Application of OsTB1 gene and protein in regulating rice resistance to sheath blight and bacterial leaf blight

Abstract

This invention discloses the application of the OsTB1 gene and protein in regulating rice resistance to sheath blight and bacterial leaf blight, belonging to the field of functional gene and germplasm innovation technology. This invention discloses the application of the OsTB1 gene or OsTB1 protein in regulating rice resistance to sheath blight and bacterial leaf blight. This invention obtains OsTB1 overexpressing plants through genetic transformation. Compared with the wild type, the expression level of OsTB1 in the overexpressing plants is significantly higher. When the overexpressing plants and wild-type plants are inoculated with *Sheath blight* and *Bacterium oxysporum*, the overexpressing plants show significantly enhanced resistance to sheath blight and multiple bacterial leaf blights compared to the wild type. This invention, through disease resistance experiments on rice OsTB1 overexpressing plants, found that their resistance to sheath blight and bacterial leaf blight is significantly enhanced compared to the wild type.

Description

Technical Field

[0001] This invention belongs to the field of functional gene and germplasm innovation technology, specifically involving the application of the OsTB1 gene and protein in regulating rice resistance to sheath blight and bacterial blight. Background Technology

[0002] Rice is one of the world's most important food crops, with more than half of the global population relying on it for food. Sheath blight and bacterial blight are two important rice diseases that cause significant yield losses every year. Therefore, disease control is crucial for ensuring food production.

[0003] Currently, there is a lack of rice varieties with high resistance to sheath blight in production. Furthermore, since the vast majority of sheath blight pathogens in the field have binucleate or multinucleate genomes, it is difficult to carry out genetic transformation, resulting in a relatively slow research on the pathogenesis of sheath blight. This brings great difficulties to the prevention and control of the disease.

[0004] Although some rice bacterial blight resistant varieties exist in production, these varieties typically only possess vertical resistance. Large-scale field planting increases selection pressure, leading to easy mutations in the pathogen and the breaking down of existing resistance genes. Disease-resistant breeding is an efficient and environmentally friendly measure for disease control, and discovering new broad-spectrum, highly resistant genes is a crucial prerequisite for breeding.

[0005] TCP (Teosinte branched 1 / Cycloidea / Proliferating cell factor) is a class of transcription factors unique to plants and widely distributed throughout the plant community. TCP regulates plant growth and development by modulating cell growth, embryonic development, leaf senescence, and photomorphogenesis. The TB1 subclass of the TCP family plays a role in regulating axillary bud meristem development, influencing flower and lateral branch formation. Studies have shown that rice Teosinte branched 1 (TB1) / Fine culm1 (FC1) is expressed in the apical meristem, basal lateral bud meristem, and vascular tissue of rice plants, influencing tillering by inhibiting axillary bud growth and negatively regulating lateral branch development. However, its relationship with rice sheath blight and bacterial leaf blight remains unresolved. Summary of the Invention

[0006] The purpose of this invention is to provide the application of the OsTB1 gene and protein in regulating the resistance of rice to sheath blight and bacterial blight, which can effectively improve the resistance of rice to sheath blight and multiple bacterial blight races.

[0007] This invention provides the application of the OsTB1 gene or OsTB1 protein in regulating the resistance of rice to sheath blight and bacterial blight.

[0008] Preferably, the nucleotide sequence of the OsTB1 gene is shown in SEQ ID No. 1.

[0009] Preferably, the amino acid sequence of the OsTB1 protein is shown in SEQ ID No. 2.

[0010] Preferably, overexpressing the OsTB1 gene in the rice genome enhances the rice's resistance to sheath blight and bacterial blight.

[0011] The present invention also provides a method for improving the resistance of rice to sheath blight and bacterial blight, comprising the following steps: expressing or overexpressing the OsTB1 gene in the target rice genome.

[0012] Preferably, the method of expression or overexpression includes genetic engineering.

[0013] This invention also provides the application of the OsTB1 gene in the preparation of rice varieties or lines with high resistance to sheath blight and bacterial blight.

[0014] The present invention also provides a method for breeding rice varieties or lines with high resistance to sheath blight and bacterial blight, comprising the following steps: increasing the expression of the OsTB1 gene in the genome of a known rice variety or line.

