S. c-glna mutant and recombinant microorganism and application thereof

Abstract

The application relates to the technical field of microbial engineering, and particularly discloses an S.c-glnA mutant, a recombinant microorganism thereof and application. The S.c-glnA mutant of the application takes the amino acid sequence of a wild-type S.c-glnA as a reference sequence, the S.c-glnA mutant contains a mutation that a cysteine at the 160th position is replaced by a tryptophan, and / or contains a mutation that a leucine at the 284th position is replaced by a proline. The fermentation bacteria with the mutant of the application have obviously improved glutamine production capacity. The application provides a new way for fermentative production of glutamine and derivatives thereof.

Description

Technical Field

[0001] This invention relates to the field of microbial engineering technology, and more specifically, to a Sc-glnA mutant and its recombinant microorganisms and their applications. Background Technology

[0002] Glutamine is a non-essential amino acid. Its chemical name is 2-amino-4-carbamoylbutyric acid. Glutamine is the amino acid that encodes proteins, promoting protein synthesis and inhibiting protein breakdown. It plays an important role in the pharmaceutical industry and is used to treat gastric and duodenal ulcers.

[0003] Currently, the most common method for producing glutamine is fermentation, primarily using *Corynebacterium glutamicum* as the production strain. *Corynebacterium glutamicum* is a heterotrophic aerobic, Gram-positive bacterium characterized by rapid growth, non-pathogenicity, and weak degradation of its own metabolites. Fermentation offers advantages such as a wide availability of raw materials, low production costs, controllable product quality, and a single product. *Corynebacterium glutamicum*'s own glutamine synthase (GS) undergoes adenylation under the influence of GlunE, leading to decreased GS activity, increased accumulation of precursor glutamate, and reduced glutamine yield and conversion rate. Therefore, introducing a glutamine synthase unregulated by GlunE is beneficial for promoting the conversion of glutamate to glutamine. The literature (Enhancing L-glutamine production in Corynebacterium glutamicum byrational metabolic engineering combined with a two-stage pH control strategy, Qinglan Lv et al.) reported that introducing glnA from Saccharomyces cerevisiae into Corynebacterium glutamicum resulted in normal expression, with ScGS enzyme activity significantly higher than CgGS, and the accumulation of more glutamine. However, further research is still needed on how to further improve its yield. Summary of the Invention

[0004] The purpose of this invention is to provide a novel *Corynebacterium glutamicum* strain with increased L-glutamine production, its construction method, and its application.

[0005] This invention provides a *Corynebacterium glutamicum* strain. The glutamine synthase encoding gene from *Saccharomyces cerevisiae* is codon-optimized, and a mutant library is constructed using error-prone PCR. The resulting plasmid is transformed into *Corynebacterium glutamicum* MHZ-0513-3. Glutamine production is compared through shake-flask fermentation, and the plasmid pXMJ19-Sc-glnA6 is selected. Sequencing results show that it contains amino acid sequence mutation sites C160W and L284P. Simultaneously, the expression plasmid pXMJ19-glnA is constructed from *G. cerevisiae*-derived *glnA*, as reported in the literature (Enhancing L-glutamine production in *Corynebacterium glutamicum* by rational metabolic engineering combined with a two-stage pH control strategy, 2021, Qinglan Lv et al.). Sc The expression plasmid pXMJ19-Sc-glnA was constructed using codon-optimized, unmutated glnA from *Saccharomyces cerevisiae*, and the expression plasmid pXMJ19-glnA was constructed using endogenous glnA from the originating strain. All these expression plasmids were transformed into *Corynebacterium glutamicum* MHZ-0513-3. Comparison revealed that the glutamine synthase mutant from *Saccharomyces cerevisiae* was more conducive to glutamine production. Furthermore, single-point verification showed that the mutations C160W and L284P were effective, and the coexistence of both had a synergistic effect.

[0006] The specific technical solution of the present invention is as follows:

[0007] A Sc-glnA mutant, with the amino acid sequence of wild-type Sc-glnA as a reference sequence, wherein the Sc-glnA mutant contains a mutation in which cysteine ​​(C) at position 160 is replaced by tryptophan (W), and / or contains a mutation in which leucine (L) at position 284 is replaced by proline (P).

[0008] In this invention, wild-type Sc-glnA is a protein expressed by codon optimization of glutamine synthase derived from Saccharomyces cerevisiae.

[0009] The reference sequence may be the sequence numbered SCEN_P03350 by NCBI.

