A method for constructing SUV39H1 gene conditional knockout mice

Abstract

The present invention discloses a method for constructing a SUV39H1 gene conditional knockout mouse, and relates to the technical field of animal model construction. The present invention provides a sgRNA targeting the mouse SUV39H1 gene, wherein the sgRNA includes a 5'Guide sequence and a 3'Guide sequence; the 5'Guide sequence includes a sequence shown in any one of SEQ ID NO.1 to SEQ ID NO.7; the 3'Guide sequence includes a sequence shown in any one of SEQ ID NO.8 to SEQ ID NO.14. The present invention is based on CRISPR / Cas9 technology, and a SUV39H1 gene conditional knockout mouse is constructed through the sgRNA and screening and hybridization. The construction method of the SUV39H1 gene conditional knockout mouse of the present invention is efficient, fast, and simple, and the obtained SUV39H1 gene conditional knockout mouse has good stability, providing an economical and reliable animal model for studying the function of the SUV39H1 gene and its role in different physiological and pathological situations.

Description

Technical Field

[0001] The present invention relates to the technical field of animal model construction, and in particular to a method for constructing a SUV39H1 gene conditional knockout mouse. Background Art

[0002] When it comes to the background of transgenic mouse construction, CRISPR-Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats Cas9) technology is undoubtedly an exciting and revolutionary tool. This technology is derived from an adaptive immune defense mechanism formed by bacteria and archaea during the long-term evolution to fight against invading viruses and foreign DNA. It is a shining pearl in the field of gene editing and is known as the "scissors" of genetic engineering. CRISPR-Cas9 has become the third generation of gene editing technology, replacing the previous ZFN and TALENs technologies. It is popular because of its high efficiency, simplicity, low cost and ease of use. This technology enables scientists to accurately edit the genes of organisms, opening up unprecedented research and treatment avenues.

[0003] In CRISPR-Cas9 gene editing technology, one of the key elements is sgRNA (guide RNA). sgRNA is an artificially designed RNA molecule that recognizes and locates a specific sequence in the target genome. Once the sgRNA matches the target sequence, it will guide the Cas9 protease to precisely cut the DNA double strand, causing a double-strand break. This break can be repaired by the cell's natural repair mechanisms, including non-homologous end joining (NHEJ) and homologous recombination-directed repair (HDR). This repair process allows scientists to modify the genome for a variety of research and therapeutic purposes. It is worth noting that the target recognition ability of sgRNA depends on its specific sequence. Normally, when the interval between genes is large, the misrecognition of the target sequence by sgRNA does not lead to serious consequences. However, when the gene is located close upstream and downstream of the target position, it may interfere with the structure of other genes, which may have an adverse effect on the transgenic results.

[0004] In short, CRISPR-Cas9 technology provides unprecedented tools and opportunities for the construction of transgenic mice, opening up broad prospects for scientists in genetic research and treatment. Summary of the invention

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a method for constructing a SUV39H1 gene conditional knockout mouse.

[0006] To achieve the above object, the technical solution adopted by the present invention is: an sgRNA targeting the mouse SUV39H1 gene, the sgRNA comprising a 5'Guide sequence and a 3'Guide sequence; the 5'Guide sequence comprises a sequence shown in any one of SEQ ID NO.1 to SEQ ID NO.7; the 3'Guide sequence comprises a sequence shown in any one of SEQ ID NO.8 to SEQ ID NO.14.

[0007] The SUV39H1 gene plays a vital role in cell and biological research. It is a gene encoding a histone transferase that regulates the structure and function of chromatin by catalyzing histone modification. The function of the SUV39H1 gene affects key biological processes such as normal differentiation, development and cell cycle of cells. In addition, abnormal expression of SUV39H1 is closely related to the occurrence and development of various diseases. The present invention designs sgRNAs for the exon2-3 region of the SUV39H1 gene, which plays a key role in the function of SUV39H1. The present invention places sgRNAs in the non-conserved regions of intron1 and intron3, respectively, to ensure precise targeting. The sgRNA targeting the mouse SUV39H1 gene of the present invention can selectively knock out the exon2-3 region of SUV39H1 locally or systemically under specific conditions, thereby studying its exact role in gene expression and chromosome structure regulation.

[0008] As a preferred embodiment of the sgRNA targeting the mouse SUV39H1 gene of the present invention, the 5'Guide sequence is shown as SEQ ID NO.4; the 3'Guide sequence is shown as SEQ ID NO.10.