[0015] The present invention also provides a method for verifying the resistance of rice varieties / lines to bacterial blight, including detecting the expression level of the OsTB1 gene or the expression level of the OsTB1 protein in the genome of the rice variety / line.

[0016] Preferably, the reagents for detecting the expression level of the OsTB1 gene include the OsTB1-F primer with nucleotide sequences as shown in SEQ ID No. 4 and the OsTB1-R primer as shown in SEQ ID No. 5.

[0017] Beneficial Effects: In this embodiment of the invention, OsTB1 overexpressing plants were obtained through genetic transformation. The expression levels of the OsTB1 gene in the overexpressing plants and wild-type plants were detected using qRT-PCR. The results showed that the expression level of OsTB1 in the overexpressing plants was significantly higher than that in the wild-type plants. The obtained overexpressing and wild-type plants were inoculated with *Rhizoctonia solani* and *Bacillus thuringiensis*. Compared with the wild-type plants, the overexpressing plants showed significantly enhanced resistance to *Rhizoctonia solani* and several bacterial blights. This invention, through disease resistance experiments on OsTB1 overexpressing rice plants, found that their resistance to *Rhizoctonia solani* and bacterial blight was significantly enhanced compared to the wild-type, providing a theoretical basis for elucidating the disease resistance of plants. It can also be applied to the screening and creation of disease-resistant rice materials, laying a germplasm foundation for future variety improvement. Attached Figure Description

[0018] Figure 1Schematic diagram of OsTB1 overexpression vector;

[0019] Figure 2 The relative expression levels of the OsTB1 gene in OsTB1-overexpressing rice and wild-type rice;

[0020] Figure 3 The phenotype and lesion length of wild-type rice plants and OsTB1-overexpressing rice after inoculation with sheath blight were statistically analyzed, where ZH11 represents wild-type rice Zhonghua 11;

[0021] Figure 4 Phenotypic and lesion length statistics were obtained for wild-type rice plants and OsTB1-overexpressing rice after inoculation with different races of bacterial blight, where ZH11 represents wild-type rice Zhonghua 11. Detailed Implementation

[0022] This invention provides the application of the OsTB1 gene or OsTB1 protein in regulating the resistance of rice to sheath blight and bacterial blight.

[0023] The nucleotide sequence of the OsTB1 gene described in this invention is shown in SEQ ID No. 1:

[0024] ATGCTTCCTTTCTTCGATTCCCCAAGCCCCATGGACATACCGCTTTACCAAC

[0025] AGCTTCAGCTCACCCCTCCCTCTCCAAAGCCCGACCACCACCACCACCAC

[0026] CATTCCACCTTCTTCTACTACCACCACCACCCACCTCCCTCCCCTTCCTTCC

[0027] CCTCCTTCCCCTCCCCCGCCGCCGCCACGATCGCCTCGCCGTCGCCGGCCA

[0028] TGCACCCCTTCATGGACTTGGAGTTGGAGCCGCATGGGCAGCAGCTGGCG

[0029] GCGGCGGAGGAGGACGGGGCAGGCGGGCAAGGCGTCGACGCCGGGGTG

[0030] CCCTTCGGCGTCGACGGAGCGGCGGCGGCCGCGGCGGCGAGGAAGGACC

[0031] GGCACAGCAAGATAAGCACCGCCGGCGGGATGAGGGACCGGCGGATGCG

[0032] GCTGTCCCTCGACGTCGCCCGCAAGTTCTTCGCGCTCCAGGACATGCTCGG

[0033] CTTCGACAAGGCCAGCAAGACGGTGCAATGGCTCCTCAACATGTCCAAGG

[0034] CCGCCATCCGGGAGATCATGAGCGACGACGCCTCCTCCGTCTGCGAGGAG

[0035] GACGGCTCCAGCAGCCTCTCCGTCGACGGCAAGCAGCAGCAGCACAGCA

[0036] ACCCGGCGGATCGGGGCGGCGGCGCCGGGGACCACAAGGGCGCCGCTCA

[0037] CGGCCACAGCGACGGGAAGAAGCCGGCCAAGCCGAGAAGGGCAGCGGC

[0038] CAACCCGAAGCCACCGCGGCGGCTGGCCAATGCGCACCCCGTCCCCGACA

[0039] AGGAGTCGCGCGCCAAGGCGAGGGAGCGGGCGCGGGAGCGGACCAAGG

[0040] AGAAGAACCGGATGCGGTGGGTCACCCTCGCCTCGGCAATCAGCGTCGAG

[0041] GCGGCCACCGCGGCGGCGGCCGCGGGGGAGGACAAGTCGCCGACGAGCC

[0042] CCAGCAACAACCTGAACCACTCATCGTCCACCAATCTTGTGAGCACCGAA

[0043] TTGGAGGACGGCTCCTCGTCAACGCGCCACAACGGCGTCGGCGTCAGCGG

[0044] CGGCCGGATGCAAGAAATCTCGGCGGCTAGCGAGGCGAGCGACGTGATCA

[0045] TGGCGTTCGCCAACGGCGGCGCGTACGGCGACAGCGGCAGCTACTACCTG

[0046] CAGCAGCAGCATCAGCAGGATCAGTGGGAGCTCGGCGGCGTCGTCTACGC

[0047] CAATTCGCGGCACTACTGCTGA, the genomic sequence is shown in SEQ ID No.3

[0048] AAGATGGCAACACCCTGATCTCTAGCTTAGCTGCAGAGGGGAGAGGAACC

[0049] TCACATCCAAACTCCTAGCTACAACTTGTACTAGCATCCTAAGCAACCAAG

[0050] CACAACCAAAGCAAGCAAGCACGAACAATTCTTTCTTCCTCTCTACCTCTA

[0051] GCTGCTGCCTGCCTCCTAATCCTCCTACCCACCACTCCACATGAGCCCATG

[0052] CTGTGTGCCTGTGTCTGTGTGTGTGTTCTACTCCTACCATGAGAGAAGAGA

[0053] CCAAGCATCAACCAAGCTAGCTAGCTCGTCCTCTCCTCGATCTCTACTTCTC

[0054] TCTCCCACACAAGCTGAGCGCCCAGGTAGGCTGCCTGCTAGGTCTCGTGC

[0055] ATGGCCGGACACATCTGATCATAGCCCACTACGGCACTATTCCCCCCTTCCG

[0056] CCTCGCACGCTGAGAGGTGGCCGGAGAGGGAGGGAGGCCAGCGAGCAGC

[0057] AGTAGCAGCAGCAACGCGGCTAGGAGTAAGGAGTCCCATCAGTAAAGCAT

[0058] GCTTCCTTTCTTCGATTCCCCAAGCCCCATGGACATACCGCTTTACCAACAG

[0059] CTTCAGCTCACCCCTCCCTCTCCAAAGCCCGACCACCACCACCACCACCAT

[0060] TCCACCTTCTTCTACTACCACCACCACCCACCTCCCTCCCCTTCCTTCCCCT

[0061] CCTTCCCCTCCCCCGCCGCCGCCACGATCGCCTCGCCGTCGCCGGCCATGC

[0062] ACCCCTTCATGGACTTGGAGTTGGAGCCGCATGGGCAGCAGCTGGCGGCG

[0063] GCGGAGGAGGACGGGGCAGGCGGGCAAGGCGTCGACGCCGGGGTGCCCT

[0064] TCGGCGTCGACGGAGCGGCGGCGGCCGCGGCGGCGAGGAAGGACCGGCA

[0065] CAGCAAGATAAGCACCGCCGGCGGGATGAGGGACCGGCGGATGCGGCTGT

[0066] CCCTCGACGTCGCCCGCAAGTTCTTCGCGCTCCAGGACATGCTCGGCTTCG

[0067] ACAAGGCCAGCAAGACGGTGCAATGGCTCCTCAACATGTCCAAGGCCGCC

[0068] ATCCGGGAGATCATGAGCGACGACGCCTCCTCCGTCTGCGAGGAGGACGG

[0069] CTCCAGCAGCCTCTCCGTCGACGGCAAGCAGCAGCAGCACAGCAACCCG

[0070] GCGGATCGGGGCGGCGGCGCCGGGGACCACAAGGGCGCCGCTCACGGCC

[0071] ACAGCGACGGGAAGAAGCCGGCCAAGCCGAGAAGGGCAGCGGCCAACC

[0072] CGAAGCCACCGCGGCGGCTGGCCAATGCGCACCCCGTCCCCGACAAGGA

[0073] GTCGCGCGCCAAGGCGAGGGAGCGGGCGCGGGAGCGGACCAAGGAGAA

[0074] GAACCGGATGCGGTGGGTCACCCTCGCCTCGGCAATCAGCGTCGAGGCGG

[0075] CCACCGCGGCGGCGGCCGCGGGGGAGGACAAGTCGCCGACGAGCCCCAG

