTGCTGCTGCTG; Complementary sequence C' of CpG2006 - transition sequence - single-stranded linker sequence C: SEQ ID NO: 337: TCGTCGTTTTGTCGTTTTGTCGTTTTTTTCAGCAGCAGCAGCA; with a phosphorothioate modification on the phosphate backbone between the 1st and 24th adjacent nucleotides at the 5'-end, TTTTT is the transition sequence, the sequence before TTTTT is the sequence of CpG2006, and the sequence after TTTTT is the complementary sequence C'; Complementary sequence A' of CD40 aptamer - transition sequence - single-stranded linker sequence A: SEQ ID NO: 338: GCCAACGAGTAGGCGATAGCGCGTGGCTTTTTGCCACCGTGCTACA, with a phosphorothioate modification on the phosphate backbone between the 1st and 4th adjacent nucleotides at the 5'-end, TTTTT is the transition sequence, the sequence before TTTTT is the sequence of the CD40 aptamer, and the sequence after TTTTT is the complementary sequence A'; Complementary sequence B' of the PD-L1 aptamer - transition sequence - single-stranded linker sequence B: SEQ ID NO: 336: ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGTTTTTTCACGGCCGCGCCGA, with a thiophosphate modification on the phosphate backbone between the 1st to 4th adjacent nucleotides at the 5' end, TTTTT is the transition sequence, the sequence before TTTTT is the sequence of the PD-L1 aptamer, and the sequence after TTTTT is the complementary sequence B'.

18. The preparation method according to claim 15, wherein, the self-assembly step includes: dissolving the modified or unmodified a sequence, b sequence, c sequence with at least one of the oligonucleotide effector molecules and the sequence of the oligonucleotide effector molecule synthesized separately, if any, in the assembly solution, and successively performing a denaturation reaction and a renaturation reaction to form a self-assembly crude product; successively purifying, eluting and drying the self-assembly crude product to obtain a targeted nucleic acid carrier with at least one of the oligonucleotide effector molecules.

19. The preparation method according to claim 18, wherein, the molar ratio between the a sequence, the b sequence and the c sequence is 0.90 - 1.10:0.90 - 1.10:0.90 - 1.

10.

20. The preparation method according to claim 19, wherein, the molar ratio between the a sequence, the b sequence and the c sequence is 1:1:

1.

21. The preparation method according to claim 18, wherein, the assembly solution is an aqueous TMS solution, an aqueous sodium chloride solution, an aqueous magnesium chloride solution or purified water.

22. The preparation method according to claim 18, wherein, the temperature of the denaturation reaction is 80 - 99°C.

23. The preparation method according to claim 22, wherein, the temperature of the denaturation reaction is 85 - 99°C.

24. The preparation method according to claim 22, wherein, the temperature of the denaturation reaction is 90 - 99°C.

25. The preparation method according to claim 18, wherein, after the denaturation reaction ends, the reaction system is cooled to the holding temperature for the renaturation reaction, and finally cooled to obtain the self-assembly crude product; wherein the holding temperature is 70 - 50°C; the time of the renaturation reaction is 3 - 15 min.

26. The preparation method according to claim 25, wherein, the holding temperature is 65 - 55°C.

27. The preparation method according to claim 25, wherein, the holding temperature is 63 - 57°C.

28. The preparation method according to claim 25, wherein, the time of the renaturation reaction is 3 - 10 min.

29. The preparation method according to claim 25, wherein, the time of the renaturation reaction is 3 - 5 min.

30. The preparation method according to claim 25, wherein, During the process of cooling the reaction system to the heat preservation temperature, the cooling rate is 2 to 10 °C / min.

31. The preparation method according to claim 30, wherein, the cooling rate is 2 to 6 °C / min.

32. The preparation method according to claim 30, wherein, the cooling rate is 2 to 3 °C / min.

33. The preparation method according to claim 25, wherein, the end temperature of the cooling is 0 to 25 °C.

34. The preparation method according to claim 33, wherein, the end temperature of the cooling is 0 to 15 °C.

35. The preparation method according to claim 33, wherein, the end temperature of the cooling is 0 to 4 °C.

36. The preparation method according to claim 25, wherein, the pH value of the denaturation reaction is 5.4 to 8.8.

Images