[0009] As a preferred embodiment of the sgRNA targeting the mouse SUV39H1 gene of the present invention, the recognition site of the sgRNA is on both sides of exons 2 to 3 of the SUV39H1 gene.

[0010] The present invention also provides a method for constructing a SUV39H1 gene conditional knockout mouse, comprising the following steps:

[0011] (1) Design and screen sgRNA targeting the mouse SUV39H1 gene;

[0012] (2) microinjecting sgRNA, Cas9 protein and targeting vector into mouse fertilized eggs, transplanting the fertilized eggs into pseudopregnant mice, and identifying the genotypes of the offspring born by the pseudopregnant mice to obtain F0 generation mice;

[0013] (3) mating F0 mice with wild-type mice to obtain F1 mice;

[0014] (4) The F1 generation heterozygous mice were screened by genotyping and mated with Cre tool mice to obtain the SUV39H1 gene conditional knockout mice.

[0015] As a preferred embodiment of the method for constructing the SUV39H1 gene conditional knockout mouse of the present invention, the nucleotide sequence of the sgRNA in step (1) is shown as SEQ ID NO.4 and SEQ ID NO.10.

[0016] As a preferred embodiment of the method for constructing SUV39H1 gene conditional knockout mice of the present invention, the 5' end identification primers used for genotype identification of F0 and F1 generation mice are shown as SEQ ID NO.15 and SEQ ID NO.16, and the 3' end identification primers are shown as SEQ ID NO.17 and SEQ ID NO.18.

[0017] As a preferred embodiment of the method for constructing the SUV39H1 gene conditional knockout mouse described in the present invention, when the genotype of the F0 and F1 generation mice is identified, the PCR amplification program is as follows: pre-denaturation at 94°C for 5 min; denaturation at 98°C for 30 s, annealing at 67°C for 30 s, extension at 68°C for 1 kb / min, with the annealing temperature reduced by 0.7°C for each cycle, for a total of 15 cycles; denaturation at 98°C for 30 s, annealing at 57°C for 30 s, extension at 68°C for 1 kb / min, for 25 cycles; extension at 68°C for 10 min.

[0018] The present invention also provides a method for constructing the SUV39H1 gene conditional knockout mouse and the obtained SUV39H1 gene conditional knockout mouse.

[0019] The present invention also provides the use of the SUV39H1 gene conditional knockout mouse in studying the functions and mechanisms of action of the SUV39H1 gene. By comparing the survival rate and health status of the SUV39H1 gene conditional knockout mouse and wild-type mice, the role of SUV39H1 in overall health can be studied; by studying the reproductive capacity of the conditional knockout mouse, the effect of SUV39H1 on fertility and reproduction can be understood.

[0020] The present invention also provides the use of the SUV39H1 gene conditional knockout mouse in screening or preparing drugs for treating diseases related to the SUV39H1 gene.

[0021] Beneficial effects of the present invention: The present invention provides a sgRNA targeting the mouse SUV39H1 gene, and the sgRNA targets and recognizes both sides of exons 2 to 3 of the SUV39H1 gene. Based on the CRISPR / Cas9 technology, a SUV39H1 gene conditional knockout mouse is constructed through the sgRNA and screening and hybridization. The construction method of the SUV39H1 gene conditional knockout mouse of the present invention is efficient, fast, and simple, and the obtained SUV39H1 gene conditional knockout mouse has good stability and a low off-target rate, providing an economical and reliable animal model for studying the function of the SUV39H1 gene and its role in different physiological and pathological situations. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a schematic diagram of the targeting vector region in the method for constructing SUV39H1 gene conditional knockout mice;

[0023] Figure 2 is the activity test result of sgRNA;

[0024] Figure 3 The electrophoresis diagrams of sgRNA-4 and sgRNA-10;

[0025] Figure 4 This is the pCS plasmid map.

[0026] Figure 5 Primer design principles for genotyping F0 generation mice;

[0027] Figure 6 Schematic diagram of the mating scheme for SUV39H1 gene conditional knockout mice;

[0028] Figure 7 Schematic diagram of the homozygous mating scheme for SUV39H1 gene conditional knockout mice;

[0029] Figure 8 This is a graph showing the PCR results of the SUV39H1 gene conditional knockout mice constructed in Example 1;

[0030] Fig. 9 This is a Western blot analysis of the SUV39H1 gene conditional knockout mouse constructed in Example 1;

[0031] Fig.10 This is the immunohistochemical analysis of the SUV39H1 gene conditional knockout mouse constructed in Example 1;

[0032] Fig.11 The proliferation and migration rates of adipose stem cells from mice with conditional knockout of the SUV39H1 gene constructed in Example 1;

[0033] Fig.12 The aging-related secretory phenotype changes of adipose stem cells in mice with conditional knockout of the SUV39H1 gene constructed in Example 1. DETAILED DESCRIPTION

[0034] The following is a further detailed description of the above contents of the present invention through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies implemented based on the above contents of the present invention belong to the scope of the present invention.