[0010] This invention, through error-prone PCR, obtained a mutant strain MHZ-0513-3 / pXMJ19-Sc-glnA6 that accumulated 33.4 g / L of glutamine, with acid production 8.4% higher than the control strain MHZ-0513-3 / pXMJ19-Sc-glnA. This indicates that point mutations C160W and L284P in Sc-glnA6 are beneficial for glutamine production. Furthermore, this invention verifies through single-point testing that C160W and L284P mutations also contribute to increased glutamine yield. Clearly, the Sc-glnA mutant containing either or both of C160W and L284P is beneficial for the production of glutamine and its derivatives.

[0011] Preferably, the amino acid sequence of the Sc-glnA mutant is shown in SEQ ID NO.2.

[0012] The present invention also provides a DNA molecule, with SEQ ID NO.1 as a reference sequence, wherein the DNA molecule contains a mutation in bases 478-480 where TGC in SEQ ID NO.1 is mutated to TGG, and / or contains a mutation in bases 850-852 where CTG in SEQ ID NO.1 is mutated to CCG.

[0013] The nucleotide sequence shown in SEQ ID NO.1 is a codon-optimized sequence of glutamine synthase from Saccharomyces cerevisiae, which can be better expressed in Corynebacterium glutamicum.

[0014] The present invention also provides a recombinant microorganism expressing the above-mentioned Sc-glnA mutant.

[0015] Preferably, the starting strain of the recombinant microorganism is Corynebacterium glutamicum.

[0016] The present invention further provides any of the following applications of the above-mentioned recombinant microorganisms:

[0017] (1) Application in the fermentation production of L-glutamine and its derivatives;

[0018] (2) Application in microbial genetic breeding for the production of L-glutamine and its derivatives;

[0019] (3) Application in increasing the yield of L-glutamine and its derivatives in fermentation production.

[0020] The present invention also provides a method for producing L-glutamine, which includes a step of fermentation culture with recombinant microorganisms as described above.

[0021] The beneficial effects of the present invention are at least as follows:

[0022] The fermentation strain possessing the mutant of this invention exhibits a significantly enhanced ability to produce glutamine. This invention provides a novel method for the fermentation production of glutamine. Detailed Implementation

[0023] The preferred embodiments of the present invention will be described in detail below with reference to examples. It should be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and intent. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. Where specific techniques or conditions are not specified in the following examples, they are performed according to the techniques or conditions described in the literature in the art, or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0024] The primer names and sequences involved in the embodiments of this invention are shown in Table 1.

[0025] Table 1 Primer sequences (SEQ ID No. 3-10)

[0026] F TCCCcccgggATGGCAGAAGCATCCATCGA R TCCCcccgggTTAGGAGGATTCGCGTTCGA 6-1-R CCAGTAGTATGGGCCTTGTGGT 6-1-F ACCACAAGGCCCATACTACTGG 6-2-F ACGCAGAACACATCAAGCCG 6-2-R CGGCTTGATGTGTTCTGCGT P1 TGTGAGCGGATAACAATTTCA P2 TTCTGATTTAATCTGTATCAGGCTGA

[0027] Example 1: Construction of a mutant library of glutamine synthase derived from Saccharomyces cerevisiae

[0028] To ensure the normal expression of glutamine synthase derived from Saccharomyces cerevisiae in Corynebacterium glutamicum, the codons of glutamine synthase were optimized (the nucleotide sequence of the optimized Sc-glnA is shown in SEQ ID No. 1). Subsequently, the gene was synthesized at Genewiz to obtain the plasmid pUC-Sc-glnA (the plasmid model is pUC-GW-Kan, and the insertion site is EcoRV). Then, a glutamine synthase mutant library was constructed using error-prone PCR.

[0029] The error-prone PCR system used in this invention is as follows: For every 50 μL of system, add 5 μL of 10× error-prone PCR buffer (100 mmol / L Tris-HCl pH 8.3, 500 mmol / L KCl, 1% Triton, 20 mmol / L MgCl2, 5 μL of 10× dNTP mixture (1 mmol / L dGTP, 1 mmol / L dATP, 5 mmol / L dCTP, 5 mmol / L dTTP); 50 pmol each of primers F and R; 10 ng of DNA template (pUC-Sc-glnA); and 5 μL of 5 mmol / L Mn2. 2+2.5 μL of 15 U / μL Taq DNA polymerase, 5 μL of 25 mmol / L Mg 2+ Add sterilized ultrapure water to a total volume of 50 μL.

[0030] The error-prone PCR program was as follows: 95℃ for 5 min; 94℃ for 1 min, 55℃ for 1 min, 72℃ for 1 min 30 s, for 30 cycles; 72℃ for 10 min. The PCR gel recovery product obtained in the first cycle was used as a template for the next round of error-prone PCR. This process was repeated for a total of 5 rounds of error-prone PCR to finally obtain the Sc-glnA mutant fragment.

