Double-stranded RNA for biological control of pests and its application

Abstract

The present application relates to the field of biological pesticides, and specifically to a double-stranded RNA for biological control of pests and its application. The present application also provides an RNA that causes silencing of the AChE gene of pests, which is a primer pair for cotton bollworm, or a combination of a primer pair for cotton bollworm and a primer pair for diamondback moth or a primer pair for beet armyworm. The present application also provides an engineered bacterium that expresses the above RNA, and a target RNA produced by the engineered bacterium, wherein the target RNA is a double-stranded RNA for biological control of pests. In addition, the present application also provides a wettable powder of double-stranded RNA. The prepared wettable powder was tested for insecticidal efficacy, and the results showed that the RNA preparation was effective in controlling a variety of pests, and had up to 95% protection for vegetables.

Description

Technical Field

[0001] The invention relates to the field of biological pesticides, and relates to a double-stranded RNA for biological control of pests and an application thereof. Background Art

[0002] RNA interference (RNAi) is a new technology for pest control. It uses the RNA regulatory mechanism in the pest to deliver the target gene into the body in the form of double-stranded RNA, causing gene silencing and leading to the death of the pest. This technology is green, environmentally friendly, simple and convenient. In today's environment where chemical pesticides are causing serious environmental pollution, increasing resistance and unresolved residue problems, it has become an excellent alternative.

[0003] As insects' detoxification ability to chemical pesticides gradually increases and their sensitivity to insecticide target sites gradually decreases, the mechanism of RNA interference technology has been studied more thoroughly, and its application in transgenic plant cultivation and disease control has become more mature. People have begun to apply RNA interference technology to pest control. Researchers are constantly exploring more efficient target genes, better ways to introduce double-stranded RNA, and the appropriate frequency of double-stranded RNA use to improve the silencing effect of RNA interference. RNA interference technology has been successfully applied to various types of pests such as Diptera, Coleoptera, Lepidoptera, Hymenoptera, Hemiptera, and Orthoptera under laboratory conditions. RNA interference has shown great potential in pest control.

[0004] The screening of RNA interference target genes generally starts from the following aspects, including direct lethal genes, genes related to pest egg laying or mating such as vitellogenin receptor (VgR), genes related to pest growth and development such as juvenile hormone and ecdysone, genes related to pest resistance and immunity that can reduce the resistance of pests to long-term pesticide use, and functional genes such as genes related to olfaction to interfere with pest recognition of crops.

[0005] In the article by Yojana et al. (Yojana R. Chikate, Vishal V. Dawkar, Ranjit S. Barbole, Priyadarshini V. Tilak, Vidya S. Gupta, Ashok P. Giri. RNAi of selected candidate genes interrupts growth and development of Helicoverpa armigera [J]. Pesticide Biochemistry and Physiology, 2016, 133), dozens of candidate enzymes / proteins including trypsin, chymotrypsin, glutathione S transferase, cathepsin L, fatty acid binding protein, esterase, catalase, superoxide dismutase, and chitin deacetylase were compared, and it was found that the acetylcholinesterase gene, after being synthesized into double-stranded RNA in vitro and fed to the cotton bollworm Helicoverpa armigera, could cause a good RNA interference effect, resulting in the highest mortality rate. Therefore, the acetylcholinesterase gene was selected for the induced expression of double-stranded RNA experiment in engineered bacteria.

[0006] Acetylcholinesterase (AChE), an essential esterase in living organisms, has the main and most basic function of hydrolyzing acetylcholine (ACh) into acetic acid and choline, thereby ensuring the normal transmission of nerve signals and preventing excessive accumulation of acetylcholine in the synaptic cleft, which leads to nerve twitching, spasm and eventual death. In other words, as long as acetylcholinesterase is inactivated or its activity is inhibited, it can disrupt the insect's nervous system, causing the insect's nervous system to be in an excited state for a long time, thereby affecting the insect's other physiological activities and reproductive survival. Therefore, the acetylcholinesterase gene is a direct lethal gene.

[0007] Since the theory of acetylcholine was proposed in 1914 and it was separated and identified in 1932, the research on acetylcholinesterase has been continuously deepened. People have found that the function of acetylcholinesterase is not limited to basic catalysis. It can affect the adhesion of cells. For example, it can interact with the bone cell matrix in bone cells; it also has a certain relationship with cell adhesion in nerve cells, promotes axon growth, induces synapse formation, and participates in the migration of nerve cells. In addition, acetylcholinesterase can also promote platelet production to solve the problem of thrombocytopenia after stem cell transplantation, promote cell apoptosis as a marker of cell apoptosis, affect amyloid protein metabolism and aggregation, regulate dopamine-cholinergic nerve activity, and relate to the learning and memory function of rats. In short, acetylcholinesterase and acetylcholinesterase inhibitors have gradually separated from theory and are widely used in various fields such as medicine, agriculture, and biological research.

[0008] In invertebrates, choline can only be hydrolyzed by acetylcholinesterase, so the role of acetylcholinesterase is more important in invertebrates, and its types are more complex and diverse than those in vertebrates. The gene encoding acetylcholinesterase is called Ace gene, and there are mostly only two types, Ace 1 and Ace 2.

[0009] There are many lepidopteran pests that harm crops, including the cotton bollworm Helicoverpa armigera, the diamondback moth Plutella xylostella, the beet armyworm Spodoptera exigua, the cutworm Spodoptera litura Fabricius, the fall armyworm Spodoptera frugiperda, etc., which are the most serious lepidopteran insects that harm vegetables. Among them:

[0010] Cotton bollworms mainly harm crops such as cabbage, corn, and tomatoes. The number of eggs they lay varies greatly at different temperatures, with the highest being more than 900 eggs. The eggs hatch into larvae in 2 to 4 days. The larvae are 4 mm long, and the adults are 15 to 18 mm long, with wings 32 to 35 mm wide. The front wings have irregular black spots and light gray wavy lines, and the hind wings are white. At suitable temperatures, a complete generation takes 31 to 36 days, with as few as 3 generations and as many as 8 generations in a season. After the second instar, they can eat the leaves, causing a reduction in vegetable yields.

[0011] The diamondback moth is also known as the small green caterpillar. The larvae are mostly dark brown, 9 to 12 mm long, with a yellow-brown head and visible patterns on the pronotum. The pupa is yellow-green or gray-brown, 7 to 9 mm long, and covered with a silk cocoon. This insect is most serious in dry and warm conditions, with as few as 5 and as many as 18 generations a year. The diamondback moth has strong adaptability and pesticide resistance. It is one of the 20 most resistant pest species reported so far. It has developed a high resistance to commonly used organophosphorus and pyrethroid pesticides, and the range of pesticides available is small;

[0012] Beet armyworm, also known as corn armyworm, belongs to the Noctuidae family of the Lepidoptera order. It is a very difficult Lepidoptera pest to control, and harms many vegetables, such as soybeans, cabbage, red beans, eggplants, potatoes, etc. The egg stage of beet armyworm is 2 to 5 days. The adult body length is 11 to 14 mm, the wing width is 23 to 28 mm, and there are triangular black spots on the forewings. This type of insect is generally gray-brown. When it grows to the 3rd to 4th instar larvae, it feeds on crops in large quantities. In severe cases, it can eat all the leaves. Under suitable growth conditions, 5 to 8 generations can occur in a year;

[0013] Helicoverpa armigera, Plutella xylostella and Spodoptera exigua are all lepidopteran pests, which have a huge impact and damage on the growth of agricultural crops in my country, greatly affecting the quality and output of agricultural products, and have a direct impact on the country's economy, environment and food demand. Therefore, these three pests will be used as the main research objects, and RNA interference technology will be used to identify only the corresponding mRNA sequence and not cause harm to non-target organisms. The characteristics of the study will be studied to study biological pesticides that are harmless to humans and the environment and can prevent and control pests, thereby providing some laboratory theoretical basis as a reference for the development of new RNA interference agents.

[0014] In recent years, the global extreme climate has occurred frequently, droughts and floods have occurred frequently, and human activities have intensified, causing serious ecological damage. As a result, the number of pest populations has increased significantly, and the frequency of insect disasters and pests has also increased, causing huge losses to the global agricultural economy. For this reason, pest control has become the focus of agricultural development. The common pest control methods currently include agricultural control, physical control, chemical control and biological control.

[0015] Since the phenomenon of RNA interference was discovered in 1998, it has been found in many organisms and has been proven to be highly conserved. However, at present, there are relatively few experiments on the RNA interference reaction of Lepidoptera in the relevant literature, and most of them are double-stranded RNA synthesized directly in vitro. However, double-stranded RNA synthesized in vitro is unstable in the environment (light and temperature can also inactivate RNA synthesized in vitro), easily decomposed in the body after being eaten by pests, difficult to reach the target of pests, low yield, high cost and other problems. For example, the price of the in vitro synthesis kit is 6556 yuan / 20 times. In addition, there may be multiple pests in the farmland at the same time, but an RNAi agent can only kill specific pests specifically, without broad spectrum, and is difficult to be accepted by farmers.

[0016] Therefore, in order to develop double-stranded RNA preparations and commercialize the application of RNA interference, the inventors mainly explored the possibility of cultivating double-stranded RNA in engineered bacteria, and used the genes of acetylcholinesterase, a key enzyme in various agricultural pests, as target genes, and tried to construct a variety of engineered bacteria corresponding to double-stranded RNA. And mixed a variety of engineered bacteria that synthesize double-stranded RNA to prepare a wettable powder for field pest control.

[0017] Specifically, this experiment chose to introduce double-stranded RNA by feeding, so that the research results can be used in field experiments outside the laboratory in the future. The method of generating double-stranded RNA has been improved, and the expensive in vitro synthesis kit has been replaced with an engineering bacterium that can generate it continuously, that is, Escherichia coli or Bacillus subtilis is used to cultivate more stable double-stranded RNA, solving a series of problems such as the high price, difficulty in absorption, and instability of double-stranded RNA synthesized in vitro. By adding a carrier, a surfactant and an RNase inhibitor to the double-stranded RNA, a wettable powder of double-stranded RNA is prepared for field pest control. And try to replicate this technology in other genes of other Lepidoptera insects (such as Plutella xylostella, Spodoptera exigua), in order to provide some new experience for the governance method mediated by RNA interference technology.

[0018] Since double-stranded RNA is very easy to degrade, the inventors developed a preparation formula, which was placed at room temperature to test the changes in RNA content and biological activity within one year, laying the foundation for the subsequent commercial application of double-stranded RNA preparations. Summary of the invention

[0019] In order to provide a method for enhancing the gene silencing effect of pests and improving the insecticidal effect, the present application provides a method for preparing a double-stranded RNA that causes AChE gene silencing in pests.

[0020] In the first aspect, the present application provides an RNA that causes silencing of the AChE gene of an insect pest, which is a primer pair for cotton bollworm, or a combination of one or two of a primer pair for cotton bollworm and a primer pair for diamondback moth or a primer pair for beet armyworm, wherein:

[0021] Helicoverpa armigera A: upstream primer F GTGGAGACTCAACGAAGATC, Seq_1;

[0022] Downstream primer R CTCTTAGACCACATAATGAACTC, Seq_2;

[0023] Plutella xylostella P1: upstream primer F ATTGTTTGGAGAATCGTCCG, Seq_3;

[0024] Downstream primer R GGATTCAGTTCTCTGACCGC, Seq_4; or

[0025] Plutella xylostella P2: upstream primer F GGCAAGAATTACTCACCCGA, Seq_5;

[0026] Downstream primer R CGGAAAAGCGAGATTCAAAC, Seq_6;

[0027] Spodoptera exigua S1: upstream primer F GGCTGTGTCGGTTTCATTG, Seq_7;

[0028] Downstream primer R GATTCAACTCTCTAACTGCCTGC, Seq_8; or

[0029] Spodoptera exigua S2: upstream primer F GGGAGAAGAAATGTGGAATCC, Seq_9;

[0030] Downstream primer R GCCGACTCACCAAATAATGTTA, Seq_10.

