A GATA transcription factor protein degradation targeted consortium compound and its preparation method and application

Abstract

The present invention discloses a GATA transcription factor protein degradation targeted consortium compound and a preparation method and application thereof. The structure of the compound is shown in Formula I. The compound has a nanomolar binding ability to the GATA transcription factor, has a significant effect on the degradation of the GATA transcription factor, and has a significant effect on inhibiting tumor growth. The compound can be effectively used in the preparation of drugs for degrading GATA transcription factors, drugs for treating abnormal GATA transcription factors, and cancer treatment drugs.

Description

Technical Field

[0001] The present invention belongs to biomedicine, and in particular relates to a GATA transcription factor protein degradation targeting consortium compound and a preparation method and application thereof. Background Art

[0002] There are multiple members of human GATA transcription factors (GATA1 to 6 six classical GATA transcription factors and TRPS1 non-classical GATA transcription factor), all of which play an important biological function in the occurrence and development of various diseases by recognizing GATA elements on DNA through their GATA zinc finger structures to regulate downstream gene expression. GATA transcription factors promote the malignant progression of various cancers and are important carcinogenic factors. Take GATA3, a typical GATA family member, as an example. GATA3 is often highly expressed in breast cancer patients. It can not only act as a pioneer transcription factor to drive the expression of ERα-related genes in the form of recruiting other auxiliary factors, but also promote the proliferation of breast cancer cells by promoting G1 / S transition by upregulating genes such as CCND1. At the same time, researchers have found that double loss of GATA3 and MDM2 can lead to synthetic lethality of ER-positive breast cancer cells. In squamous cell carcinoma of the neck, GATA3 can stabilize HIT-1α and enhance the invasiveness of cancer. In T cell tumors, GATA3 can also act as a proto-oncogene to promote the growth and survival of tumor cells. Therefore, GATA transcription factors such as GATA3 are potential targets for cancer treatment. In addition, abnormalities in GATA transcription factors are also an important cause of anemia, hypoparathyroidism, deafness and infertility, as well as developmental diseases such as kidney and heart defects. However, all transcription factors, including GATA transcription factors, lack structurally stable small molecule binding pockets and allosteric regulatory sites, and their transcription factor characteristic DNA binding domains have positive charge enrichment and convex shapes on the surface, and have always been considered "undruggable" proteins. The protein degradation targeted consortium PROTAC technology uses the in vivo proteasome system (UPS) to spatially bring the target protein closer to a specific E3 ubiquitination ligase to achieve specific degradation, making it possible to target undruggable proteins. At present, a variety of PROTAC drugs have entered the clinic one after another. However, there is no GATA transcription factor protein degradation targeted consortium drug. Summary of the invention

[0003] Purpose of the invention: In order to solve the problems existing in the prior art, the present invention provides a protein degradation targeted consortium compound targeting GATA transcription factor, which is the first compound drug proposed for targeted degradation of GATA transcription factor, has strong affinity with the target protein and high efficacy; it can be used to prepare drugs for the treatment of breast cancer.

[0004] The invention also provides a preparation method and application of the compound. The invention provides a new VHL ligand synthesis route and successfully connects the three core components of the drug together, further breaking through the technical bottleneck of the transcription factor being undrugable in the prior art.

[0005] Technical solution: In order to achieve the above-mentioned purpose, the present invention provides a GATA transcription factor protein degradation targeted consortium compound and a pharmaceutically acceptable salt thereof, the structure of which is shown in formula (I):

[0006]

[0007] The method for preparing the GATA transcription factor protein degradation targeted consortium compound and its pharmaceutically acceptable salt according to the present invention is characterized in that the reaction process is as follows:

[0008]

[0009]

[0010]

[0011] Wherein, the synthesis method comprises the following steps:

[0012] (1) slowly adding Et3SiH and TFA to tert-butyl carbamate and 4-bromobenzaldehyde in a solvent, stirring the reaction, quenching the reaction, extracting, washing, drying, filtering, and vacuum concentrating to obtain a crude product, which is separated and purified to obtain an intermediate 1;

[0013] (2) Dissolving the intermediate product 1, 4-methylthiazole, Pd(OAc)2, and K2CO3 in N,N-dimethylacetamide, heating for reaction, cooling to room temperature, diluting, extracting, washing, drying, filtering, and vacuum concentrating to obtain a crude product, which is separated and purified to obtain the intermediate product 2;

[0014] (3) The intermediate product 2 (1 mmol) was dissolved in DCM, TFA was added, and the mixture was stirred for reaction, extracted, washed, and dried. The obtained crude deprotected amine (1 mmol) was dissolved in N,N-dimethylformamide, boc-L-hydroxyproline was added, DIPEA was added while stirring, and then HATU was added. After stirring for reaction, water was added, extracted, washed, and dried, filtered, and concentrated in vacuo to obtain a crude product. After separation and purification, the intermediate product 3 was obtained.

