Application of arylsulfonamide compounds in the preparation of HIV-1 latency reversal agents or latent infection activators
By using aromatic sulfonamide compounds such as Indisulam as latent infection activators, the problem of the existing technology being unable to effectively clear the HIV-1 latent infection virus reservoir is solved, and significant activation effects and clearance of latent viruses are achieved, which has good clinical application prospects.
Patent Information
- Application Number
- CN202311646390.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-01
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2043-12-01
AI Technical Summary
Existing technologies are unable to effectively eliminate the HIV-1 latent viral reservoir. Existing latency reversal agents (LRAs) have problems with absorption, metabolism and duration of action when activating and clearing latently infected cells, and are unable to significantly reduce the overall size of the latent viral reservoir.
Arylsulfonamide compounds such as Indisulam, E7820 and Tasisulam are used as latent infection activators. Through high-throughput screening and combined use of existing LRAs, the activation ability of HIV-1 latently infected cells is enhanced, and good activation effects are shown in human primary CD4+T cells and patient samples.
Arylsulfonamide compounds can significantly activate HIV-1 latently infected cells. When used in combination, they amplify the activation effect and have a synergistic effect. They show good clinical application potential and can eliminate latent HIV viruses.
Smart Images

Figure CN117547610B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of HIV-1 prevention and treatment, and more specifically, to the use of arylsulfonamide compounds or derivatives thereof in the preparation of HIV-1 latent infection activators. Background Art
[0002] HIV-1 is a positive-sense, single-stranded RNA virus. CD4+ T cells are HIV-1's primary target cells. While most infected and activated CD4+ T cells die quickly due to the cytopathic effect, some long-lived memory CD4+ T cells harboring HIV-1 proviruses can form during the acute phase of HIV-1 infection. These cells possess characteristics such as sustained proliferation and a long half-life, allowing HIV-1 proviruses to be stably stored in the host, forming a latent reservoir of HIV-1 infection. This has become the greatest obstacle to curing HIV-1. Currently, the most commonly used treatment for controlling HIV-1 infection and AIDS symptoms is highly active antiretroviral therapy (HAART). This treatment approach uses a combination of different antiviral drugs to keep the number of viral RNA copies in the patient's plasma at a low level. However, this treatment approach is not effective in clearing the latent reservoir of HIV-1 infection. Once patients stop taking the drugs or develop drug resistance, the plasma viral load rebounds rapidly.
[0003] To eradicate the HIV-1 latent reservoir, a "shock and kill" strategy has been proposed. This strategy aims to utilize latency-reversing agents (LRAs) to restore the ability of HIV-1 proviruses to transcribe and express. Latently infected cells can then be recognized by the immune system or eliminated due to HIV-1-associated cytopathic effects. However, in clinical trials, the absorption, metabolism, distribution, and excretion characteristics of LRAs significantly affect their reactivation capacity and duration of action. Furthermore, while these LRAs can reactivate silent HIV-1 proviruses within CD4+ T cells, they do not affect the overall size of the latent reservoir. A plausible explanation is that the "shock and kill" strategy requires more effective LRAs. Therefore, screening for a wider range of more potent LRAs could improve the "shock and kill" strategy.
[0004] Sulfonamides have been used as antibacterial drugs for decades. They offer a broad spectrum of antimicrobial activity, are stable, easy to use, and inexpensive. As research into sulfonamides deepens, they are found to possess a wider range of biological activities, including diuretic, antithyroid, antidiabetic, antihypoglycemic, and cataract treatment.
[0005] Indisulam (N-(3-chloro-7-indolyl)-1,4-benzenedisulfonamide), belongs to the class of arylsulfonamide drugs, CAS No.: 165668-41-7; Molecular formula: C 14 H 12 ClN3O4S2; molecular weight: 385.8458. Indisulam is a drug in clinical trials for anti-tumor applications. It has demonstrated good tolerability and efficacy in multiple clinical trials for acute myeloid leukemia, breast cancer, colon cancer, and lung cancer.
[0006] E7820 is an orally active aromatic sulfonamide derivative and a unique angiogenesis inhibitor that inhibits the expression of integrin α2 subunit on endothelium and has anti-angiogenesis and anti-tumor activities. CAS No.: 289483-69-8; Molecular formula: C 17 H 12 N4O2S; molecular weight: 336.37.
[0007] Tasisulam is an acylsulfonamide with potential anti-tumor activity, CAS No.: 519055-62-0; Molecular formula: C 11 H6BrCl2NO3S2; molecular weight: 415.110.