[0035] Example 1 Construction of SUV39H1 gene conditional knockout mice

[0036] This embodiment provides a method for constructing a SUV39H1 gene conditional knockout mouse, which specifically includes the following steps:

[0037] 1. Design of sgRNA

[0038] The mouse SUV39H1 gene described in the present invention is located on the antisense strand of the X chromosome, with a total length of 13.6 kb. Its gene ID in NCBI is 20937. Based on the design principles of CRISPR SgRNA and taking into account the structure of the mouse SUV39H1 gene, it was found that there were 5 transcripts in total, and SUV39H1-203 was finally selected for design, among which exon2-3 can be conditionally knocked out. The 5' and 3' LoxP sites are inserted into the non-conserved regions in intron1 and intron3, respectively; the homology arms at the 5' and 3' ends are approximately 1.5 kb. This embodiment designs 14 different targeting sites, and the schematic diagram of the knockout region is shown in FIG. Figure 1 The specific sgRNA sequences are shown in Table 1.

[0039] Table 1 Sequences of sgRNA

[0040]

[0041]

[0042] The activity of the sgRNA in Table 1 was tested, specifically by constructing sgRNA and Cas9 expression plasmids and transfecting cells, screening positive mixed clones, selecting and culturing single clones, and using PCR experiments to detect editing efficiency and identify knockout types. The test results are shown in Figure 2 As shown, sgRNA-4 and sgRNA-10 were preferred for the next experiment.

[0043] Preparation of sgRNA RNA: sgRNA-4 and sgRNA-10 were linked to a T7 promoter plasmid vector and transcribed in vitro to obtain RNA for microinjection. PCR verification was performed and electrophoresis was performed in a 2% agarose gel at 65°C for 5 min. The results were as follows: Figure 3 shown.

[0044] 2. Construction of targeting vector

[0045] The targeting vector was purchased from Shanghai Zeye Biotechnology Co., Ltd.

[0046] 3. Obtain positive mice by transplantation injection:

[0047] The sgRNA sequence was synthesized into oligos and linked into the pCS vector by annealing polymerization to obtain the pCS plasmid. The map of the pCS plasmid is shown in Figure 4 As shown. The pCS plasmid and the targeting vector were microinjected into the fertilized mouse eggs and then transplanted into the oviduct of the pseudo-pregnant mother mice. When the F0 generation mice born by the pseudo-pregnant mother mice grew to one week old, the tails of about 2 mm were cut and the tail genome was extracted for genotype identification.

[0048] Primers were designed based on the two sites of Floxed insertion. The principles of primer design are as follows: Figure 5 The primer information is shown in Table 2, and the PCR reaction conditions and reaction system are shown in Table 3 below.

[0049] Table 2 Identification primer information

[0050]

[0051]

[0052] Table 3 PCR reaction conditions

[0053]

[0054] 4. Screen the positive F0 generation mice and mate them with wild-type mice to obtain F1 generation mice. The F1 generation mice are identified and screened for positive heterozygotes. The identification scheme is the same as that for F0 generation mice.

[0055] 5. Mating the F1 generation positive heterozygous mice with Cre-deleter mice, such as Figure 6 As shown, heterozygous mice (SUV39H1 gene conditional knockout mice, genotype is △ / +, Cre / +) were obtained and mated with each other. Figure 7 As shown, homozygous mice (genotype is + / +, Cre / +) are obtained. The genotype identification strategy of the SUV39H1 gene conditional knockout mice is shown in Table 4, and the genotype identification strategy of the homozygous mice is shown in Table 5.

[0056] Table 4

[0057]

[0058] Table 5

[0059]

[0060]

[0061] Example 2

[0062] This example verifies the SUV39H1 gene conditional knockout mice constructed in Example 1. The specific experimental method is as follows:

[0063] CAG-Cre mice were hybridized with SUV39H1-Flox mice to obtain CAG-SUV39H1 conditional knockout mice, and the identification method was the same as step 5 of Example 1. Comparison showed that the survival status, health status, and reproductive rate of CAG-SUV39H1 conditional knockout mice were no different from those of control mice.