[0076] CAACAACCTGAACCACTCATCGTCCACCAATCTTGTGAGCACCGAATTGG

[0077] AGGACGGCTCCTCGTCAACGCGCCACAACGGCGTCGGCGTCAGCGGCGG

[0078] CCGGATGCAAGAAATCTCGGCGGCTAGCGAGGCGAGCGACGTGATCATGG

[0079] CGTTCGCCAACGGCGGCGCGTACGGCGACAGCGGCAGCTACTACCTGCAG

[0080] CAGCAGCATCAGCAGGATCAGTGGGAGCTCGGCGGCGTCGTCTACGCCAA

[0081] TTCGCGGCACTACTGCTGATGTGATCATCCATCCACACACGAACGAACGAA

[0082] CGAACGGTACGGCACTAAGATCGAACTCCTGCAGCTACATAATTATCCTTT

[0083] GCTTCTCAAGAGTAATAATTCTTGACGTGTTAATTAATCCGGGTGTGTATTA

[0084] ATTCCCTCTTATTATTTTTTCTCGCGTTTATCCGGAGTTGACTGTGGTGAAG

[0085] ACGAACTTTGGTTTGGTCATCGCATGGTGTGCATTGCATATATAGCTAGCACTATCGTCTGATCGATGATTCATC; The preferred amino acid sequence encoding the OsTB1 protein is as shown in SEQ ID. Shown in No.2: MLPFFDSPSPMDIPLYQQLQLTPPSPKPDHHHHHHSTFFYYHHHPPPSPSFPSFPSPAAATIASPSPAMHPFMDLELEPHGQQLAAAEEDGAGGQGVDAGVPFGVDGAAAAAAARKDRHSKISTAGGMRDRRMRLSLDVARKFFALQDMLGFDKASKTVQWLLNMSKAAIREIMSDDASSVCEEDGSSSLS VDGKQQQHSNPADRGGGAGDHKGAAHGHSDGKKPAKPRRAAANPKPPRRLANAHPVPDKESRAKARERERTKEKNRMRWVTLASAISVEAATAAAAAGEDKSPTSPSNNLNHSSSSTNLVSTELEDGSSSTRHNGVGVSGGRMQEISAASEASDVIMAFANGGAYGDSGSYYLQQQHQQDQWELGGVVYANSRHYC*.

[0086] This invention demonstrates that by increasing the expression of the OsTB1 gene, overexpressing plants can exhibit significant resistance to sheath blight and bacterial blight, thus confirming that overexpression of the OsTB1 gene can improve the resistance of rice to sheath blight and bacterial blight.

[0087] This invention does not specifically limit the method for altering the expression level of OsTB1 in the rice genome. Preferred methods include EMS chemical mutagenesis, radiation mutagenesis, T-DNA insertion, CRISPR gene editing, or genetic transformation. In the embodiments, it is preferred to construct an overexpression vector and use Agrobacterium-mediated transformation of rice callus to obtain transgenic rice with high OsTB1 expression. However, this should not be considered the entire scope of protection of this invention. In the embodiments of this invention, it is preferred to insert OsTB1 after the strong promoter Ubi of pCAMBIA1381 to construct the OsTB1-pCambial-1381-Ubi overexpression vector, which is then obtained through Agrobacterium-mediated genetic transformation. Primers are designed based on the target gene sequence, and the full-length fragment of the target gene TB1 with HindIII and KpnI restriction sites is obtained by PCR using cDNA from wild-type rice Zhonghua 11 as a template. The product was ligated into the intermediate vector pBlueScript SK(+) by digesting the vector with EcoRV single enzyme, and then ligated into the overexpression vector pCAMBIA1381 by double digestion with HindIII and KpnI.

[0088] Amplification primers:

[0089] OsTB1-OX-F (SEQ ID No. 8): AAGCTTATGCTTCCTTTCTTCGATTCC, OsTB1-OX-R (SEQ ID No. 9): GGTACCTCAGCAGTAGTGCCGCGAATT

[0090] The present invention also provides a method for improving the resistance of rice to sheath blight and bacterial blight, comprising the following steps: expressing or overexpressing the OsTB1 gene in the target rice genome.