[0008] So far, no one has reported the use of sulfonamide drugs as HIV-1 latent infection activators. Summary of the Invention
[0009] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an application of an arylsulfonamide compound in the preparation of an HIV latent infection activator or latency reversal agent.
[0010] The first object of the present invention is to provide an application of an arylsulfonamide compound or its derivatives in the preparation of a latent infection activator or a latent reversal agent for HIV.
[0011] The second object of the present invention is to provide the use of arylsulfonamide compounds in the preparation of drugs for treating HIV.
[0012] The third object of the present invention is to provide a composition for use in preparing an HIV latent infection activator or a latent reversal agent.
[0013] The fourth object of the present invention is to provide a composition for use in preparing a drug for treating HIV.
[0014] A fifth object of the present invention is to provide a composition.
[0015] In order to achieve the above object, the present invention is implemented through the following technical solutions:
[0016] The present invention discovered that Indisulam has a good ability to activate HIV-1 latent infection. A high-throughput drug screening experiment was conducted on the HIV-1 latently infected cell line J-Lat 10.6 using a sugar metabolism compound library (TagerMol, Taoshu Biotechnology). It was found that Indisulam can effectively activate latently infected HIV-1. In other suspended latent cell lines J-Lat A2 and J-LatNIB, it was found that Indisulam's effect on activating HIV-1 latent infection was relatively stable. Further, in primary human CD4 + The effect of Indisulam was tested in a T cell model of HIV-1 latent infection and clinical samples from patients. + In T cells, Indisualm showed good activation ability and clinical application capabilities.
[0017] It was further discovered that sulfonamides have a good effect on activating HIV-1 latent infection, and when used in combination with existing LRAs, they can amplify the activation effect and have a synergistic effect.
[0018] Therefore, the present invention claims to protect the use of arylsulfonamide compounds in the preparation of HIV latent infection activators or latency reversals.
[0019] And, the use of arylsulfonamide compounds in preparing drugs for treating HIV.
[0020] Preferably, the HIV is HIV-1.
[0021] Preferably, the arylsulfonamide compound is an arylsulfonamide drug.
[0022] More preferably, the arylsulfonamide drug is a sulfonamide drug with anticancer activity.
[0023] More preferably, the arylsulfonamide compound is a DCAF15 ligand.
[0024] More preferably, the DCAF15 ligand is indisulam, E7820 or tasisulam.
[0025] Most preferably, the DCAF15 ligand is indisulam.
[0026] The invention also claims the use of a composition in preparing an HIV latent infection activator or a latent reversal agent, wherein the composition contains an aryl sulfonamide compound.
[0027] And the invention relates to the use of a composition in preparing medicine for treating HIV, wherein the composition contains an aryl sulfonamide compound.
[0028] Preferably, the composition further comprises a latent infection activator or a latency reversal agent.
[0029] More preferably, the latent infection activator or latency reversal agent is one or more of SAHA, Bryostatin-1 or JQ-1.
[0030] Finally, a composition comprising an arylsulfonamide compound and a latent infection activator or a latent reversal agent is also claimed.
[0031] Preferably, the arylsulfonamide compound is an arylsulfonamide drug.
[0032] More preferably, the arylsulfonamide drug is a sulfonamide drug with anticancer activity.
[0033] More preferably, the arylsulfonamide compound is a DCAF15 ligand.
[0034] More preferably, the DCAF15 ligand is indisulam4, E7820 or tasisulam.
[0035] Most preferably, the DCAF15 ligand is indisulam4.
[0036] The latent infection activator or latent reversal agent is one or more of SAHA, Bryostatin-1 or JQ-1.
[0037] Compared with the prior art, the present invention has the following beneficial effects:
[0038] The present invention provides the use of arylsulfonamide compounds in the preparation of HIV latency activators or latency reversals, as well as the use of arylsulfonamide compounds in the preparation of drugs for treating HIV. Arylsulfonamide drugs have an activating effect on latent HIV and can be used to eliminate latent HIV, thereby curing latent AIDS. They exhibit excellent activation and clinical applicability. Furthermore, arylsulfonamide compounds can be used in combination with existing LRAs to amplify the activation effect, creating a synergistic effect. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] Figure 1 In order to screen potential LRAs in the HIV-1 latent infection cell model J-Lat10.6 using 559 compounds in the sugar metabolism compound library, Indisulam can effectively activate HIV-1 latent infection.
[0040] Figure 2 Indisulam can effectively activate HIV-1 in different HIV-1 latently infected cell line models J-Lat A2 and J-Lat NIB.
[0041] Figure 3 SAHA, Bryostatin-1 and JQ-1 jointly activate the HIV-1 latently infected cell line J-Lat A2.