[0031] In a second aspect, the present application provides an engineered bacterium expressing RNA, the raw materials of which are: RNA that causes silencing of the AChE gene of pests, a vector and competent cells.

[0032] The vector is T Easy vector.

[0033] The competent cell is Escherichia coli, preferably Escherichia coli HT115 (DE3).

[0034] The method for preparing the engineered bacteria comprises the following steps:

[0035] 1) Preparation of pest total RNA: The intestinal and brain tissues of the corresponding pests were extracted using RNA prep pure animal tissue total RNA extraction kit to obtain pest total RNA;

[0036] 2) Preparation of template DNA:

[0037] Step 1) Prepare pest total RNA solution and synthesize single-stranded cDNA using M-MuLV first-strand cDNA synthesis kit, amplify it into double-stranded cDNA by polymerase chain reaction (PCR) technology, and use primers to locate the template DNA corresponding to the target double-stranded RNA;

[0038] 3) Preparation of plasmid: 1 μL of vector, 2 μL of template DNA prepared in step 2), 1 μL of T4 DNA Ligase, 5 μL of 2×Rapid Ligation Buffer, 1 μL of ddH2O; place at 4°C overnight to obtain plasmid;

[0039] 4) Transformation of plasmid: Prepare E. coli into competent cells and add the plasmid prepared in step 1), heat shock reaction after ice bath, then resuscitate in LB liquid culture medium, concentrate, discard the supernatant, precipitate and culture on a plate containing ampicillin, then pick a single colony and place it again in LB liquid culture medium containing ampicillin, culture, and obtain an engineered bacterium expressing RNA.

[0040] In the above method:

[0041] In the step 2):

[0042] Resistance plates containing ampicillin, the concentration of ampicillin is 50 μg / mL;

[0043] LB liquid medium containing ampicillin, the concentration of ampicillin is 50 μg / mL;

[0044] LB liquid culture medium composition: sodium chloride 1.0g, tryptone 1.0g, yeast extract powder 0.5g, deionized water 100mL, the culture medium was prepared according to the above proportions, the pH was adjusted to 7±0.2 (25°C), and sterilized at high temperature and high pressure to obtain a sterile culture medium.

[0045] Gene fragments of three different insect species, Helicoverpa armigera, Plutella xylostella and Spodoptera exigua, were transferred into E. coli. The maturity of this method in genetic engineering ensured the successful preparation of engineered bacteria. The engineered bacteria were investigated and found that the sequence had been successfully connected to the vector. By comparing the known acetylcholinesterase gene sequence, it was found that the plasmid already contained the target gene sequence. A few genes had mutated, but their mutations did not affect the subsequent induced expression and the effect of double-stranded RNA. Therefore, it can be determined that the plasmid has been successfully transferred into E. coli.

[0046] In a third aspect, the present application provides a double-stranded RNA produced by an engineered bacterium, which is induced to express by the following method: the engineered bacterium generates double-stranded RNA under the induction of IPTG, centrifuges, and freeze-dries.

[0047] The inducer is isopropyl-β-D-thiogalactoside;

[0048] The inducible expression method provided in the present application comprises the following steps: picking a single colony and placing it in an LB liquid culture medium solution containing ampicillin for overnight culture, taking the overnight cultured bacterial solution into an ampicillin-resistant 2×YT culture medium solution, culturing on a shaking table until OD600>0.8, adding IPTG solution, continuing to culture on a shaking table to obtain double-stranded RNA at 4°C and 4,000rpm, centrifuging, discarding the supernatant, obtaining bacterial mud, and drying.

[0049] The LB liquid culture medium mainly comprises the following components: 1.0 g sodium chloride, 1.0 g tryptone, 0.5 g yeast extract powder, and 100 mL deionized water. The culture medium is prepared according to the above proportions, the pH is adjusted to 7±0.2 (25° C.), and then sterilized by high temperature and high pressure to obtain a sterile culture medium.

[0050] The 2×YT culture medium mainly comprises: 0.5 g sodium chloride, 1.6 g tryptone, 1.0 g yeast extract powder, and 100 mL deionized water. The culture medium is prepared according to the above proportions, the pH is adjusted to 7±0.2 (25° C.), and then sterilized by high temperature and high pressure to obtain a sterile culture medium.

[0051] In various culture media containing ampicillin, the concentration of ampicillin was 50 μg / mL.

[0052] IPTG (Isopropyl-β-D-thiogalactoside, IPTG) solution: dissolve 238 mg of IPTG in 10 mL of deionized water and filter with a 0.22 μm filter membrane.

[0053] The centrifugation conditions are: 4°C, 4,000 rpm for 10 min.

[0054] The drying is freeze drying or spray drying, which can be prepared by conventional methods, or by the following method: pre-freeze at -80°C for 4 to 5 hours, open a vacuum freeze dryer for pre-freezing half an hour in advance, remove the cap of a 50 mL centrifuge tube containing the pre-frozen bacterial sludge, cover the tube mouth with a layer of film, and leave a number of air holes on the film (this step prevents impurities from falling into the freeze-drying process to ensure the purity of the freeze-dried product), place the centrifuge tube on a centrifuge tube rack and put it into a vacuum freeze dryer, and vacuum freeze for 18 hours at a cold trap temperature of -50 to -53°C and a pressure of 6 to 6.50 Pa to obtain a freeze-dried product.

[0055] In a fourth aspect, the present application also provides a wettable powder containing double-stranded RNA, comprising: double-stranded RNA, a carrier, a surfactant and an RNase inhibitor.

[0056] Specifically, the wettable powder comprises the following components in parts by weight: 10 parts of double-stranded RNA, 30-150 parts of a carrier, 2-9 parts of a surfactant and 2-9 parts of an RNase inhibitor.

[0057] Preferably, the wettable powder comprises the following components in parts by weight: 10 parts of double-stranded RNA, 60-120 parts of a carrier, 2-5 parts of a surfactant and 2-6 parts of an RNase inhibitor.

[0058] More preferably, the wettable powder comprises the following components in parts by weight: 10 parts of double-stranded RNA, 60-90 parts of a carrier, 3.5-5 parts of a surfactant and 3.5-5 parts of an RNase inhibitor.

[0059] Optimally, the wettable powder comprises the following components in parts by weight: 10 parts of double-stranded RNA, 60 parts of carrier, 4.2 parts of surfactant and 4.9 parts of RNase inhibitor.

[0060] In the above wettable powders:

[0061] The double-stranded RNA is lyophilized powder.

[0062] The surfactant is sodium dodecyl sulfate (SDS), BX, sodium lignin sulfonate (SL), calcium lignin sulfonate (CL), preferably calcium lignin sulfonate; the amount of the surfactant is 3-7% of the sum of the mass of the carrier and the double-stranded RNA, specifically 3%, 5%, and 7%;

[0063] The carrier is kaolin, bentonite, diatomaceous earth or white carbon black, preferably white carbon black; the mass ratio of the carrier to the double-stranded RNA is 3-15:1, specifically 15:1, 12:1, 9:1, 6:1, 3:1.

[0064] The RNase inhibitor is urea or sodium dodecyl sulfate (SDS), preferably urea; the dosage of the RNase inhibitor is 3-7% of the sum of the mass of the carrier and the double-stranded RNA, specifically 3%, 5%, and 7%.

[0065] The present application also provides a method for preparing a wettable powder, which comprises mixing any double-stranded RNA with a carrier, a surfactant and an RNase inhibitor, and freeze-drying or spray-drying to prepare a wettable powder.

[0066] The present application also provides the use of the wettable powder in preparing pesticides for preventing and controlling lepidopteran pests.

[0067] The application also provides a method for using the wettable powder: dilute the wettable powder with water by 200-400 times, and then spray it on the leaves of green vegetables.

[0068] In summary, this application has the following beneficial effects:

[0069] 1. The pest RNA extracted from the midgut of the larvae of cotton bollworm, diamondback moth and beet armyworm is the original gene sequence, and cDNA is generated by reverse transcription, PCR amplification and location of the target acetylcholinesterase gene, and the target gene is linked to T Easy vector, and then transformed into E. coli competent cells to obtain double-stranded RNA engineered bacteria.

[0070] 2. The engineered bacteria provided in the present application, after producing double-stranded RNA under IPTG induction, were fed to fourth-instar larvae, and it was found that the targeted gene was silenced; when fed to second-instar larvae of pests, a mortality rate of up to 60% was observed, the dead insect bodies turned black, while the other alive insects grew slowly, and the individuals were significantly smaller than the negative control.

[0071] 3. When conducting RNA interference experiments, the present application found that RNA, including double-stranded RNA, is easily degraded by RNase, and the preservation of double-stranded RNA has become a major problem. Therefore, four commonly used RNase inhibitors, urea, sodium dodecyl sulfate, vanadyl ribonucleoside complex and protein inhibitor RNasin, were tried to extend the storage time of double-stranded RNA. The results show that urea and RNasin have a high degree of inhibition on RNase and have the possibility of being used as efficient inhibitors, but considering the cost of commercialization, the low price of urea makes it stand out.

[0072] 4. The wettable powder provided in the present application can extend the shelf life to at least six months at room temperature.

[0073] 5. The wettable powder provided by the present application was sprayed on the leaves of indoor potted plants for cotton bollworm, diamondback moth and beet armyworm. On the third day after the application, all three insects showed RNA interference effects, their growth was restricted, and they all died to varying degrees within seven days of the application, with a mortality rate of 85%. The preparation provided by the present application also has up to 95% protection for green vegetables. Compared with green vegetables without pesticides, RNA interference preparations have a good effect in crop protection. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1 :Experimental flow chart for preparation of single gene engineering bacteria;

[0075] Figure 2 :PCR electrophoresis of acetylcholinesterase gene of cotton bollworm;

[0076] Figure 3 : PCR electrophoresis of acetylcholinesterase genes of Spodoptera exigua and Plutella xylostella, S1 and S2 represent two target genes of Spodoptera exigua, P1 and P2 represent two target genes of Plutella xylostella, and three samples represent one gene;

[0077] Figure 4 : Sequencing results of engineered cotton bollworm bacteria. The asterisk indicates that the sequencing results are consistent with the original gene.

[0078] Figure 5 : Sequencing results of Plutella xylostella Ace 1 engineered bacteria, asterisks indicate that the sequencing results are consistent with the original gene;

[0079] Figure 6 : Sequencing results of Plutella xylostella Ace 2 engineered bacteria, asterisks indicate that the sequencing results are consistent with the original gene;

[0080] Figure 7 : Sequencing results of Spodoptera exigua Ace 1 engineered bacteria, asterisks indicate that the sequencing results are consistent with the original gene;

[0081] Figure 8 : Sequencing results of Spodoptera exigua Ace 2 engineered bacteria, asterisks indicate that the sequencing results are consistent with the original gene;

[0082] Fig. 9 :Electrophoresis of double-stranded RNA induction in cotton bollworm, including the results of 4 and 5 hours at 37 degrees Celsius, and the results of 5 hours at 32 degrees Celsius;

[0083] Fig.10:Double-stranded RNA induction electrophoresis of Plutella xylostella and Spodoptera exigua. Experiments were conducted using various induction times (4h, 5h, and 6h) and induction temperatures (37°C and 32°C). Double-stranded RNA with brighter bands was selected for subsequent stomach poison experiments. S1 and S2 represent double-stranded RNA corresponding to two target genes of Spodoptera exigua, and P1 and P2 represent double-stranded RNA corresponding to two target genes of Plutella xylostella;

[0084] Fig.11 : Gene silencing levels in cotton bollworm, data in the figure refer to mean ± standard deviation (SEM). Asterisks indicate significant differences (**P<0.005, ***P<0.001, ****P<0.0001);

[0085] Fig.12 : Gene silencing levels in Plutella xylostella, data in the figure are mean ± SEM. Asterisks indicate significant differences (**P<0.005, ***P<0.001, ****P<0.0001);

[0086] Fig.13 : Gene silencing level of Spodoptera exigua, data in the figure are mean ± SEM. Asterisks indicate significant differences (**P<0.005, ***P<0.001, ****P<0.0001);

[0087] Fig.14 :Electrophoresis verification of four carriers. From left to right: kaolin, bentonite, diatomaceous earth, white carbon black;

[0088] Fig.15 :Comparison of RNA concentrations of four vectors corresponding to mother powder. The data in the figure are mean ± SEM. Asterisks represent significant differences (**P<0.005, ***P<0.001, ****P<0.0001);

[0089] Fig.16 : Electrophoresis diagram of different mass ratios of white carbon black and technical drug;

[0090] Fig.17 : RNA concentrations of different mass ratios of white carbon black. The data in the figure are mean ± SEM. Asterisks represent significant differences (**P<0.005, ***P<0.001, ****P<0.0001);

[0091] Fig.18 : Electrophoresis diagrams of different RNase inhibitors;

[0092] Fig.19 : Electrophoresis diagram of different added amounts of urea;

[0093] Fig. 20: RNA concentrations under different inhibitor addition amounts. Data in the figure are mean ± SEM. Asterisks represent significant differences (**P<0.005, ***P<0.001, ****P<0.0001);

[0094] Fig.21 : Electrophoresis diagrams of different surfactants at the same mass ratio;

[0095] Fig. 22 : RNA content with different surfactant addition amounts. Data in the figure are mean ± SEM. Asterisks represent significant differences (**P<0.005, ***P<0.001, ****P<0.0001);

[0096] Fig.23 : Target bands at different storage times;

[0097] Fig.24 : The survival rate of green vegetable leaves. DETAILED DESCRIPTION

[0098] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention.