[0091] The present invention preferably uses genetic engineering methods to express or overexpress the OsTB1 gene in the target rice genome. In the embodiments of the present invention, transgenic rice with OsTB1 gene overexpression was obtained using the Zhonghua 11 rice variety as the original material, which showed significant resistance to sheath blight and bacterial blight.

[0092] This invention also provides the application of the OsTB1 gene in the preparation of rice varieties or lines with high resistance to sheath blight and bacterial blight.

[0093] The preferred applications described in this invention are the same as those described above, and will not be repeated here.

[0094] The present invention also provides a method for breeding rice varieties or lines with high resistance to sheath blight and bacterial blight, comprising the following steps: increasing the expression of the OsTB1 gene in the genome of a known rice variety or line.

[0095] The method described in this invention is preferably the same as described above, and will not be repeated here.

[0096] The present invention also provides a method for verifying the resistance of rice varieties / lines to bacterial blight, including detecting the expression level of the OsTB1 gene or the expression level of the OsTB1 protein in the genome of the rice variety / line.

[0097] The preferred methods for detecting the expression level described in this invention include qRT-PCR, Western blotting, or ELISA. In the examples, qRT-PCR is preferred for verifying the expression level of the OsTB1 gene; however, this should not be considered the entire scope of protection of this invention. When performing the qRT-PCR, Actin is preferably used as an internal control, and the primer sequences used are shown below:

[0098] OsTB1-F (SEQ ID NO.4): CAAGAAATCTCGGCGGCTAG;

[0099] OsTB1-R (SEQ ID NO.5): GCGAATTGGCGTAGACGAC;

[0100] Actin-F (SEQ ID NO. 6): GAGTATGATGAGTCGGGTCCAG;

[0101] Actin-R (SEQ ID NO. 7): ACACCAACAATCCCAAACAGAG.

[0102] This invention preferably collects leaves from wild-type and mutant plants, extracts RNA, and reverse transcribes it into cDNA. The cDNA is used as a template to prepare the reaction system. In the examples, qRT-PCR was performed using the ChamQ universal SYBR qPCR Master Mix (Vazyme, China) kit. The operation steps are as follows: 1. 95℃, 30s; 2. 95℃, 5s; 60℃, 30s; step 2 was repeated 40 times; melting curve program: 95℃, 15s; 60℃, 30s; 95℃, 15s.

[0103] To further illustrate the present invention, the application of the OsTB1 gene and protein provided by the present invention in regulating the resistance of rice to sheath blight and bacterial blight is described in detail below with reference to the embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0104] Example 1

[0105] Full-length primers were designed based on the OSTTB1 sequence. The CDS fragment of the target gene OsTB1 was obtained from cDNA containing the target gene by PCR. Finally, the entire fragment was ligated into a plant overexpression vector driven by the Ubi promoter. Figure 1 The specific experimental method is as follows:

[0106] Primers for amplifying the OsTB1 gene, SEQ ID No. 8 and SEQ ID No. 9, were designed using bioinformatics software such as Snapgene. OsTB1 gene amplification and cloning experiments were performed using TOYOBO high-fidelity PCR polymerase KOD-Plus.

[0107] After gel electrophoresis, the PCR products were recovered using the Kangwei Century Gel Extraction Kit. The recovered target gene was ligated into the pBlueScript SK(+) vector, which had been linearized by EcoRV digestion, using TaKaRa T4 DNA Ligase. The ligation system was transformed into *E. coli* DH5α, and positive clones were screened and sent to a biotechnology company for sequencing analysis. The correctly sequenced intermediate vector was selected, and the target fragment was recovered using a double enzyme digestion system. The pCAMBIA1381-Ubi vector was digested with HindIII and KpnI, following the same digestion system as the previous step. All digestion products were recovered, and a ligation reaction was performed to ligate the target gene into the final overexpression vector pCAMBIA1381-Ubi. This was transformed into *E. coli* DH5α, and positive clones were screened and sent to the company for sequencing analysis, thus completing the construction of the overexpression vector. The plasmid was extracted and introduced into *Agrobacterium tumefaciens* EHA-105 for transformation of callus tissue of the rice variety Zhonghua 11. T0 generation rice with hygromycin resistance was obtained. Individual plants were harvested and sown to produce T1 generation rice. RNA was extracted from rice leaves, reverse transcribed into cDNA, and overexpressing plants were identified by qRT-PCR.