[0042] Figure 4 SAHA, Bryostatin-1 and JQ-1 combined to activate HIV-1 latently infected cell line J-Lat 10.6.
[0043] Figure 5 Indisulam can activate latent HIV-1 in CD4+ T cells from HIV-1 patients.
[0044] Figure 6 Tasisulam can effectively activate HIV-1 latently infected cell models J-Lat 10.6 and J-Lat NIB
[0045] Figure 7 E7820 can effectively activate HIV-1 latently infected cell models J-Lat 10.6 and J-Lat NIB
[0046] Figure 8 Bryostatin-1 combined with E7820 or Tasisulam effectively activates HIV-1 latent infection DETAILED DESCRIPTION
[0047] The present invention is further described in detail below with reference to the accompanying drawings and specific examples. The examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are commercially available unless otherwise specified.
[0048] J-Lat 10.6 cells were a gift from Dr. Robert F. Siliciano's laboratory;
[0049] J-Lat A2 cells were a gift from Dr. Robert F. Siliciano's laboratory;
[0050] J-Lat NIB cells were donated by Professor Zhang Hui's laboratory at the Institute of Human Virology, Zhongshan School of Medicine, Sun Yat-sen University. They are the "an in vitro latency model" in PMID: 27434587. The preparation method is described in the "Tat-R5M4activates latently infected cells in an in vitro latency model" section of the article, "We adapted the latency model based on primary CD4+T cells infected with amodified env-deleted proviral construct harboring the Bcl-2 gene in the nef region (Figure 3a). The freshly activated CD4 + T lymphocytes were infected with HIV-1 / VSV pseudotyped viruses. Bcl-2 was expressed well and did not reduce theratio of apoptosis after infection (Supplementary Figure S8). After all the cells harboring the integrated proviruses went into the resting state (Supplementary Figure S8), GFP-negative cells were isolated and subjected to toreactivation by various reagents (Figure 3b, Supplementary Figure S8)", and a and b in Figure 3;
[0051] The above three cell lines are all latent HIV virus reservoir cell lines.
[0052] Example 1 Screening of Potential LRAs in HIV-1 Latently Infected Cell Model J-Lat 10.6
[0053] 1. Experimental Methods
[0054] In this example, a latently infected HIV-1 cell line J-Lat10.6 with a GFP reporter gene was used to perform a high-throughput screening of 559 compounds in a carbohydrate metabolism compound library. The specific method is as follows:
[0055] (1) Take well-grown J-Lat 10.6 cells and add them evenly into a 96-well plate. The number of cells per well is 3-4×10 4 559 compounds from the sugar metabolism compound library (TagerMol, Taoshu Biotechnology) were added, with DMSO used as a control, at a final drug concentration of 20 μM. The cells were cultured in RPMI-1640 complete medium (10% fetal bovine serum and 1% double-antibody) in a cell culture incubator (37°C, 5% CO2).
[0056] (2) After drug treatment, the cells were cultured for another 48 h, centrifuged at 500 × g for 5 min, and the cells were harvested and the supernatant discarded;
[0057] (3) Resuspend the cells with PBS, centrifuge at 500 × g for 5 min, discard the supernatant, resuspend the cells with 300 μL PBS and transfer to a flow cytometry tube;
[0058] (4) BD LSR II Fortessa flow cytometer was used to measure the GFP expression level of J-Lat 10.6 cells, and statistical graphs were used to analyze the results.
[0059] 2. Experimental Results
[0060] The results are as follows Figure 1 As shown in the figure, it can be seen that compared with the DMSO group, among the 559 sugar metabolism compound library drugs, Indisulam (CAS No.: 165668-41-7) can lead to upregulation of GFP expression in the screening system, significantly activate J-Lat10.6 and effectively activate HIV-1 latent infection.
[0061] Example 2 Activation Effect of Indisulam in HIV-1 Latently Infected Cell Models J-Lat A2 and J-Lat NIB
[0062] 1. Experimental Methods
[0063] (1) Take well-grown J-Lat A2 and J-Lat NIB cells and evenly add them into a 96-well plate, with 3 to 4 × 10 cells per well. 4Different volumes of Indisulam were added for treatment to give final concentrations of 0.25 μM, 0.5 μM, 1 μM, 2 μM, 4 μM, and 8 μM, respectively. DMSO was used as a control. The cells were cultured in RPMI-1640 complete medium (10% fetal bovine serum and 1% double antibody) in a cell culture incubator (37°C, 5% CO2).