[0099] 1. Experimental equipment (equipment name, model and manufacturer):

[0100] Sterile clean bench (model SW-CJ-IFD), constant temperature incubator (model DHG-9070A), Shanghai Yiheng Technology Instrument Co., Ltd.;

[0101] High pressure steam sterilizer, LDZX-50KBS, Shanghai Shen'an Medical Equipment Factory;

[0102] Constant temperature shaker, COS-200B, Shanghai Bilang Instrument Manufacturing Co., Ltd.;

[0103] Vortex mixer, XW-80A, Shanghai Jingke Industrial Co., Ltd.;

[0104] Nucleic acid electrophoresis tank (model HE-200), gel imager (model Tanon 2500), Shanghai Tianneng Technology Co., Ltd.;

[0105] Constant temperature heater, GL-150B, Qilin Bell Instrument Manufacturing Co., Ltd.;

[0106] UV spectrophotometer, UV1902PC, purchased from Phoenix Optical Group Co., Ltd.;

[0107] Light incubator, Blue Pard, purchased from Shanghai Yiheng Technology Instrument Co., Ltd.;

[0108] Reverse transcription-fluorescence quantitative PCR instrument, Light Cycle 96, was purchased from Shanghai Roche Pharmaceuticals Co., Ltd.

[0109] 2. RNA store Reagent, RNA prep pure animal tissue total RNA extraction kit, Agarose in electrophoresis experiment, 6×DNA loading buffer, DNA marker II (molecular weight standard) and DNA marker IV (molecular weight standard), centrifugal column type agarose gel DNA recovery kit, 10×PCR buffer, ddH2O, etc. were all purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. Among them:

[0110] The RNA prep pure animal tissue total RNA extraction kit contains: lysis solution RL 30ml, deproteinization solution RW 140ml, rinse solution RW 12ml, RNase Free ddH2O 15ml, RNase Free adsorption column CR3 (including 2ml collection tube) 50 sets (hereinafter referred to as adsorption column), RNase Free filtration column CS (including 2ml collection tube) 50 sets, RDD buffer 4ml, RNase-Free DNase I 1 tube, DNase I dry powder, Proteinase K.

[0111] 3. DEPC water (diethypyrocarbonate), M-MuLV first-strand cDNA synthesis kit, Taq plus DNA polymerase, primers and dNTP Mixture (with Mg 2+ , 25mM), 50×TAE buffer and 4S red plus nucleic acid stain (10,000× aqueous solution), sterile CaCl2 solution (1M), T4 DNALigase1, 2×Rapid Ligation Buffer, ddH2O, etc. used for electrophoresis were all from Sangon Biotech (Shanghai) Co., Ltd. Among them:

[0112] The M-MuLV first-strand cDNA synthesis kit contains: 5× Reaction Buffer, 10Mm dNTP Mix, Oligo-dT Primer (0.5μg / μl), Random Primer p(dN)6 (0.2μg / μl), RNase Inhibitor (20U / μl), M-MuLV Reverse Transcriptase (200U / μl), RNase-free ddH2O. 4. Preparation of culture medium

[0113] LB liquid medium, its main components: sodium chloride 1.0g, tryptone 1.0g, yeast extract powder 0.5g, deionized water 100mL;

[0114] 2×YT medium, its main components: 0.5g sodium chloride, 1.6g tryptone, 1.0g yeast extract powder, and 100mL deionized water.

[0115] The preparation methods of each culture medium are: prepare the culture solution according to the above ratio, adjust the pH to 7±0.2 (25°C), sterilize at high temperature and high pressure to obtain a sterile culture medium.

[0116] 5. IPTG (Isopropyl-β-D-thiogalactoside, IPTG) and Trizol reagent were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0117] 6. Isopropanol and ethanol were purchased from Shanghai Titan Technology Co., Ltd.;

[0118] 7. Trans Script one step gDNA removal and cDNA synthesis super mix and Perfect start green qPCR super mix were purchased from Beijing Quanshijin Biotechnology Co., Ltd.

[0119] 8. 1×TAE solution, purchased from Shanghai Bio-Tech Biotechnology Co., Ltd.

[0120] Example 1: Design of primer pairs

[0121] Based on the acetylcholinesterase gene corresponding to the double-stranded RNA that causes RNA interference reaction in the literature of Yojana et al. [Document 1], Gaddelapati et al. [Document 2] and Zhao Jing et al. [Document 3], primers for PCR reaction were synthesized, and the primer sequences are shown in Table 1.

[0122] Table 1 Primer sequences of cotton bollworm, diamondback moth and beet armyworm

[0123]

[0124] F represents the upstream primer, R represents the downstream primer, bp represents the primer length, and Accession no. is the sequence number found on NCBI.

[0125] in:

[0126] Document 1, Yojana R.Chikate, Vishal V.Dawkar, Ranjit S.Barbole, PriyadarshiniV.Tilak, Vidya S.Gupta, Ashok P.Giri.RNAi of selected candidate genesinterrupts growth and development of Helicoverpa armigera[J].PesticideBiochemistry and Physiology, 2016,133;

[0127] Document 2, Gaddelapati Sharath Chandra, Ramaswamy Asokan, Maligeppagol Manamohan, Nallur Krishna Kumar.Enhancing RNAi by using concatemerized double-stranded RNA[J].Pest Management Science, 2019, 75(2);

[0128] Document 3, Zhao Jing, Hao Dejun, Xiao Liubin, Tan Yongan, Jiang Yiping, BaiLixin, Wang Kai. Molecular and functional properties of two Spodoptera exiguaacetylcholinesterase genes [J]. Archives of Insect Biochemistry and Physiology, 2019, 101(3);

[0129] Example 2: Extraction of total RNA from pests

[0130] 1. Experimental materials:

[0131] 1.1 The test insects Helicoverpa armigera, Plutella xylostella and Spodoptera exigua and their food were purchased from Henan Keyun Biopesticide Co., Ltd.

[0132] The experimental subjects were 2nd instar larvae, and the culture conditions in the light incubator were: 16 hours of light, a temperature of 26-28°C, and a humidity of about 40%.

[0133] 1.2 Configuration of each liquid:

[0134] The total RNA was extracted using the RNA prep pure animal tissue total RNA extraction kit. Before use, the following:

[0135] Preparation method of 1% β-mercaptoethanol lysis buffer RL: add β-mercaptoethanol to the lysis buffer RL to a final concentration of 1%, for example, add 10 μl of β-mercaptoethanol to 1 ml of lysis buffer RL.

[0136] Preparation of DNase I mixed solution: Dissolve DNase I dry powder (1500U) in 550μl RNase Free ddH2O, mix gently, and store at -30 to -15℃ (can be stored for 9 months) after aliquoting to obtain DNase I storage solution.

[0137] 2. Extraction of total RNA (see flowchart Figure 1 )

[0138] Total RNA was extracted from intestine and brain tissue using RNA prep pure animal tissue total RNA extraction kit. The extraction of cotton bollworm, diamondback moth and beet armyworm is the same. The following takes cotton bollworm as an example:

[0139] 1) Homogenization:

[0140] The cotton bollworm Helicoverpa armigera was dissected, and its intestine and brain were taken out and immersed in RNA store Reagent for later use.

[0141] Weigh 20 mg of cotton bollworm midgut or brain tissue, add 300 μL of lysis buffer RL with a concentration of 1% β-mercaptoethanol, and grind the tissue thoroughly with a pestle. (Note: Since the brain is difficult to grind, it can be crushed before adding it to the lysis buffer)

[0142] 2) After homogenization, add 590 μL RNase Free ddH2O and 10 μL Proteinase K, mix well, place in a 56°C water bath for 20 min, and centrifuge at 12,000 rpm for 5 min. Take the supernatant and place it in another clean collection tube for later use.

[0143] 3) Add 0.5 times the volume of the supernatant liquid in anhydrous ethanol to the collection tube containing the supernatant in step 2), mix well and transfer to the adsorption column, centrifuge at 12,000 rpm for 1 min, pour out the waste liquid, and place the adsorption column in the collection tube.

[0144] 4) Add 350 μL of deproteinized solution RW1 to the collection tube in step 3), centrifuge at 12,000 rpm for 1 min, discard the waste liquid, and place the adsorption column in the collection tube.

[0145] 5) Prepare a mixed solution of 70 μL RDD buffer and 10 μL DNase I, add it to the collection tube in step 4), place it at room temperature for 15 minutes, then add 350 μL deproteinization solution RW1, centrifuge at 12,000 rpm for 1 minute, discard the waste liquid, and place the adsorption column in the collection tube.

[0146] Preparation of DNase I mixed solution: Take 10μl DNase I stock solution and add it to a new RNase Free centrifuge tube, add 70μl RDD buffer, mix gently, and you have it.

[0147] 6) Add 500 μL of rinsing solution RW (add ethanol before use) to the collection tube in step 5), place at room temperature for 2 minutes, centrifuge at 12,000 rpm for 1 minute, discard the waste liquid, and place the adsorption column in the collection tube.

[0148] 7) Add 500 μL of rinsing solution RW to the collection tube in step 6) again, place at room temperature for 2 minutes, centrifuge at 12,000 rpm for 3 minutes, discard the waste liquid, and place the adsorption column in the collection tube.

[0149] 8) After drying at room temperature for several minutes, the remaining rinse solution was completely removed. Finally, the adsorption column was placed in a new centrifuge tube, 50 μL RNase Free ddH2O was dripped into the middle of the adsorption membrane, and the mixture was allowed to stand for 2 minutes. The mixture was centrifuged at 12,000 rpm for 2 minutes to collect the RNA solution, which was the total RNA solution of the pest.

[0150] Example 3: Preparation of template DNA

[0151] The total RNA solution of the pest was synthesized into single-stranded cDNA using the M-MuLV first-strand cDNA synthesis kit, and then amplified into double-stranded DNA using the polymerase chain reaction (PCR) technique. The preparation methods for cotton bollworm, diamondback moth and beet armyworm are the same, and the following still takes cotton bollworm as an example:

[0152] 1. Reverse transcription of RNA

[0153] The pest total RNA solution prepared in Example 2 was used to synthesize single-stranded cDNA using the M-MuLV first-strand cDNA synthesis kit. The entire experiment was performed on ice.

[0154] 1) Add the total RNA reverse transcription system 1 solution to an ice-bathed test tube, shake well and centrifuge for 3 seconds, and remove the supernatant.