[0031] Constructing the Sc-glnA expression plasmid:

[0032] The obtained Sc-glnA mutant fragment was purified using an agarose gel extraction kit (Tiangen), then digested with XmaI. Simultaneously, pXMJ19 was digested with XmaI and dephosphorylated with FastAP. The mutant fragment was ligated to the vector using T4 DNA ligase (TransGen Biotech), transformed into Trans1T1 competent cells (TransGen Biotech), and kanamycin-resistant clones were selected. XmaI digestion confirmed the presence of the inserted fragment in pXMJ19, and sequencing using P1 / P2 primers (Invitrogen) confirmed the correct insertion. The resulting plasmid was named pXMJ19-Sc-glnAX, where X = 1, 2, 3…n. The control plasmid was pXMJ19-Sc-glnA, meaning the inserted fragment Sc-glnA underwent codon optimization but was not mutated.

[0033] Example 2: Construction of MHZ-0513-3 / pXMJ19-Sc-glnA mutant strain and its glutamine production performance.

[0034] The plasmid pXMJ19-Sc-glnAX was electroporated into MHZ-0513-3 (Corynebacterium glutamicum, disclosed in CN106701649A, is classified as Corynebacterium glutamicum and was deposited on November 30, 2016, at the China General Microbiological Culture Collection Center, Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, accession number CGMCC No. 13405), yielding strain MHZ-0513-3 / pXMJ19-Sc-glnAX. Shake-flask fermentation was then performed to detect glutamine production. After multiple experiments, a strain with high glutamine production, MHZ-0513-3 / pXMJ19-Sc-glnA6, was selected. Sequencing revealed two point mutations in this strain: C160W and L284P.

[0035] Similarly, glnA from Corynebacterium glutamicum (NCBI ID CEY17_10860) and glnA from Saccharomyces cerevisiae (as reported in the literature, "Enhancing L-glutamine production in Corynebacterium glutamicum byrationalmetabolic engineering combined with a two-stage pH control strategy, 2021, Qinglan Lv et al.") were expressed in Corynebacterium glutamicum using the above method, resulting in mutant strains MHZ-0513-3 / pXMJ19-glnA and MHZ-0513-3 / pXMJ19-glnA. Sc .

[0036] Six bacterial strains were used: MHZ-0513-3, MHZ-0513-3 / pXMJ19 (with plasmid pXMJ19 transformed into MHZ-0513-3), MHZ-0513-3 / pXMJ19-glnA, and MHZ-0513-3 / pXMJ19-glnA. Sc MHZ-0513-3 / pXMJ19-Sc-glnA and MHZ-0513-3 / pXMJ19-Sc-glnA6 were subjected to shake-flask fermentation, and the glutamine content was detected.

[0037] Method for verifying glutamine production through fermentation: The strain stored in glycerol tubes at -80℃ was inoculated into the above-mentioned slant culture medium for activation. After culturing at 33℃ for 24 hours, mycelial growth occurred. Mycelial growth was picked from the freshly activated slant and inoculated into the above-mentioned seed culture medium. The culture was then incubated at 33℃ with shaking at 100 rpm until the mid-to-late logarithmic growth stage, for 5 hours to obtain the seed culture. 10% of this seed culture was inoculated into a 500 ml shake flask containing 20 ml of fermentation medium and incubated at 33℃ with shaking at 150 rpm for 48 hours. The results are shown in Table 2 (OD). 562 The turbidity of the culture medium at 562 nm indicates the cell mass, and Gln (g / L) indicates the amount of accumulated L-glutamine.

[0038] The culture medium formula is as follows:

[0039] Slant culture medium: brain heart extract 37 g / L, agar 1.8%, sterilized at 121℃ and 0.1 MPa for 20 min;

[0040] The seed culture medium consisted of: glucose 50 g / L, urea 5 g / L, KH2PO4 2.0 g / L, MgSO4·7H2O 1.0 g / L, corn steep liquor 30 g / L, and pH 7.0.

[0041] The fermentation medium was: glucose 90 g / L, (NH4)2SO4 40 g / L, KH2PO4 2.0 g / L, MgSO4·7H2O 1.0 g / L, corn steep liquor 10 g / L, CaCO3 50 g / L, pH 7.0.

[0042] Table 2. Detection of glutamine content in mutant strains.