[0064] (2) After adding drugs and culturing for another 48 hours, the cells were centrifuged at 500 × g for 5 minutes, the supernatant was discarded, and the cells were resuspended in 300 μL PBS and transferred to a flow cytometry tube;
[0065] (3) BD LSR II Fortessa flow cytometer was used to measure the GFP expression levels of J-Lat A2 and J-Lat NIB cells treated with different concentrations of Indisulam, and statistical graphs were used to analyze the results.
[0066] 2. Experimental Results
[0067] The results are as follows Figure 2 As shown in the figure, it can be seen that Indisulam can also play a good activation role in the HIV-1 latently infected cell models J-Lat A2 and J-LatNIB.
[0068] Example 3 Indisulam used in combination with various LRAs in HIV-1 latently infected cell models
[0069] 1. Experimental Methods
[0070] (1) Take well-grown J-Lat A2 and J-Lat NIB cells and evenly add them into a 96-well plate, with 3 to 4 × 10 cells per well. 4 SAHA (final concentration 1 μM), Bryostatin-1 (final concentration 10 nM), and JQ-1 (final concentration 1 μM) were added, with or without Indisulam (final concentration 1 μM). DMSO was used as a control. The cells were cultured in RPMI-1640 complete medium (10% fetal bovine serum and 1% double antibody) in a cell culture incubator (37°C, 5% CO2).
[0071] (2) After adding drugs and culturing for another 48 hours, the cells were centrifuged at 500 × g for 5 minutes, the supernatant was discarded, and the cells were resuspended in 300 μL PBS and transferred to a flow cytometry tube;
[0072] (3) BD LSR II Fortessa flow cytometer was used to analyze the GFP expression levels of J-LatA2 and J-Lat NIB cells after LRAs were combined with Indisulam, and statistical graphs were used to analyze the results.
[0073] 2. Experimental Results
[0074] The results are as follows Figure 3 and Figure 4 As shown in the figure, it can be seen that SAHA, Bryostatin-1 and JQ-1 can significantly activate HIV-1 latently infected cell lines J-Lat A2 and J-Lat 10.6. This activation effect is more significant after combined use of Indisulam, and has a systemic synergistic effect.
[0075] Example 4 Activation Effect of Indisulam on CD4+ T Cells in HIV-1 Patients
[0076] 1. Sample Source
[0077] With their informed consent, blood samples were collected from 6 HIV-1 patients who were receiving long-term HAART treatment at the Eighth Affiliated Hospital of Guangzhou Medical University.
[0078] 2. Experimental Methods
[0079] (1) 10 mL of blood sample donated by an HIV-1 patient receiving long-term HAART treatment was diluted with 40 mL of PBS solution;
[0080] (2) Take two 50 mL centrifuge tubes and add 25 mL of human lymphocyte separation medium;
[0081] (3) Use a pipette to draw the diluted blood and slowly add 25 mL of mixed peripheral blood to the lymphocyte separation medium interface. Centrifuge at room temperature for 30 min at 500 × g, with an acceleration of 5 and a deceleration of 0.
[0082] (4) Use a pipette to remove the cells (PBMCs) in the middle milky white layer into a new 50 mL centrifuge tube, add PBS to 50 mL, and centrifuge at 500 × g for 5 min at room temperature;
[0083] (5) Discard the supernatant, resuspend the cells with an appropriate amount of PBS, centrifuge at 500 × g for 5 min at room temperature, take 20 μL of the cell suspension, and count the cells using a cell counter;
[0084] (6) Add appropriate amount of PBS to dilute the cells to 1×10 7 cells / mL, for every 1×10 6 Add 3 μL CD4 Biotinylated Human T Lymphocyte Enrichment Cocktail to each cell, mix well, and incubate at room temperature for 15 minutes;
[0085] (7) After incubation, add 10 volumes of PBS, centrifuge at 500 × g for 5 min at room temperature, and discard the supernatant;
[0086] (8) Add an equal volume of Streptavidin Particles to the CD4 Biotinylated Human T Lymphocyte Enrichment Cocktail, pipette to mix, and incubate at room temperature for 30 min.
[0087] (9) After the incubation, add PBS and resuspend the cells to 2-8×10 7 / mL, transfer to a flow tube, and place it in a BDIMagnet for 8-10 minutes;
[0088] (10) Carefully aspirate the supernatant into a new 15 mL centrifuge tube using a pipette tip, centrifuge at 500 × g for 5 min at room temperature, discard the supernatant, resuspend in RPMI-1640 complete medium (10% fetal bovine serum and 1% double antibody), and culture in a cell culture incubator (37°C, 5% CO2);
[0089] (11) The CD4+ T lymphocytes isolated in (10) were divided into two groups. One group of cells was treated with 5 μM Indisulam, and the other group was treated with the same volume of DMSO as the control group.