[0155] The system solution of total RNA reverse transcription system 1 is: 5 μL of pest total RNA solution, 1 μL of each of the upstream and downstream primers in the corresponding primer pairs in Table 1, and 6 μL of RNase-free ddH2O.

[0156] 2) Place the test tube in a 65°C water bath for 5 minutes, then place in an ice bath for 30 seconds, centrifuge for 3 seconds, and remove the supernatant;

[0157] 3) Place the test tube back on the ice bath, add the total RNA reverse transcription system 2 solution, mix gently, centrifuge for 3 seconds, and remove the supernatant.

[0158] System solution of total RNA reverse transcription system 2: 12μL pest total RNA solution, 4μL 5× Reaction Buffer, 1μL RNase Inhibitor, 2μL dNTP Mix, and 1μL M-MuLV Reverse Transcriptase.

[0159] If the total RNA concentration is low, the amount of total RNA can be increased appropriately and the amount of enzyme-free water can be reduced.

[0160] 4) Perform reverse transcription reaction on a PCR instrument under the following reaction conditions: pre-reaction at 25°C for 10 min; cDNA synthesis at 45°C for 60 min; termination reaction at 70°C for 10 min to obtain a template cDNA solution.

[0161] 2. Amplification of cDNA

[0162] The single-stranded cDNA prepared above is extremely unstable and is amplified into double-stranded DNA by polymerase chain reaction (PCR) technology.

[0163] The PCR system was as follows: Taq plus DNA polymerase 1 μL, template cDNA solution 2 μL, upstream primer (10 μM) 2 μL, downstream primer (10 μM) 2 μL, dNTP Mixture (with Mg 2+ )(25mM) 1μL, 10×PCR buffer 5μL, ddH2O 37μL. (The primers are the cotton bollworm upstream primer and downstream primer in Table 1).

[0164] The above system was shaken and centrifuged, and then PCR reaction was carried out on a PCR instrument. The reaction conditions were: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 45 sec; annealing at 51-58°C for 15 sec; extension at 72°C for 45 sec, including 30 cycles of denaturation, annealing and extension, and then final extension at 72°C for 10 min to obtain template DNA.

[0165] (Explanation:

[0166] 1. Reasons for setting reaction conditions: Using a step-wise annealing temperature can screen a more suitable temperature. Finally, high-quality DNA can be obtained by selecting the DNA with the darkest band for recovery.

[0167] 2. Template DNA products: the final products are divided into 5 types, 1 type for cotton bollworm, 2 types for diamondback moth and 2 types for beet armyworm)

[0168] Experimental Example 1: DNA Verification - Agarose Gel Electrophoresis

[0169] In order to verify that the template DNA prepared in Example 3 was the target DNA, agarose gel electrophoresis was performed to examine and verify.

[0170] 1. The detection method is:

[0171] Take 0.4g agarose and 40mL 1×TAE solution to prepare 1% agarose solution, heat the agarose solution to dissolve it completely. After cooling to about 40℃, add 4μL 4S red plus nucleic acid stain at a ratio of 1:10,000, shake thoroughly, pour it into the glass plate, insert the comb, and wait for it to cool down and solidify.

[0172] After the gel is completely solidified, remove the comb, take out the glass plate and put it into the electrophoresis tank, mix 5μL template DNA solution with 1μL 6×DNA loading buffer and add the sample. The electrophoresis condition is 120V, run for about 30 minutes until the sample runs to two-thirds of the gel, take out the electrophoresis gel, and observe the electrophoresis results in the imaging recorder.

[0173] The template DNA solutions are template DNAs of cotton bollworm, diamondback moth and beet armyworm prepared according to the method of Example 3.

[0174] 2. Testing standards:

[0175] The target gene of Helicoverpa armigera is 308 bp. If there is a clear band at about 300 bp compared with the marker, it is considered to be successfully verified;

[0176] Similarly, if the other four fragments have bands at 500 bp, the PCR experiment is considered to be successfully amplified. After successful verification, a gel recovery experiment is performed to recover the DNA. This method can remove non-specifically bound impurity DNA and select only the desired DNA bands, ensuring the purity of the plasmid during ligation and reducing the possibility of false positive plasmids.

[0177] 3. Test results: see Figure 2 , 3

[0178] The target cDNA of Helicoverpa armigera is 308 bp in length. Figure 2 There is an obvious band at 300bp in the middle, which can prove that the obtained gene is the target gene.

[0179] The cDNA length of Plutella xylostella and Spodoptera exigua is 400-500 bp. Figure 3 As shown, there are obvious bands at less than 500bp, indicating that the next step of connection and transformation experiment can be carried out. In the figure, from left to right, there are beet armyworm fragment 1 (S1), beet armyworm fragment 2 (S2), diamondback moth fragment 1 (P1) and diamondback moth fragment 2 (P2), and the gene lengths are 476bp, 417bp, 498bp and 487bp respectively. S1 and S2 represent two target genes of beet armyworm, and P1 and P2 represent two target genes of diamondback moth. Three samples represent one gene.

[0180] Example 4: Preparation of an engineered bacterium expressing RNA

[0181] 1. Experimental Materials

[0182] Escherichia coli HT115 (DE3) strain was purchased from Wuhan Miaoling Biotechnology Co., Ltd.

[0183] T Easy vector was purchased from Promega (Beijing) Biotechnology Co., Ltd.

[0184] Glycerol, ampicillin, sodium chloride, tryptone, yeast extract powder and agar used in the preparation of culture medium were purchased from Shanghai Titan Technology Co., Ltd.

[0185] The final concentration of ampicillin culture medium is generally 50μg / mL, and the commonly used storage concentration of ampicillin is 100mg / mL, that is, take 1g of ampicillin and dissolve it in 10mL of deionized water. After dissolution, filter it with a 0.22μm filter membrane to sterilize it and freeze it at -20℃. When it is needed, after dissolving at room temperature, add 25μL of ampicillin to every 50mL of culture medium.

[0186] 2. Carrier connection

[0187] 2.1 Preparation of plasmid:

[0188] The reaction system is: 1 μL of T Easy vector, 2 μL of template DNA (prepared in Example 3, choose one of them) or control DNA (without any DNA), 1 μL of T4 DNA Ligase, 5 μL of 2× Rapid Ligation Buffer, and 1 μL of ddH2O.

[0189] The culture was placed at 4°C overnight to obtain the plasmid.

[0190] 2.2 Plasmid transformation

[0191] 1) First, make the E. coli HT115 (DE3) strain into competent cells before transformation:

[0192] In the first step, a small amount of bacterial suspension of the HT115 (DE3) strain in the glycerol tube was streaked onto a non-resistant plate and cultured overnight at 37°C.

[0193] In the second step, a single colony was picked and placed in LB liquid culture medium solution and cultured at 37°C for 14 hours until the late logarithmic growth stage.

[0194] Next, the bacterial solution was inoculated into LB liquid medium at a ratio of 1:50 and shaken at 37°C until OD 600 ≈0.5(Note: OD 600 is the absorbance of the solution at a wavelength of 600nm). Transfer the above bacterial solution into two new centrifuge tubes, place on crushed ice for 10 minutes, centrifuge at 4,000rpm at 4℃ for 10 minutes after the bacterial solution cools down, and discard the supernatant. Add 10mL of pre-cooled 0.1mol / L sterile CaCl2 solution to suspend the cells, ice-bathe in crushed ice for 30 minutes, centrifuge at 4,000rpm at 4℃ for 10 minutes, and discard the supernatant. Add 4mL of pre-cooled 0.1mol / L sterile CaCl2 solution containing 15% glycerol, mix well, and place in crushed ice for 10 minutes to obtain competent cells. Aliquot 100μL / tube and store at -80℃.

[0195] Competent cells are very easy to inactivate, so the thawing time should not be too long. The transformation experiment must be carried out on ice in the early stages.

[0196] 2) Take 50 μL of competent cells, add 5 μL of the plasmid prepared in step 1), and place in crushed ice for 30 minutes. Heat shock at 42°C for 60 seconds, ice bath for 2 minutes, add 900 μL of LB liquid culture medium and resuscitate at 37°C shaker for 1 hour. Centrifuge at 4°C, 4,000 rpm for 5 minutes to concentrate the bacterial solution, discard 800 μL of supernatant, take 100 μL and spread it on a plate containing ampicillin (50 μg / mL) resistance, and culture at 37°C overnight until a single colony grows. Pick a single colony and place it in ampicillin (50 μg / mL) resistance LB liquid culture medium, culture at 37°C overnight to obtain an engineered bacterium expressing RNA.

[0197] (Explanation: The final products are divided into 5 types, 1 type of cotton bollworm, 2 types of diamondback moth and 2 types of beet armyworm)

[0198] Experimental Example 2: Verification of engineered bacteria - agarose gel electrophoresis

[0199] Whether the transformation is successful is preliminarily determined by whether the band size is consistent with the size of the target gene. The main experimental operation principle is to amplify the DNA in the bacterial solution again with the same primers, and then perform agarose gel electrophoresis. If there is an obvious band at 300bp, it means that the bacteria contain the target gene, which means that the transformation is successful.

[0200] 1. Whether the plasmid was successfully introduced into E. coli cells:

[0201] The inspection process is divided into two steps:

[0202] 1) Perform bacterial liquid PCR

[0203] The PCR system was as follows: 1 μL Taq plus DNA polymerase, 2 μL bacterial solution DNA (prepared in Example 3), 2 μL upstream primers (10 μM) of the corresponding pests, 2 μL downstream primers (10 μM) of the corresponding pests, 2 μL dNTP Mixure (with Mg 2+ )(25mM)1μL, 10×PCR buffer5μL, ddH2O17μL.

[0204] Reaction conditions: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 45 sec, annealing at 55°C for 15 sec, extension at 72°C for 45 sec, 30 cycles of denaturation, annealing and extension, and final extension at 72°C for 10 min.

[0205] 2) The PCR reaction solution was subjected to electrophoresis verification, and the electrophoresis verification steps were the same as those described in Experimental Example 1.

[0206] 2. Through sequencing experiments, it was observed that the sequence had been successfully connected to the vector. By comparing the known acetylcholinesterase gene sequence, it was found that the plasmid already contained the target gene sequence. A few genes had mutated, but the mutation did not affect the subsequent induced expression and the effect of double-stranded RNA. Therefore, it can be determined that the plasmid has been successfully transferred into E. coli HT115 (DE3). (See details. Figure 4-8 )

[0207] Example 5: Double-stranded RNA produced by engineered bacteria

[0208] The engineered bacteria produce double-stranded RNA under the induction of IPTG (Isopropyl-β-D-Thiogalactoside).

[0209] 1. Pick a single colony of the engineered bacteria prepared in Example 4 and culture it in 50 ml of LB liquid culture medium containing 50 ug / mL ampicillin at 37° C. and 200 rpm overnight;

[0210] 2. Take 1 mL of overnight culture solution and add it to 50 mL of 2×YT medium solution containing 50 ug / mL ampicillin. Cultivate and shake at 37°C and 200 rpm until OD600>0.8.

[0211] 3. Add IPTG inducer to the solution to make the final concentration of the inducer 0.4 mM, continue to shake and culture at 37°C, 200 rpm for several hours, and then obtain double-stranded RNA;

[0212] The inducer is isopropyl-β-D-thiogalactoside (IPTG), and the storage concentration is 0.1 M. Weigh 238 mg of IPTG inducer in a 10 mL quantitative bottle with a weighing balance, dilute to the scale with deionized water, and after it is completely dissolved, filter with a 0.22 μm filter membrane to sterilize and dispense into 1.5 mL sterile EP tubes, and store at -20°C;

[0213] 4. Dispense 1 ml / tube, centrifuge at 4,000 rpm at 4°C for 10 min, discard the supernatant, and freeze-dry the remaining bacterial sludge to obtain the double-stranded RNA expressed by the engineered bacteria;

[0214] The freeze-drying method is as follows: pre-freeze at -80°C for 4 to 5 hours, open the vacuum freeze dryer for pre-freezing half an hour in advance, remove the lid of the 50mL centrifuge tube containing the pre-frozen bacterial sludge, cover the tube mouth with a layer of film, and leave several air holes on the film (this step prevents impurities from falling into the freeze-drying process to ensure the purity of the freeze-dried product), place the centrifuge tube on a centrifuge tube rack and put it into a vacuum freeze dryer, and vacuum freeze for 18 hours at a cold trap temperature of -50 to -53°C and a pressure of 6 to 6.50Pa to obtain the freeze-dried product.