[0043]

[0044] Shake-flask fermentation results showed that strain MHZ-0513-3 / pXMJ19-glnA Sc The glutamine production was higher than that of MHZ-0513-3 / pXMJ19-glnA, but comparable to that of the codon-optimized MHZ-0513-3 / pXMJ19-Sc-glnA. This indicates that glnA from *Saccharomyces cerevisiae* is superior to glnA from *Corynebacterium glutamicum* itself, and that codon optimization has virtually no impact on Sc-glnA activity. The mutant strain MHZ-0513-3 / pXMJ19-Sc-glnA6 accumulated 33.4 g / L of glutamine, representing an 8.4% increase in acid production compared to the control strain MHZ-0513-3 / pXMJ19-Sc-glnA. This demonstrates that Sc-glnA6 is superior to the unmutated Sc-glnA and the glnA reported in the literature. ScSequencing revealed that Sc-glnA6 contains point mutations C160W and L284P. To verify the effectiveness of these two points, single-point verification was performed below.

[0045] Example 3: Construction of single-point mutant strain and its performance in producing glutamine

[0046] The construction method of strain MHZ-0513-3 / pXMJ19-Sc-glnA6-1 is as follows:

[0047] Using Phusion high-fidelity polymerase (New England BioLabs), the recombinant fragment UP was prepared using plasmid pXMJ19-Sc-glnA as a template and F / 6-1-R as a primer. The recombinant fragment DN was prepared using 6-1-F / R as a primer. The resulting fragments were purified using an agarose gel extraction kit (Tiangen). Subsequently, using UP and DN as templates and F / R as primers, the recombinant fragments were prepared and purified using an agarose gel extraction kit (Tiangen). Then, the fragments were digested with XmaI, and pXMJ19 was digested with XmaI and dephosphorylated with FastAP. The fragments were ligated to the vector using T4 DNA ligase (TransGen Biotech). The cells were transformed into Trans1T1 competent cells (TransGen Biotech). Kanamycin-resistant clones were picked, and positive clones with fragment insertion into pXMJ19 were identified by XmaI restriction enzyme digestion. The correct insertion of the fragment was further confirmed by sequencing with P1 / P2 primers (Invitrogen).

[0048] In this embodiment, plasmid pXMJ19-Sc-glnA6-1 was electroporated to MHZ-0513-3 to obtain strain MHZ-0513-3 / pXMJ19-Sc-glnA6-1, and then shake-flask fermentation was carried out according to the method in Example 2 to detect the yield of glutamine and glutamic acid.

[0049] Similarly, the construction process of plasmid pXMJ19-Sc-glnA6-2 ​​was as described above (the primers used were F / 6-2-R and 6-2-FR). Plasmid pXMJ19-Sc-glnA6-2 ​​was electroporated to MHZ-0513-3 to obtain strain MHZ-0513-3 / pXMJ19-Sc-glnA6-2. Then, shake-flask fermentation was carried out according to the method in Example 2, and the yields of glutamine and glutamic acid were detected.

[0050] The results are shown in Table 2. Compared with the control strain MHZ-0513-3 / pXMJ19-Sc-glnA, the glutamine production of MHZ-0513-3 / pXMJ19-Sc-glnA6-1 increased to 32.1 g / L and the acid production increased by 4.2%. The glutamine production of MHZ-0513-3 / pXMJ19-Sc-glnA6-2 ​​increased to 31.8 g / L and the acid production increased by 3.2%. It can be seen that C160W and L284P are both effective and have a synergistic effect when they are present at the same time.

[0051] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A Sc-glnA mutant, characterized in that, The amino acid sequence of the Sc-glnA mutant is obtained by replacing cysteine ​​at position 160 with tryptophan and / or leucine at position 284 with proline in the amino acid sequence of wild-type Sc-glnA as shown in NCBI number SCEN_P03350.

2. The Sc-glnA mutant according to claim 1, characterized in that, The amino acid sequence of the Sc-glnA mutant is shown in SEQ ID NO.

2.

3. A DNA molecule, characterized in that, The nucleotide sequence of the DNA molecule is obtained by mutating bases 478-480 to TGG and / or bases 850-852 to CCG, as shown in SEQ ID NO.

1.

4. A recombinant microorganism, characterized in that, The recombinant microorganism expresses the Sc-glnA mutant as described in claim 1 or 2.

5. The recombinant microorganism according to claim 4, characterized in that, The starting strain of the recombinant microorganism was Corynebacterium glutamicum.

6. Any of the following applications of the recombinant microorganism according to claim 4 or 5: (1) Application in the fermentation production of L-glutamine; (2) Application in the genetic breeding of microorganisms for the production of L-glutamine; (3) Application in increasing the yield of L-glutamine produced by fermentation.

7. A method for producing L-glutamine, characterized in that, It includes the step of fermenting and culturing with recombinant microorganisms as described in claim 4 or 5.

Images