[0015] (4) The intermediate product 3, benzoyl chloride and DMAP were dissolved in DCM, TEA was added under ice bath conditions, the reaction was stirred, H2O was added, extraction was performed, washing was performed, drying was performed, filtration was performed, and vacuum concentration was performed to obtain a crude product, which was separated and purified to obtain the intermediate product 4;

[0016] (5) The intermediate product 4 is dissolved in DCM, TFA is added, the reaction is stirred, extracted, washed, and dried, and the obtained crude deprotected amine is dissolved in N,N-dimethylformamide, boc-L-tert-leucine is added, DIPEA is added while stirring, and then HATU is added. After stirring, water is added, extraction, washing, drying, filtering, and vacuum concentration are performed to obtain a crude product, which is separated and purified to obtain an intermediate product 5;

[0017] (6) The intermediate product 5 is dissolved in DCM, TFA is added, the reaction is stirred, extracted, washed, and dried, and the obtained crude deprotected amine is dissolved in N,N-dimethylformamide, 2-[2-(tert-butoxycarbonylamino)ethoxy]ethoxyacetic acid is added, DIPEA is added while stirring, and then HATU is added, the reaction is stirred, water is added, extraction, washing, drying, filtering, and vacuum concentration are performed to obtain a crude product, which is separated and purified to obtain the reactant 1;

[0018] (7) The reactant 1 was dissolved in DCM, TFA was added, the reaction was stirred, extracted, washed, and dried, and the obtained crude deprotected amine was dissolved in N,N-dimethylformamide, 3-(2,5-dimethyl-1H-pyrrol-1-yl)-2-thiophenecarboxylic acid methyl ester was added, DIPEA was added while stirring, and then HATU was added, the reaction was stirred, water was added, extraction, washing, drying, filtering and vacuum concentration were performed to obtain a crude product, and after separation and purification, an intermediate product 6 was obtained;

[0019] (8) The intermediate product 6 is dissolved in THF, and the prepared lithium hydroxide aqueous solution is placed in the mixture under ice bath conditions, and the reaction is stirred. After the mixture is neutralized, extraction, drying, filtering and vacuum concentration are performed to obtain a crude product. After separation and purification, a compound GATA transcription factor protein degradation targeted consortium compound is obtained.

[0020] The compound of the present invention and the pharmaceutically acceptable salt thereof are used in preparing a drug for degrading GATA transcription factors or a drug for treating abnormal GATA transcription factors.

[0021] Among them, the compound and its pharmaceutically acceptable salt are used in the preparation of a degradation agent for degrading GATA3 protein.

[0022] The invention relates to the use of the compound and the pharmaceutically acceptable salt thereof in the preparation of cancer treatment drugs.

[0023] Among them, the compound and its pharmaceutically acceptable salt are used in the preparation of drugs for treating breast cancer.

[0024] The GATA transcription factor protein degradation targeted consortium pharmaceutical composition of the present invention comprises the compound or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

[0025] Wherein, the pharmaceutical composition is a capsule, powder, tablet, granule, pill, injection, syrup, oral liquid, inhalant, ointment, suppository or patch.

[0026] The GATA transcription factor protein degradation targeting consortium compound (PROTAC: proteolysis-targeting chimeras) described in the present invention has a nanomolar binding ability to GATA transcription factors, has a significant effect on degrading GATA transcription factors, and has a significant effect on inhibiting tumor growth. It can be effectively used in the preparation of drugs for degrading GATA transcription factors, drugs for treating abnormal GATA transcription factors, and cancer treatment drugs.

[0027] Through specific design and screening, the present invention firstly realizes the synthesis of compounds that target the degradation of GATA, effectively breaking through the technical bottleneck of the prior art that transcription factors are undruggable drug targets. The present invention designs a new synthesis path for existing VHL ligands and newly discovered GATA ligands, as well as the synthesis and splicing of the three components of the final drug; synthesizes the first drug that targets the degradation of GATA transcription factors, and uses it in the treatment of breast cancer with significant results.

[0028] The compound of the present invention comprises three core component compounds, and the structures are shown in formula (II), formula (III), and formula (IV) respectively:

[0029] GATA protein binding compounds (II):

[0030] Linker(Ⅲ):

[0031] VHL ligand (Ⅳ):

[0032] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0033] 1. The present invention proposes and synthesizes for the first time a compound drug that targets and degrades GATA transcription factors. The compound has a very strong binding force with GATA3 and can be used to prepare drugs that degrade GATA transcription factors or drugs that treat abnormal GATA transcription factors. It can further treat diseases such as tumors caused by abnormal GATA transcription factors and has a very good effect.

[0034] 2. The present invention proposes a new synthesis route for VHL ligand and provides a new synthesis route for splicing three elements of transcription factor protein degradation targeting consortium compounds.

[0035] 3. Compared with the existing technologies of gene knockout and RNA interference to intervene in GATA transcription factor gene expression to achieve downregulation of GATA protein levels, the present invention provides compounds and a new technology that can directly knock down GATA protein levels.