[0215] Experimental Example 3: Feeding Experiment

[0216] The gene silencing effect of double-stranded RNA expressed by engineered bacteria in different lepidopteran insects was detected by feeding, the tolerance of different lepidopteran insects to RNA interference was explored, the degree of lethality caused by RNA interference was tested, and whether a good RNA interference effect could be induced.

[0217] 1. Experimental Materials

[0218] 1) Insects: larvae and feeds of cotton bollworm Helicoverpa armigera, diamondback moth Plutella xylostella and beet armyworm Spodoptera exigua were purchased from Henan Keyun Biopesticide Co., Ltd. The stomach toxicity test was conducted in a light incubator with 16 hours of white light and 8 hours of darkness per day, at a temperature of 26-28°C and a relative humidity of 40%.

[0219] 2) Primers: See Table 2

[0220] In the experiment of determining the gene silencing efficiency of RNA interference by reverse transcription-fluorescence quantitative PCR, gene primers and internal reference gene primers were synthesized according to the literature of Yojana et al. [Reference 1], Gaddelapati et al. [Reference 2] and Jing et al. [Reference 3], as shown in Table 2.

[0221] Table 2: Primer sequences for reverse transcription-fluorescence quantitative PCR

[0222]

[0223] F represents the upstream primer and R represents the downstream primer.

[0224] 2. Experimental methods

[0225] The double-stranded RNA (5 kinds) expressed by the engineered bacteria prepared in Example 5 were extracted using Trizol reagent respectively. The specific extraction method was as follows:

[0226] Add 500μL Trizol reagent to the centrifuged bacteria, mix thoroughly and place at room temperature for 10 minutes. Add 200μL chloroform, shake vigorously for 30 seconds, place at room temperature for 3 minutes, and obvious stratification can be seen. Centrifuge at 12,000rpm for 10 minutes at 4℃. At this time, the sample is divided into three layers. Take the upper aqueous phase to a new EP tube, add an equal volume of isopropanol, mix thoroughly and place at room temperature for 20 minutes. Centrifuge at 12,000rpm for 10 minutes at 4℃ and discard the supernatant.

[0227] Add 1 mL of 75% ethanol prepared with DEPC-treated water, centrifuge at 12,000 rpm for 3 min at 4°C, and discard the supernatant. Dry at room temperature for several minutes to completely remove the ethanol and residual organic solvent. Add 50 μL of RNase Free ddH2O to dissolve the RNA, and the extracted double-stranded RNA bacterial solution is obtained.

[0228] 3. Testing indicators:

[0229] 3.1 Electrophoresis verification:

[0230] The extracted double-stranded RNA was verified by agarose gel electrophoresis. The electrophoresis verification steps are shown in Experimental Example 1.

[0231] 3.2 Gastric poison test - fourth instar larvae

[0232] 3.2.1 Experimental method: Double-stranded RNA bacterial solutions extracted from three pests, namely cotton bollworm, beet armyworm and diamondback moth (prepared in 2 above), were fed to the corresponding three larvae, of which beet armyworm and diamondback moth were fed with one of each;

[0233] Three other larvae were fed with bacterial solution containing only HT115 (DE3) competent cells as a control group.

[0234] When feeding, the fourth instar larvae were selected for feeding, 10 μL of bacterial solution was added to the feed every day, and the larvae were dissected after 3 days of feeding.

[0235] 3.2.2 Detection location and indicators: The brain was removed and the total RNA in the cells was extracted. The specific operation was the same as in Example 2.

[0236] 3.2.3 Reverse transcription-fluorescence quantitative PCR

[0237] Reverse transcription-fluorescence quantitative PCR, also known as reverse transcription quantitative polymerase chain reaction (RT-qPCR), refers to an experimental method in which RNA is reverse transcribed into cDNA and then PCR is performed and combined with fluorescence quantitative detection. Syber Green I is used as a fluorescent dye, and the signal of the fluorescent group is used to monitor the entire PCR process in real time, and finally the Ct value is obtained.

[0238] 1) Preparation of template cDNA

[0239] Reverse transcription system preparation: template RNA (prepared in Example 5) 7 μL, Random Primer 1 μL, 2×TS Reaction Mix 10 μL, Trans Script RT / RI Enzyme Mix 1 μL, gDNA remover 1 μL.

[0240] The reverse transcription reaction conditions are as follows: pre-reaction, cDNA synthesis, and heat inactivation, where the pre-reaction is 25°C for 10 minutes, cDNA synthesis is 42°C for 15 minutes, and heat inactivation is 85°C for 5 seconds. (The purpose is to remove the Trans Script RT / RI enzyme and gDNA remover)

[0241] 2) PCR reaction:

[0242] The real-time quantitative PCR system solution was prepared, and the preparation system was as follows: 3 μL of template cDNA, 0.4 μL of upstream primer (10 μM), 0.4 μL of downstream primer (10 μM), 10 μL of 2×Perfect Start Green qPCR Super Mix, and 6.2 μL of ddH2O.

[0243] The prepared samples were added into eight-tube strips and loaded into the reaction machine. The reaction conditions were as follows: 94°C for 30 sec, 94°C for 5 sec, 53°C for 15 sec, and 72°C for 10 sec, with the latter three conditions repeated for 45 cycles.

[0244] (Note: The upstream primers and downstream primers corresponding to the template cDNA of cotton bollworm A are the upstream and downstream primers in Table 2; the upstream primers and downstream primers corresponding to the template cDNA of diamondback moth P1 are the upstream and downstream primers of diamondback moth P1 in Table 2, and so on)

[0245] 3.2.4 Evaluation indicators - Evaluation of the degree of silence:

[0246] 1) Inspection method: Use the three-step method to perform qPCR on the computer, which can improve the amplification efficiency. Finally, check the data on the computer and perform data processing.

[0247] 2) By detecting the expression level of acetylcholinesterase gene in the pest, it is determined whether the gene in the pest is silenced after feeding double-stranded RNA, the degree of silencing, and whether the introduced double-stranded RNA is actually working.

[0248] During the measurement, the concept of an internal reference gene is introduced to correct the sample error in the experiment. It refers to a gene with relatively constant expression in the organism. It is used as a reference and subtracted from the number of samples to be measured, which is the expression amount of the measured gene in the organism. Through the internal reference gene, more realistic data can be obtained. The internal reference gene is generally the β-actin gene.

[0249] After obtaining the Ct value of each sample, a graph was plotted with 2^(-△△Ct) as the ordinate and each double-stranded RNA gene as the abscissa.

[0250] △△Ct=△Ct(positive sample)-△Ct(negative sample) (Formula 1)

[0251] △Ct (positive sample) = Ct (positive sample, using target gene primer) - Ct (positive sample, using internal reference gene primer)

[0252] (Formula 2)

[0253] △Ct (negative sample) = Ct (negative sample, using target gene primers) - Ct (negative sample, using internal reference gene primers)

[0254] (Formula 3)

[0255] In the above formula:

[0256] Ct value, C stands for Cycle, t stands for threshold, that is, the number of PCR cycles each reaction goes through to reach the set threshold. Therefore, the more template copies there are, the faster the number of cycles to reach the threshold, and the smaller the Ct value.

[0257] The internal reference gene is generally selected from the β-actin gene;

[0258] 3.3 Stomach poison test - second instar larvae

[0259] The second-instar larvae were divided into multiple groups, such as the drug-added group and the negative control group, with 10 larvae in each group, and 10 μL of the drug was added to the feed every day.

[0260] The drug-added group was added with the prepared target RNA (prepared in Example 5), and the same concentration of enzyme-free water was added to the double-stranded RNA after centrifugation, and the insects were fed. The negative control was an Escherichia coli bacterial solution without adding plasmids, that is, pure HT115 (DE3) competent cells were cultured in 50mL LB liquid culture medium under the same conditions overnight, and the bacterial solution was divided into multiple tubes of 1mL bacterial solution after turbidity, centrifuged at 4,000rpm for 10min at 4℃, and the supernatant was discarded. The precipitate was stored at -80℃, and the same concentration of enzyme-free water was added when used, and it can be fed.

[0261] 4. Experimental results

[0262] 4.1 Verification of double-stranded RNA: see Fig. 9 , 10

[0263] In order to determine the optimal induction temperature and time, the target gene length of Helicoverpa armigera is 308bp:

[0264] Depend on Fig. 9 It can be seen that when the induction time is the same, there is an obvious band at 300bp under 37°C conditions, while no band appears at 32°C; when the induction temperature is the same, a band appears after 5h of induction but not after 4h of induction. It can be seen that the generation of double-stranded RNA cannot be guaranteed when the temperature is too low or the induction time is too short. Therefore, induction at 37°C for 5h was selected as the optimal induction condition for subsequent gastric poison experiments. In addition, the bright band at 100bp in the figure is other RNA in the bacterial solution, such as 5S RNA, 16S RNA, 23SRNA and other impurities.

[0265] In the induction experiment of Plutella xylostella and Spodoptera exigua, different induction times (4h, 5h and 6h) and induction temperatures (37℃ and 32℃) were used. Fig.10 It can be seen that most of them have obvious bands at 500bp. The most obvious samples were selected, the best time was recorded, and subsequent stomach poison experiments were carried out. The best induction temperature was 37℃, the best induction time for Plutella xylostella P1 and Spodoptera exigua S1 was 6h, and the best induction time for Plutella xylostella P2 and Spodoptera exigua S2 was 5h.

[0266] 4.2 Reverse transcription-fluorescence quantitative PCR: see Fig.11 , 12 , 13

[0267] By using reverse transcription-fluorescence quantitative PCR, the expression level of acetylcholinesterase gene in the pest was obtained. By comparing with the pests fed only with E. coli, the degree of reduction of the expression level of the gene in the pest can be seen, that is, the efficiency of gene silencing and the effect of RNA interference. After measuring the expression level of each gene, the inhibition level of RNA in each sample can be obtained through calculation, that is, the value of 2^(-△△Ct), which can be used as the vertical coordinate to obtain Figure 11-13 arrive.

[0268] from Fig.11 , Fig.12 and Fig.13 It can be seen that P2, the second segment of the target gene of the diamondback moth Plutella xylostella, has the best gene silencing effect, while S1, the first segment of the gene of the beet armyworm Spodoptera exigua, has the worst inhibition effect. The gene silencing effect of the cotton bollworm Helicoverpa armigera is also very good, second only to P2.

[0269] In general, the silencing effect was within 20% except for P1. The next step will be to conduct stomach poison experiments to observe the lethality of these samples to smaller larvae.

[0270] 4.3 RNA interference

[0271] When artificially synthesized double-stranded RNA was fed to the second-instar larvae of Helicoverpa armigera, Plutellaxylostella, and Spodoptera exigua, varying degrees of mortality were observed.

[0272] For Helicoverpa armigera, in order to determine the RNA interference effect of acetylcholinesterase gene at different induction times, double-stranded RNA was fed after 5h and 6h of induction, and compared with the negative control group, which was a bacterial solution containing only HT115 (DE3), with 10 larvae in each group. Larvae died after feeding, with a mortality rate of 40% and 60% respectively, and the insect bodies turned black, while other larvae that did not die grew slowly, and the individuals were significantly smaller than the negative control, and their development was also hindered.