[0108] Using Actin as an internal reference, the primer sequences used are shown below:

[0109] OsTB1-F (SEQ ID NO.4):CAAGAAATCTCGGCGGCTAG;

[0110] OsTB1-R (SEQ ID NO.5): GCGAATTGGCGTAGACGAC;

[0111] Actin-F (SEQ ID NO. 6): GAGTATGATGAGTCGGGTCCAG;

[0112] Actin-R (SEQ ID NO. 7): ACACCAACAATCCCAAACAGAG.

[0113] Leaves from wild-type and mutant strains were collected, RNA was extracted, and cDNA was reverse transcribed. The cDNA was used as a template to prepare the reaction system, and the reaction was performed using the ChamQ universal SYBR qPCR Master Mix (Vazyme, China) kit. The operation steps were as follows: 1. 95℃, 30s; 2. 95℃, 5s; 60℃, 30s; step 2 was repeated 40 times; melting curve program: 95℃, 15s; 60℃, 30s; 95℃, 15s.

[0114] RNA was extracted from leaves and reverse transcribed into cDNA. The expression level of the OsTB1 gene in the overexpressing plants and wild-type Zhonghua 11 was detected by qRT-PCR. The results showed that the expression level of OsTB1 in the mutant was significantly higher than that in the wild type. Figure 2 ).

[0115] The obtained overexpression lines were inoculated with *Rhizoctonia solani* and *Bacillus thuringiensis*, and the length of lesions was measured after disease onset. *Rhizoctonia solani* identification was performed using a leaf sheath method. Activated *Rhizoctonia solani* fungal cakes were punched out and placed in the center of a new PDA culture dish. Wood bark was placed radially around the fungal cake. Once the mycelium had covered the entire culture dish, the wood bark at the same distance from the fungal cake was removed and placed in a cultured rice leaf sheath. The dish was sprayed twice with distilled water and wrapped with plastic wrap to maintain moisture. Eight overexpression plants and eight wild-type plants were inoculated each. The lesion length was measured one week later. The results are as follows: Figure 3 As shown. The identification of bacterial blight was performed using the leaf-cutting method. Frozen bacterial blight pathogens were streaked on a plate, and the resulting single colonies were then cultured on a shaker at 28℃ and 220 rpm. Once the OD value reached 0.8-1.0, 1 cm of the rice leaf tip was cut off using scissors dipped in the bacterial solution. Ten overexpressing plants and ten wild-type plants were inoculated. The length of the lesions was counted two weeks later. The results are shown below. Figure 4 As shown.

[0116] The results showed that the lesion length of the overexpressing plants was significantly shorter than that of the wild-type control, indicating that the overexpressing plants had significantly improved resistance to sheath blight and bacterial blight.

[0117] Table 1. Statistics on lesion length after inoculation with *Rhizoctonia solani*.

[0118]

[0119] Table 2. Statistics on lesion length after inoculation with bacterial blight pathogen.

[0120]

[0121] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of the OsTB1 gene or OsTB1 protein in regulating resistance to rice sheath blight and bacterial blight, characterized in that, The nucleotide sequence of the OsTB1 gene is shown in SEQ ID No. 1; the amino acid sequence of the OsTB1 protein is shown in SEQ ID No.

2. Overexpression of the OsTB1 gene or OsTB1 protein in the rice genome enhances rice resistance to sheath blight and bacterial blight.

2. A method for improving the resistance of rice to sheath blight and bacterial leaf blight, characterized in that, The method includes the following steps: overexpressing the OsTB1 gene in the target rice genome, wherein the nucleotide sequence of the OsTB1 gene is shown in SEQ ID No.

1.

3. The application of overexpression of the OsTB1 gene in the preparation of rice varieties or lines highly resistant to sheath blight and bacterial blight, characterized in that, The nucleotide sequence of the OsTB1 gene is shown in SEQ ID No.

1.

4. A method for cultivating a rice variety or strain highly resistant to sheath blight and bacterial blight, characterized in that, Includes the following steps: Increase the expression level of the OsTB1 gene in the genome of a known rice variety or strain; the nucleotide sequence of the OsTB1 gene is shown in SEQ ID No. 1.

Images