[0090] (12) After 48–72 h of treatment, cells were washed with PBS, centrifuged, and the supernatant was discarded to collect the cells;
[0091] (13) RNA was extracted from cells using the Trizol method, and 2 μL of RNA sample was used to measure RNA concentration using an Agilent 2100.
[0092] (14) Reverse transcription was performed according to the instructions of the HiScript II 1st Strand cDNA Synthesis Kit (Vazyme);
[0093] (15) Take 3–5 μL of PCR product and test the amplification effect by 3% agarose gel electrophoresis;
[0094] (16) qPCR was performed according to the instructions of the 2×SYBR Green qPCR Mix kit (Vazyme) to detect the level of cell-associated unspliced HIV RNA (CA-US).
[0095] Among them, the qPCR primers were SK38: ATAATCCACCTATCCCAGTAGGAGAAA and SK39: TTTGGTCCTTGTCTTATGTCCAGAATGC.
[0096] 3. Experimental Results
[0097] Unspliced HIV RNA (CA-US) levels are considered a marker of latent infection. Figure 5 As shown in the figure, CD4 + After T cells were treated with Indisulam, HIV CA-US RNA levels increased in five patients, indicating that Indisulam exhibits good activation ability and clinical application capabilities and is an effective LRA.
[0098] Example 5 Activation Effects of Other Arylsulfonamide Compounds on HIV Latently Infected Cell Model
[0099] 1. Experimental Methods
[0100] 1. Take well-grown J-Lat 10.6 and J-Lat NIB cells and add them evenly into 96-well plates. The number of cells per well is (3-4)×10 4 . Perform the following processing respectively:
[0101] Treatment 1: Different volumes of E7820 or Tasisulam were added to the cells to achieve final concentrations of 5 μM and 20 μM, respectively. DMSO was used as a control.
[0102] Treatment 2: E7820 or Tasisulam (final concentration 20 μM) was added to cells treated with Bryostatin-1 (final concentration 10 nM), and DMSO was used as a control.
[0103] Afterwards, the cells were cultured in RPMI-1640 complete medium (10% fetal bovine serum and 1% double antibody) in a cell culture incubator (37°C, 5% CO2);
[0104] 2. After adding drugs and culturing for another 48 hours, centrifuge at 500 × g for 5 minutes, collect the cells, discard the supernatant, resuspend the cells in 300 μL PBS and transfer them to a flow cytometry tube;
[0105] 3. Use BD LSR II Fortessa flow cytometer to measure the GFP expression level of J-Lat 10.6 and J-Lat NIB cells, and make statistical graphs to analyze the results.
[0106] 2. Experimental Results
[0107] The results are as follows Figures 6 to 8 As shown, from Figure 6 and Figure 7It can be seen that when the content of E7820 or Tasisulam in the culture medium reaches 20μM, it can effectively activate the HIV-1 latently infected cell models J-Lat 10.6 and J-Lat NIB. Figure 8 As shown in the results, Bryostatin-1 alone significantly activated HIV-1 latently infected cell lines J-Lat10.6 and J-Lat NIB, while combined use with E7820 or Tasisulam amplified this activation effect. This suggests that the arylsulfonamide compounds E7820 and Tasisulam can also effectively activate HIV-1 latent infection and are novel LRAs.
Claims
1. Use of an arylsulfonamide compound in the preparation of a drug for treating HIV, characterized in that: The arylsulfonamide compound is indisulam or E7820.
2. Use of tassolan in the preparation of drugs for treating HIV.
3. The use according to claim 1 or 2, characterized in that The drug for treating HIV is an HIV latent infection activator or a latent reversal agent.
4. The use according to claim 1 or 2, characterized in that The HIV is HIV-1.
5. Use of a composition in the preparation of a drug for treating HIV, characterized in that: The composition contains an arylsulfonamide compound and a latent infection activator or a latent reversal agent; The arylsulfonamide compound is indisulam or E7820, and the latent infection activator or latent reversal agent is one or more of SAHA, Bryostatin-1 or JQ-1.
6. Use of a composition in the preparation of a drug for treating HIV, characterized in that: The composition contains tassolan and a latent infection activator or a latency reversal agent; The latent infection activator or latent reversal agent is one or more of SAHA, Bryostatin-1 or JQ-1.
7. The use according to claim 5 or 6, characterized in that The HIV is HIV-1.
Citation Information
Patent Citations
Antiviral JAK inhibitors useful in treating or preventing retroviral and other viral infections
US20140328793A1
Treatment of cancer and other diseases
WO2007064691A1