[0273] 2) RNA interference stomach poison experiment of Plutella xylostella and Spodoptera exigua, also with 3 groups, namely gene 1, gene 2 and negative control group, each group has 10. Plutella xylostella genes P1 and P2 caused 40% and 50% mortality respectively; while the mortality of Spodoptera exigua in the two groups S1 and S2 was 30% and 50% respectively. Similarly, the insects that did not die showed obvious symptoms of stunted development, with obviously thinner body and longer cocooning time. The final pupation rate of Plutella xylostella P1 was 50% and P2 was 40%; the final pupation rate of Spodoptera exigua was 30% and 10%. As can be seen from the figure, the body size of Ace 2 is smaller than that of Ace 1, which also shows that the second gene has a greater impact on the growth and development of larvae.

[0274] 5. Analysis and summary

[0275] First, in terms of the preparation of engineered bacteria, the double-stranded RNA of the three pests were successfully expressed in the recombinant engineered bacteria. This not only enhanced the stability of the double-stranded RNA fragments in the environment and in the insect body, and provided an extra layer of protection from E. coli compared to the double-stranded RNA directly synthesized in vitro, but also demonstrated that the method of producing double-stranded RNA using E. coli is universally applicable, and this achievement can be applied to other different insects or different genes in the future.

[0276] In addition, by utilizing the characteristic that bacteria can be cultured continuously, this method effectively and significantly increases the yield of double-stranded RNA, especially compared with in vitro synthesis kits, greatly reducing its production costs. These factors make it possible to apply double-stranded RNA to pesticide production, rather than only being able to achieve it in the laboratory.

[0277] In terms of RNA interference technology, we chose to introduce it into the pests through feeding. The three acetylcholinesterase genes all showed a certain gene silencing phenomenon, indicating that RNA interference is conservative.

[0278] The inventors tried to prepare double-stranded RNAs of different pests into wettable powders, and screened the double-stranded RNAs of each pest with different adjuvants. The results were similar. The following examples 6-9 are used as examples to illustrate the adjuvant screening process for the target RNA of cotton bollworm:

[0279] Example 6: Screening of wettable powder-carrier

[0280] 1. Carrier type and dosage

[0281] The carrier is kaolin, bentonite, diatomaceous earth or white carbon black.

[0282] 2. Dosage

[0283] 2.1 Drug loading 10%

[0284] Different carriers were added to the original drug (lyophilized powder prepared in Example 5) at a ratio of 90%, with the mass ratio of raw material to carrier being 90:10. After being fully mixed, the mixture was freeze-dried to prepare a mother powder.

[0285] The freeze-drying method is freeze-drying, which is the same as the freeze-drying method in step 4 of Example 5.

[0286] 2.2 Drug loading 4.8%:

[0287] The raw material (lyophilized powder prepared in Example 5) and different carriers were mixed evenly at a mass ratio of 20:1 (100 parts of raw material, 5 parts), and freeze-dried to prepare a mother powder.

[0288] 2.3 Different ratios:

[0289] According to the above screening results, the carrier was determined, and then the carrier was mixed with the original drug in different mass ratios. The weight ratios of the carrier and the raw material were 15:1, 12:1, 9:1, 6:1, and 3:1. The mixture was fully mixed in a grinder and freeze-dried to prepare a mother powder.

[0290] 3. Testing indicators:

[0291] The prepared master powder was stored at room temperature for 3 days before conducting the experiment:

[0292] 3.1 Wettability determination: The national standard GB / T5451-2001 is adopted for determination. The specific method for determining the wetting time is as follows:

[0293] (l) Place 100 mL ± 1 mL of hard water in a 250 mL beaker and place it in a 25°C constant temperature water bath, making sure that the liquid level in the beaker is always flush with the liquid level outside the beaker;

[0294] (2) When the temperature of the hard water in the beaker reaches 25±1°C, weigh 5g of sample powder on a weighing paper and pour all the sample evenly into the hard water at the same level as the beaker mouth. Start timing immediately after adding the sample until the sample is completely wetted. Stop timing and record the wetting time.

[0295] (3) The sample wetting process is repeated 5 times, and the wetting time is accurate to seconds and the average value is taken to obtain the wetting time.

[0296] 3.2 Sample suspension rate: The national standard GB / T14825-2006 is adopted for determination. The specific method for determining the suspension rate is as follows:

[0297] (l) Weigh an appropriate amount of sample on a weighing balance, record the mass as W1g (accurate to 0.0001g), add it to a 200mL beaker containing 50mL of hard water, and oscillate for 2min to form a suspension. Place the suspension in a 30±1℃ water bath for 13min, and wash the suspension into a 250mL graduated cylinder with 30±1℃ hard water to make up the volume;

[0298] (2) With the bottom of the measuring cylinder as the axis, cover the measuring cylinder with the measuring cylinder cover, turn the measuring cylinder 30 times within 1 min, then open the measuring cylinder stopper and place it vertically in a constant temperature water bath and let it stand for 30 min;

[0299] (3) Within 10 to 15 seconds, remove 9 / 10 (i.e., 225 mL) of the suspension using a pipette (be careful to avoid sucking up the sediment in the measuring cylinder), and transfer the remaining 1 / 10 to a drying oven for drying. Measure its dry weight and record it as W2 g.

[0300] (4) Calculate the sample weight suspension rate:

[0301] Sample weight suspension rate (%) = 10 / 9 × (sample mass W1-dry matter mass W2) / sample mass W1 × 100%

[0302] 3.3 Investigation of the activity of freeze-dried bacteria

[0303] Electrophoresis verification: Take 0.1g of the mother powder prepared in 2.1, 2.2, and 2.3 respectively and add them to 5mL centrifuge tubes, add enzyme-free water of equal concentration to re-dissolve and centrifuge, discard the supernatant, extract double-stranded RNA from the precipitate in the centrifuge tube by Trizol method, and perform electrophoresis experiment on the obtained RNA solution to verify the presence of the double-stranded RNA target band (the method is the same as that of Experimental Example 1);

[0304] Comparison of RNA concentration: Take part of the obtained RNA solution and use the Nanodrop nucleic acid concentration detector to determine the RNA concentration of the mother powder prepared with the same mass ratio and different carriers to determine the RNA content of different samples. Open the Nanodrop sampling arm, add 2μL of sample to the sampling arm each time, read and record the data, and wipe off the residual sample liquid in the sampling arm between samples to prevent cross-interference between samples (i.e., Nanodrop nucleic acid concentration detector readings).

[0305] 4. Experimental results

[0306] 4.1 Physical and chemical properties of drug loading of 10%: see Table 3

[0307] Table 3: Effects of different carriers on the physicochemical properties of preparations

[0308] Content of original drug (%) Carrier Wetting time(s) Suspension rate (%) 10 Kaolin 39 43 10 Bentonite 38 62 10 diatomite 35 71 10 White Carbon Black 29 69

[0309] From Table 3, we can see that:

[0310] From the perspective of wetting, the wetting time of silica preparation is the shortest, which takes 29 seconds, followed by diatomaceous earth preparation, which takes 35 seconds. The wetting time of kaolin and bentonite preparations is not much different.

[0311] From the perspective of suspension rate, the suspension rates of corresponding preparations of white carbon black and diatomaceous earth are relatively high, close to the national standard value of ≥70%.

[0312] In general, silica has the best wetting effect and diatomaceous earth has the highest suspension rate, but the suspension rate of silica is close to that of diatomaceous earth and the performance is also good, so silica is initially selected as the carrier for its advantages.

[0313] 4.2 Drug loading 5%

[0314] 1) Electrophoresis diagram Fig.14 :

[0315] In the figure, in the samples corresponding to the four carriers of kaolin, bentonite, diatomaceous earth and white carbon black, double-stranded RNA bands appeared at 500bp (the gene fragment length of Plutella xylostella is between 400 and 500bp, slightly lower than 500bp). Among them, the band of the sample corresponding to kaolin is relatively shallow. As a carrier, kaolin's adsorption performance for the original drug is not as good as the other three. The double-stranded RNA content in the samples corresponding to the other three carriers is higher.

[0316] 2) Comparison of RNA concentration: see Fig.15

[0317] from Fig.19 It can be seen that the control group (control group, no carrier added) has the lowest RNA concentration of only 21ng / μL due to the lack of carrier protection. In addition, among the samples corresponding to the four carriers, the RNA solution concentration of the sample corresponding to kaolin is the lowest, less than 50ng / μL, and the RNA solution concentrations of the samples corresponding to bentonite and diatomaceous earth are not much different. The RNA solution concentration corresponding to white carbon black is the highest, reaching 370ng / μL, which is higher than the RNA concentration of the control group, indicating that white carbon black as a carrier can effectively protect the sample components.

[0318] Based on the previous analysis of carrier suspension rate, wetting time, electrophoresis bands and RNA concentration, silica was selected as the best carrier. The following is a discussion on the results of the optimal addition mass ratio of silica.

[0319] 4.3 Different drug loading

[0320] 1) Electrophoresis verification results: Fig.16 Shown

[0321] From the figure, it can be seen that the RNA solutions extracted under different mass ratios all have bands at 500bp (the gene fragment length of Plutella xylostella is between 400 and 500bp, slightly less than 500bp), and the depth of the bands is slightly different. Among them, when the mass ratio of white carbon black to the original drug is 6:1, the band is the most obvious and the double-stranded RNA content is the highest. When the mass ratio of the two is 3:1, the band here becomes lighter than the former, and the double-stranded RNA content decreases. When the mass ratio of the two is 15:1, the band is the lightest.

[0322] 2) Comparison of RNA concentration: see Fig.17

[0323] In the figure, when the mass ratio of silica to the original drug is 15:1 and 12:1, the RNA concentration is lower than that of the other groups. The RNA concentration is about 200 ng / μL at the mass ratio of 12:1, and the RNA concentration is the lowest at this time. When the mass ratio is 9:1, the RNA concentration is significantly higher than before. When the mass ratio is 6:1, the RNA concentration reaches the highest, which is 630 ng / μL, and the RNA concentration begins to decrease at 3:1.

[0324] After comprehensive consideration of the electrophoresis bands and RNA concentration graph, a carrier to original drug mass ratio of 6:1 was finally selected as the optimal addition ratio of silica.

[0325] Example 7: Screening of wettable powder-RNase inhibitors

[0326] Considering that double-stranded RNA is very easy to degrade in the environment, in order to prolong the storage of wettable powders, adding RNase inhibitors to wettable powders can alleviate RNA degradation. In this experiment, commonly used nuclease inhibitors such as urea and sodium dodecyl sulfate (SDS) were added as formulation adjuvants to the prepared mother powder of Example 6 (the mass ratio of white carbon black to the original drug was 6:1, the mother powder was fully mixed in a grinder, and the experiment was carried out after storage at room temperature for 3 days), and the best inhibitor and the best mass ratio of the inhibitor were selected.

[0327] 1. RNase inhibitors:

[0328] RNase inhibitors include urea and sodium dodecyl sulfate.

[0329] 2. Dosage:

[0330] 2.1 Mix the RNase inhibitor and mother powder in a mass ratio of 5:1 to prepare the sample.

[0331] 2.2 Urea, sodium dodecyl sulfate and the mother powder prepared in Example 6 (white carbon black and technical drug mass ratio 6:1) were respectively mixed uniformly at a mass ratio of 3%, 5% and 7% to prepare preparation samples.

[0332] 3. Detection method:

[0333] After the sample was stored at room temperature for 3 days, it was re-dissolved in enzyme-free water of equal concentration and then centrifuged. The supernatant was discarded and the double-stranded RNA was extracted from the precipitate in the centrifuge tube by the Trizol method. Then, the sample was tested according to the "Activity of Freeze-dried Bacteria" test method of Example 6. The test indicators included: electrophoresis verification and Nanodrop nucleic acid concentration detector detection.

[0334] 4. Experimental results

[0335] 4.1 Electrophoresis:

[0336] 1) The inhibitor to be tested and the mother powder were mixed evenly at a mass ratio of 5:1 and double-stranded RNA was extracted. The electrophoresis results are shown in Fig.18 In the figure, there is no band at 500bp for the SDS corresponding sample. Since SDS is a cell lysis solution, the bacterial cells have been destroyed by SDS and are not selected. Urea has an obvious band at 500bp.