[0064] Adipose tissue and adipose-derived stem cells, which are easier to obtain, were selected for subsequent experiments to verify the knockout efficiency of CAG-SUV39H1 conditional knockout mice, as follows:

[0065] 1. PCR verification: The following primers and conditions were used to perform PCR verification on CAG-SUV39H1 conditional knockout mice. The results were as follows: Figure 8 As shown. The PCR program is: 95℃ 5min; 95℃ 10s, 60℃ 20s, 72℃ 20s, 40cycles; 95℃ 5s; 65℃ 1min; 4℃∞. Specific PCR primers: Forward: GCAGTGTGTGCTGTAAATCT; Reverse: ATACCCACGCCACTTAACCA.

[0066] Depend on Figure 7 It was found that the expression efficiency of SUV39H1 in adipose-derived mesenchymal stem cells of CAG-SUV39H1 conditional knockout mice was decreased.

[0067] 2. Western blot analysis: DNA from CAG-SUV39H1 conditional knockout mice was extracted for Western blot analysis. The results are as follows: Fig. 9 As shown.

[0068] 3. Immunohistochemical analysis: Immunohistochemical analysis was used to analyze the expression level of SUV39H1 protein in CAG-SUV39H1 conditional knockout mice. Fig.10 shown.

[0069] 4. Detect the proliferation and migration rate of adipose stem cells in CAG-SUV39H1 conditional knockout mice and control mice. The results are as follows Fig.11 The control mice are the same littermate control mice of CAG-SUV39H1 mice. Fig.11 It can be seen that knocking out SUV39H1 can reduce the proliferation and migration ability of adipose-derived mesenchymal stem cells.

[0070] 5. Detection of changes in secretory phenotype associated with aging of adipose stem cells in the SUV39H1 gene conditional knockout mice and control mice. The results are as follows: Fig.12 As shown. Fig.12 It can be seen that the constructed CAG-SUV39H1 mice can change the SASP expression level of adipose-derived mesenchymal stem cells.

[0071] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A sgRNA combination targeting mouse SUV39H1 gene, characterized in that: The sgRNA combination includes a 5'Guide sequence and a 3'Guide sequence; the 5'Guide sequence is shown as SEQ ID NO.4; the 3'Guide sequence is shown as SEQ ID NO.10; the recognition sites of the sgRNA combination are respectively located before exon 2 and after exon 3 of the SUV39H1 gene.

2. A method for constructing a SUV39H1 gene conditional knockout mouse, characterized in that: The following steps are involved: (1) Design and screen sgRNA combinations targeting the mouse SUV39H1 gene; (2) The sgRNA combination, Cas9 protein and targeting vector are microinjected into mouse fertilized eggs, and the fertilized eggs are transplanted into pseudo-pregnant mice. The genotypes of the offspring born by the pseudo-pregnant mice are identified to obtain F0 generation mice; (3) mating F0 mice with wild-type mice to obtain F1 mice; (4) F1 heterozygous mice were selected through genotyping and mated with Cre mice to obtain the SUV39H1 gene conditional knockout mice; The nucleotide sequences of the sgRNA in step (1) are shown in SEQ ID NO.4 and SEQ ID NO.

10.

3. The method for constructing a SUV39H1 gene conditional knockout mouse according to claim 2, characterized in that: The 5' end identification primers used for genotype identification of the F0 and F1 generation mice are as shown in 5'loxP-F: TGTCCTATGCCAGGAATTCGCCTAA and 5'loxP-R: AGCCTACACACCAGGAAGCATCAAC; the 3' end identification primers are as shown in 3'loxP-F: AGGTCTGGGCATAAGGTTGCAGAAC and 3'loxP-R: GGGGTCATTCTATCCCCAAAGGGGT.

4. The method for constructing a SUV39H1 gene conditional knockout mouse according to claim 2, characterized in that: When the genotype of the F0 and F1 generation mice was identified, the PCR amplification program was 94°C pre-denaturation for 5 min; 98°C denaturation for 30 s, 67°C annealing for 30 s, 68°C extension at 1 kb / min, with the annealing temperature reduced by 0.7°C in each cycle, for a total of 15 cycles; 98°C denaturation for 30 s, 57°C annealing for 30 s, 68°C extension at 1 kb / min, for 25 cycles; and 68°C extension for 10 min.

5. Use of the SUV39H1 gene conditional knockout mouse obtained by the construction method according to any one of claims 2 to 4 in studying the functions and mechanisms of action of the SUV39H1 gene.

Images