[0337] 2) Urea was used as an RNase inhibitor and mixed with the mother powder at different addition amounts of 3%, 5%, and 7%. The double-stranded RNA bands after mixing were verified. The results were as follows: Fig.19 As shown, when 5% and 3% urea were added to the mother powder, the corresponding band at 500bp was relatively obvious, and no band was seen with 7% urea, which indicated that the amount added at this time could not inhibit RNase well.

[0338] 4.2 RNA concentration: SDS and urea were added to the corresponding samples at 3%, 5%, and 7% respectively to measure the RNA concentration. The results are as follows: Fig. 20 As shown, when the addition amount is 3%, the RNA concentrations of the SDS and urea samples are not much different, but when the addition amount is 5%, the RNA concentration of the urea sample is the highest, which is 1040ng / μL, while the RNA concentration of the SDS sample does not change much. When the addition amount is 7%, the RNA concentration of the urea sample is lower than before.

[0339] Finally, combined with the electrophoresis and bar chart data analysis results, the best RNase inhibitor was screened out as urea, and the optimal addition amount of urea was 5%. The converted mass ratio of urea, silica and raw materials was 5:60:10.

[0340] Example 8: Screening of wettable powder-surfactant

[0341] Surfactant is one of the important components in the preparation of wettable powders. Its addition directly affects whether the wettable powder can be evenly covered on the applied crops and control objects. The addition of surfactant can increase the adhesion to the applied crops and control objects, so it is necessary to select a suitable surfactant. The selection principle is: preliminary screening is carried out based on factors such as wettability, dispersibility, and price, and then based on the effect of the surfactant on the activity of the preparation sample prepared in Example 7 (urea, white carbon black and raw material mass is 5:60:10), a suitable surfactant is further selected.

[0342] 1. Surfactant:

[0343] Sodium dodecyl sulfate (SDS), bentonite (BX), sodium lignin sulfonate (SL), calcium lignin sulfonate (CL).

[0344] 2. Preparation and inspection of wettable powder samples:

[0345] 2.1 The four surfactants were mixed with the preparation samples prepared in Example 7 (the mass ratio of urea, white carbon black and raw materials was 5:60:10) at a mass ratio of 3%, 5% and 7% to obtain wettable powder samples.

[0346] After the wettable powder samples were stored for 3 days, the RNA concentration was compared according to the "Wettability Determination", "Sample Suspension Rate", and "Viability Investigation of Freeze-dried Bacteria" methods in Example 6, and the wetting time, suspension rate and RNA concentration were determined. This was repeated multiple times to determine the effects of different surfactants on the physicochemical properties of the preparations.

[0347] 2.2 After examining the physicochemical properties of the four surfactants in 2.1 (wettability determination, sample suspension rate), the preparation sample prepared in Example 7 (urea, white carbon black and raw material mass ratio of 5:60:10) was added in an addition amount of 5% to prepare a wettable powder sample. After storage for 3 days, electrophoresis verification and RNA concentration comparison were carried out according to the method of "Investigation of activity of freeze-dried bacteria" in Example 6.

[0348] 3.3 Optimization of the optimal ratio of surfactant and RNase inhibitor

[0349] The surfactants and RNase inhibitors with good performance are selected from the above and compounded. The suspension rate and wetting time of the compounded preparations are measured to screen the best ratio.

[0350] 4. Experimental results

[0351] 4.1 Physical and chemical properties (wetting time and suspension rate): see Table 4

[0352] Table 4: Effects of surfactants on the physicochemical properties of preparations

[0353] Surfactants Addition amount (%) Wetting time(s) Suspension rate (%) Sodium dodecyl sulfate (SDS) 3 103 89 Pull open powder (BX) 3 67 51 Sodium lignin sulfonate (SL) 3 85 47 Calcium lignin sulfonate (CL) 3 72 69

[0354] As shown in Table 4, the wetting time of the pull-open powder preparation is the shortest, which takes 67 seconds, followed by the calcium lignin sulfonate CL preparation. The wetting time of the sodium dodecyl sulfate SDS preparation is the longest, which takes 103 seconds, but the wetting time of the four samples tested is within the national standard range of ≤120 seconds; from the perspective of suspension rate, sodium dodecyl sulfate (SDS) has the highest suspension rate, reaching 89%, followed by calcium lignin sulfonate, which performs better and is close to the national standard ≥70%.

[0355] 4.2 Vitality inspection

[0356] 1) Electrophoresis verification: The results of the investigation of different surfactants with the same mass ratio are shown in Fig.21 The samples corresponding to sodium lignin sulfonate SL and calcium lignin sulfonate CL had brighter bands at 500bp, which performed better. The samples corresponding to SDS had no bands, and the samples corresponding to powder had no visible bands at 500bp.

[0357] 2) RNA concentration investigation: Investigation of different surfactants with different mass ratios is shown in Fig. 22 , the RNA concentrations of the preparation samples corresponding to the three addition amounts of SDS were not very high, indicating that the ability of SDS to inhibit RNase was weak; the RNA content of the samples corresponding to 5% pulled open powder and 5% sodium lignin sulfonate SL was relatively high within their range, but far less than that of 5% calcium lignin sulfonate; when the corresponding target bands were measured for both sodium lignin sulfonate SL and calcium lignin sulfonate CL, the RNA concentration corresponding to calcium lignin sulfonate CL was significantly higher than that of sodium lignin sulfonate SL, and 5% calcium lignin sulfonate corresponded to the highest RNA concentration of 1700ng / μL.

[0358] In summary, according to the experimental results, calcium lignin sulfonate CL was selected as the best surfactant, and the best addition amount was 5%.

[0359] Example 9: Optimization results of wettable powder-surfactant and RNase inhibitor ratio

[0360] From Example 7 Fig. 20 It can be seen that when the urea addition amount is 5% and 7%, the RNA content of the corresponding preparation samples is relatively high. Fig. 22 It can be seen that when the addition amount of calcium lignin sulfonate is 5% and 7%, the RNA content of the corresponding preparation sample is relatively high. Therefore, urea and calcium lignin sulfonate are selected to prepare the preparation at an addition amount of 5%, 6%, and 7%, respectively, and the wetting time and suspension rate of the preparation sample are measured (the method is the same as that of Example 5), and the best formula is screened. The results are shown in Table 5 below:

[0361] Table 5: Effects of different additive ratios on the physicochemical properties of the preparation

[0362]

[0363]

[0364] (Note: The data in the table are mean ± standard error, and different letters in the same column indicate significant differences at the 0.05 level)

[0365] The data results in Table 5 show that:

[0366] When the addition amount of urea was 7% and the addition amount of calcium lignin sulfonate was 5%, the suspension rate of the sample was the highest, which was 81.8%;

[0367] When the addition amount of urea is 5% and the addition amount of calcium lignin sulfonate is 7%, the wetting time of the sample is the shortest, which is 76.4s.

[0368] In general, there is no significant difference in the wetting time of each sample.

[0369] After comprehensive consideration, the urea addition amount was selected as 6% and the calcium lignin sulfonate addition amount was selected as 7%. The corresponding suspension rate was 76.8%, slightly lower than the maximum suspension rate, and the corresponding wetting time was 77.6s, second only to the shortest wetting time of 76.4s.

[0370] Example 10: Optimal wettable powder formulation

[0371] According to the experiments of Examples 6-9, the best wettable powder formula was determined as follows: based on a mass ratio of white carbon black to technical drug of 6:1, 6% urea and 7% calcium lignin sulfonate were added in sequence.

[0372] 1. Composition: 100 mg white carbon black, 10 mg technical, 4.2 mg urea, 4.9 mg calcium lignin sulfonate.

[0373] 2. Preparation method: Mix well and you are done.

[0374] Experimental Example 5: Pest Control Experiment with Wettable Powder

[0375] 1. Experimental Materials

[0376] The cotton bollworm, diamondback moth, and beet armyworm and their food were purchased from Henan Keyun Biological Pesticide Co., Ltd.;

[0377] Vegetable seeds were purchased from Xingyun Vegetable Seed Company;

[0378] DuPont Kangkuan (20% chlorantraniliprole) was purchased from Suzhou FMC Plant Protection Co., Ltd., and Bacillus thuringiensis was purchased from Hubei Kangxin Agricultural Pharmaceutical Co., Ltd.

[0379] 2. Test samples

[0380] Application group: the wettable powder provided in Example 10 was diluted 300 times with water for standby use.

[0381] 3. Quality indicators of wettable powder

[0382] 3.1 The main quality indicators of wettable powders include suspension rate, wetting time, pH value, moisture content, fineness, etc. The wetting time and suspension rate are tested according to the "Wettability Determination" and "Sample Suspension Rate" of Example 6, the pH value is based on GB / T1601-1993, and the moisture content is determined by the oven drying weight loss method. The fineness is ≥95% through a 325 mesh standard sieve.

[0383] 3.2 Shelf life of wettable powder: Under room temperature storage conditions, take samples every month, determine the double-stranded RNA corresponding to the target band by electrophoresis, and determine the remaining RNA concentration by Nanodrop, and repeat 3 times.

[0384] 4. Preparation spraying experiment

[0385] Prepare preparations corresponding to the three insects separately, as well as a mixed preparation for jointly controlling two or three insects, spray them multiple times, and observe the corresponding control effect of each insect and the joint control effect of the mixed preparation on the three insects.

[0386] (Note: 1) One RNA from Plutella xylostella and Spodoptera exigua can be selected as a representative. Experimental investigations have confirmed that any Plutella xylostella RNA is effective against Plutella xylostella, and any one of the Spodoptera exigua is also effective against Spodoptera exigua; 2) Two or three insect mixed preparations can be compounded according to the insect species, and the ratio between the preparations is 1:1:1)

[0387] 4.1 Spraying test method:

[0388] (1) Diamondback moth spraying experiment:

[0389] Green vegetables were selected as the food source for diamondback moth and cultivated in soil in the laboratory. After the green vegetables grew for 2-3 weeks, second-instar diamondback moth larvae were placed on the vegetable leaves, with 3 to 4 larvae placed on each leaf. A pesticide application group and a control group were set up, and the leaves were sprayed every day. The pesticide application group was sprayed with the prepared wettable powder solution, and the control group was sprayed with clean water. The spraying time was one week.

[0390] (2) Cotton bollworm spraying experiment:

[0391] Green vegetables were selected as the food source for cotton bollworms. The green vegetables were planted in indoor soil. After sprouting and growing for several weeks, second-instar cotton bollworm larvae were placed on the leaves of the green vegetables, with 2 to 3 larvae placed on each leaf. A pesticide application group and a control group were set up. The pesticide application group was sprayed with the prepared wettable powder solution, and the control group was only sprayed with clean water. The spraying lasted for about 7 days.

[0392] (3) Beet leaf moth spraying experiment:

[0393] Green vegetables were selected as the food source for beet armyworms and cultivated in indoor soil. After the green vegetables grew for a period of time, second-instar beet armyworm larvae were placed on the leaves, with 2 to 3 larvae placed on each leaf. A pesticide application group and a control group were set up. The pesticide application group was sprayed with the prepared wettable powder solution, and the control group was only sprayed with clean water. The spraying was carried out for about 7 days.

[0394] (4) Experiment on mixed spraying of three insects:

[0395] Green vegetables were selected as the food source for the three insects. Green vegetables were planted in indoor soil and cultivated. When each seedling grew to 10-15 cm, the second-instar larvae of the three insects were placed on the rapeseed leaves, with one larva of each type placed on each leaf. A pesticide application group, blank control, negative control and positive control were set up, among which:

[0396] Application group: wettable powder prepared in Example 10 diluted 300 times.

[0397] Blank control: spray only water.

[0398] Negative control: spray ordinary Escherichia coli solution.

[0399] Positive control (chemical pesticide): spraying DuPont Concuron (20% chlorantraniliprole) diluted 3000 times.

[0400] Positive control (biological pesticide): spraying Bacillus thuringiensis diluted 300 times.

[0401] According to the above grouping, the leaves were sprayed and the experiment lasted for about a week.

[0402] 4.2 Inspection indicators: Observe the growth of pests in different groups after application of pesticides, and analyze and calculate the leaf erosion rate of green vegetables.

[0403] Green vegetable leaf erosion rate = leaf area eaten / initial leaf area

[0404] 5. Detection indicators

[0405] 5.1 Wettable powder quality inspection results: see Table 6

[0406] Table 6: Quality indicators of wettable powder

[0407] National standard value Measurements Wetting time ≤120s 77.6s Suspension rate ≥70％ 76.8％ pH 5～8 7.4 Moisture content ≤2.5％ 0.09％ Fineness ≥95％ 98％

[0408] 5.2 Validity period test:

[0409] The double-stranded engineered bacteria corresponding to the target gene of cotton bollworm were used as the original drug, and the mass ratio of the carrier to the original drug was 6:1. Then 6% urea was added as an RNase inhibitor, and finally 7% of Lakai powder BX, sodium lignin sulfonate SL, calcium lignin sulfonate CL, and sodium dodecyl sulfate SDS were added as surfactants to prepare four wettable powders. The freeze-dried original drug was used as the control group, for a total of five samples to be tested. The electrophoresis bands of them placed at room temperature for one month and six months were measured respectively. The results are as follows Fig.23 As shown:

[0410] As can be seen from the figure, the band corresponding to 300bp of calcium lignin sulfonate CL stored for about one month is the brightest, and no obvious bands are found in other samples; after six months of storage, the target band corresponding to the calcium lignin sulfonate CL sample still exists, and the brightness has not decreased significantly, indicating that the preparation is still effective.

[0411] Based on the physical and chemical index data of the RNA interference preparation developed in this experiment, considering its application in actual production in the later stage, the following are the production quality control indicators of the preparation:

[0412] Bacterial liquid fermentation OD600 value range: 0.8~1.2;

[0413] RNA purity: A260 / A280 is between 1.7 and 2.0;

[0414] Preparation CFU value: 3.34×10 33 CFU / g

[0415] 6. Preparation spraying experiment

[0416] (1) Diamondback moth spraying results:

[0417] Comparing the growth of the two groups of diamondback moths a few days after the application of the pesticide, it can be seen that the growth of the diamondback moths in the drug-treated group was inhibited to a certain extent, and the insects were generally smaller than those in the control group. Four days after the application of the pesticide, the diamondback moths died due to RNA interference.

[0418] (2) Results of spraying cotton bollworm:

[0419] Place the cotton bollworm on the green vegetables. After a period of time, the cotton bollworm begins to eat the vegetables, and obvious insect bites appear on the leaves.

[0420] By comparing the growth of cotton bollworms after seven days of spraying and those in the control group, it can be seen that from the third day, the cotton bollworms in the sprayed group began to show growth inhibition due to the influence of the drug, and the body of the insect was slightly smaller than that of the control group. Five to seven days after spraying, the cotton bollworms in the sprayed group stopped growing, and compared with the normally growing cotton bollworms in the control group, the body length was only half of that of the control group, indicating that the cotton bollworms in the sprayed group were greatly affected by RNA interference, and the preparation showed a better insecticidal effect.

[0421] (3) Results of beet armyworm spraying:

[0422] The beet armyworms that ate the medicated vegetables were restricted in their growth and development after about four to five days and began to gradually stop growing. However, the beet armyworms in the control group that ate the vegetables sprayed with clean water ate normally, their bodies were not affected at all, they developed normally, and their body length was significantly longer than those in the medicated group.

[0423] (4) Mixed preparation spraying results: see Fig.24

[0424] The growth of five groups of green vegetables was compared before and after insect release and spraying. Before the insect release and spraying, the green vegetables grew normally and the leaves were intact. A few days after spraying and releasing insects, the green vegetables in the blank control group and the negative control group were eaten by insects in large quantities, leaving almost only the veins and a few residual leaves; the leaf insects in the group treated with the experimental preparation were reduced or stopped eating due to RNA interference, and the number of insects was reduced, making the leaf surface of the green vegetables relatively intact, while the leaf surface of the green vegetables in the chemical pesticide control group was not damaged; after spraying chemical pesticides, the leaf insects died and fell quickly, and the insects in the biological pesticide control group were also affected by the leaf agents. After eating, the efficacy of the drugs evaporated and the insects died quickly.

[0425] The degree of growth inhibition of the three types of insects was compared. The insects in the negative control group sprayed with ordinary Escherichia coli solution and the blank control group sprayed with only water grew and developed normally, while the insects in the medicated group sprayed with the mixed preparation developed slowly. All three types of insects showed obvious RNA interference after seven days, and the multiple insect repellent effects of the mixed preparation were verified.

[0426] Fig.24 The results showed that, from the perspective of leaf erosion, as the number of days increased, the leaves of the green vegetables in the blank control group and the negative control group were more seriously eaten by insects. The leaf survival rate of the two groups of green vegetables was 70% on the third day. On the fourth day, the leaf insects entered the third instar gluttony period and increased their food intake. The leaf survival rate of the green vegetables in the blank group was only 40%, and that of the green vegetables in the negative control group was only 30%. After a week, the two groups of green vegetables were almost left with only residual leaves. In contrast, the growth of the other three groups of green vegetables did not change much. After the application of the DuPont Kangkuan group, the drug effect was exerted quickly, and the insects died quickly in less than half a day. The leaf larvae in the Bacillus thuringiensis group also died quickly after the application of the drug and fell from the leaves. After seven days, the leaf survival rates of the two groups were 100% and 98%, respectively. The insects in the RNA interference preparation group ate a small amount of green vegetables. After 2 to 3 days of feeding, the insects were affected by RNA interference, reduced or stopped eating, and then died. After seven days, the leaf survival rate was about 90%.

[0427] 7. Experimental summary:

[0428] The physical and chemical indicators of the wettable powder provided in this application meet national standards and can maintain a shelf life of at least six months at room temperature.

[0429] Subsequently, the control effect of the wettable powder after scaled-up production was verified, and indoor potted foliar spraying experiments were carried out on cotton bollworm, diamondback moth and beet armyworm. On the third day after application, all three insects showed RNA interference effects, their growth was restricted, and they all died to varying degrees within seven days of application, with a mortality rate of 85%.

[0430] After the success of the single spraying experiment, it was considered to mix the preparations for specific control of three insects into a mixed preparation that can control three insects at the same time, and then spray them experimentally. During this period, other control groups were set up to compare the control effect of RNA interference preparations. The results showed that the chemical control effect of spraying 20% ​​chlorantraniliprole was the best, and its protective effect on the green vegetables applied was as high as 100%. The green vegetables sprayed with Bacillus thuringiensis were protected by about 98%. The preparations provided in this application also protected the green vegetables by up to 95%. Compared with the green vegetables without pesticides, RNA interference preparations have a good effect in crop protection.

[0431] Although the present invention has been described in detail above by means of general description, specific implementation methods and tests, it is obvious to those skilled in the art that some modifications or improvements may be made to the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A method for preparing a mixed preparation of double-stranded RNA engineering bacteria, characterized in that: It is prepared by the following method: 1) Preparation of pest total RNA: The intestinal and brain tissues of the corresponding pests were extracted using RNA prep pure animal tissue total RNA extraction kit to obtain pest total RNA; 2) Preparation of template DNA: Step 1) Prepare pest total RNA solution and use M-MuLV first-strand cDNA synthesis kit to synthesize single-strand cDNA, and amplify it into double-strand cDNA by polymerase chain reaction technology with primer pairs of corresponding pests; 3) Preparation of plasmid: 1 μL of vector, 2 μL of template DNA prepared in step 2), 1 μL of T4 DNA Ligase, 5 μL of 2×Rapid Ligation Buffer, 1 μL of ddH2O; place at 4°C overnight to obtain a plasmid. The vector is pGEM ® T Easy vector; 4) Transformation of plasmid: Prepare E. coli into competent cells, then add the plasmid prepared in step 3), heat shock reaction after ice bath, then recover in LB liquid medium, concentrate, discard the supernatant, precipitate on a plate containing ampicillin and culture overnight, pick a single colony and place it again in LB liquid medium containing ampicillin, culture, and obtain engineered bacteria expressing RNA; 5) The engineered bacteria expressing RNA generate double-stranded RNA under the induction of IPTG, specifically comprising the following steps: picking a single colony and placing it in an LB liquid culture medium solution containing ampicillin for overnight culture, taking the overnight cultured bacterial solution into a resistant 2×YT culture medium solution containing ampicillin, and culturing on a shaking table until OD600>0.8, adding IPTG solution, continuing to culture on a shaking table, centrifuging it, discarding the supernatant, and drying the bacterial mud to obtain the double-stranded RNA produced by the engineered bacteria; 6) Preparations were prepared according to the double-stranded RNA bacterial liquid of cotton bollworm, double-stranded RNA bacterial liquid of diamondback moth and double-stranded RNA bacterial liquid of beet armyworm, and then mixed in a weight ratio of 1:1:1, wherein the primer pair sequences of the corresponding pests are as follows: Helicoverpa armigera A: upstream primer F: GTGGAGACTCAACGAAGATC, Seq_1; Downstream primer R: CTCTTAGACCACATAATGAACTC, Seq_2; Plutella xylostella P1: upstream primer F: ATTGTTTGGAGAATCGTCCG, Seq_3; Downstream primer R: GGATTCAGTTCTCTGACCGC, Seq_4; or Plutella xylostella P2: upstream primer F: GGCAAGAATTACTCACCCGA, Seq_5; Downstream primer R: CGGAAAAGCGAGATTCAAAC, Seq_6; Spodoptera exigua S1: upstream primer F: GGCTGTGTCGGTTTCATTG, Seq_7; Downstream primer R: GATTCAACTCTCTAACTGCCTGC, Seq_8; or Spodoptera exigua S2: upstream primer F: GGGAGAAGAAATGTGGAATCC, Seq_9; Downstream primer R: GCCGACTCACCAAATAATGTTA, Seq_10.

2. A wettable powder containing double-stranded RNA, characterized in that: The wettable powder comprises the following components in parts by mass: 10 parts of the mixed preparation according to claim 1, 30-150 parts of a carrier, 2-9 parts of a surfactant and 2-9 parts of an RNase inhibitor.

3. The wettable powder according to claim 2, characterized in that The wettable powder comprises the following components in parts by mass: 10 parts of the mixed preparation according to claim 1, 60-120 parts of a carrier, 2-5 parts of a surfactant and 2-6 parts of an RNase inhibitor.

4. The wettable powder according to claim 2, characterized in that The wettable powder comprises the following components in parts by mass: 10 parts of the mixed preparation according to claim 1, 60-90 parts of a carrier, 3.5-5 parts of a surfactant and 3.5-5 parts of an RNase inhibitor.

5. The wettable powder according to claim 2, characterized in that The wettable powder comprises the following components in parts by mass: 10 parts of the mixed preparation according to claim 1, 60 parts of a carrier, 4.2 parts of a surfactant and 4.9 parts of an RNase inhibitor.

6. The wettable powder according to claim 2, characterized in that The surfactant is sodium dodecyl sulfate, pulverized powder, sodium lignin sulfonate or calcium lignin sulfonate; the carrier is kaolin, bentonite, diatomaceous earth or white carbon black; and the RNA enzyme inhibitor is urea or sodium dodecyl sulfate.

7. The wettable powder according to claim 6, characterized in that The surfactant is calcium lignin sulfonate.

8. The wettable powder according to claim 6, characterized in that The carrier is white carbon black.

9. The wettable powder according to claim 6, characterized in that The RNase inhibitor is urea.

10. Use of the wettable powder according to claim 2 in the preparation of pesticides for preventing and controlling lepidopteran pests.

Images