[0036] 4. Compared with the single GATA ligand compound (Formula II), the synthetic GATA transcription factor protein degradation targeted consortium compound of the present invention has a target protein affinity increased by more than 10,000 times and a drug efficacy increased by 40 to 70 times; while the compound without GATA ligand has no activity.

[0037] 5. The compound of the present invention is cleverly designed, simple in structure, has cheap and readily available raw materials, a safe and environmentally friendly synthesis process, and is easy to mass produce. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is the NMR image of intermediate 1;

[0039] Figure 2 This is the NMR image of intermediate 2;

[0040] Figure 3 This is the NMR image of intermediate 3;

[0041] Figure 4 is the NMR image of intermediate 4;

[0042] Figure 5 is the NMR image of intermediate 5;

[0043] Figure 6 is a high-resolution image of reactant 1;

[0044] Figure 7 is a high-resolution image of intermediate 6;

[0045] Figure 8 is the NMR image of the GATA transcription factor protein degradation targeting complex compound (I);

[0046] Fig. 9 It is a graph of the MST experimental results of the binding ability of the GATA transcription factor protein degradation targeting complex compound formula (I) and the single GATA ligand Pyrrothigatain compound formula (II) to GATA3, and the binding ability is shown in the figure;

[0047] Fig.10 is the expression of GATA3 in each breast cancer;

[0048] Fig.11 This is a graph showing the degradation of GATA3 protein by GATA transcription factor protein degradation targeting consortium compounds in T47D and MCF7 cells;

[0049] Fig.12 is the graph of GATA3 protein recovery in T47D and MCF7 cells;

[0050] Fig.13 is a graph of the concentration of the GATA transcription factor protein degradation targeting complex compound that causes the half-lethality of T47D;

[0051] Fig.14 is the concentration graph of the GATA transcription factor protein degradation targeting complex compound that causes the half lethality of MCF7;

[0052] Fig.15 is a graph showing the ability of a GATA transcription factor protein degradation targeting complex compound to inhibit T47D cell proliferation;

[0053] Fig.16 is a graph showing the ability of GATA transcription factor protein degradation targeting consortium compounds to inhibit MCF7 cell proliferation;

[0054] Fig.17 This is a flow cytometry result diagram showing that the GATA transcription factor protein degradation targeting complex compound promotes apoptosis of T47D cells;

[0055] Fig.18 This is a flow cytometry result diagram showing that the GATA transcription factor protein degradation targeting complex compound promotes apoptosis of MCF7 cells;

[0056] Fig.19 This is a protein result diagram showing that the GATA transcription factor protein degradation targeting consortium compound promotes apoptosis of T47D and MCF7 cells;

[0057] Fig. 20 This is a graph showing the results of normal saline and GATA transcription factor protein degradation targeting consortium compounds inhibiting the growth of mouse mammary tumors;

[0058] Fig.21 Body weight changes of mice after treatment with normal saline and GATA transcription factor protein degradation targeting consortium compounds;

[0059] Fig. 22 These are the tumor volume and tumor weight graphs of mice after being stripped of normal saline and treated with GATA transcription factor protein degradation targeted consortium compounds.

[0060] In the above figures, Degrader refers to the GATA transcription factor protein degradation targeting consortium compound or directly shows the drug concentration. DETAILED DESCRIPTION

[0061] The present invention will be further described below in conjunction with specific embodiments.

[0062] The experimental methods described in the examples are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.

[0063] Example 1

[0064] Preparation of compound targeting GATA transcription factor protein degradation conjugate

[0065]

[0066] 1. Preparation of reactant 1

[0067]

[0068] (1) Under nitrogen protection, Et3SiH (3mmol) and TFA (2mmol) were slowly added dropwise to tert-butyl carbamate (3mmol) and 4-bromobenzaldehyde (1mmol). The solvent was DCM (2ml) and MeCN (6ml). The mixture was stirred at room temperature for 48 hours. Then, saturated NaHCO3 solution (2ml) was added to the mixture to quench the reaction. The reaction was extracted with DCM (3×5ml). The organic phase was washed with saturated brine (2ml) and dried with Na2SO4, filtered and concentrated in vacuo to obtain a crude product. After purification by column chromatography on silica gel (petroleum ether), intermediate 1 was obtained. The NMR results are as follows Figure 1 shown. 1 H NMR (400MHz, CDCl3) δ7.42(d,J=7.6Hz,2H),7.14(d,J=7.2Hz,2H),5.02(brs,1H),4.22(s,2H),1.43(s,9H). 13 C NMR (101MHz, CDCl3) δ155.8,138.0,131.5,129.0,121.0,79.6,43.9,28.3.

[0069] (2) Under nitrogen protection, the intermediate product 1 (1 mmol), 4-methylthiazole (2 mmol), Pd(OAc)2 (0.01 mmol), and K2CO3 (2 mmol) were dissolved in N,N-dimethylacetamide (1 mL), heated to 130°C in a nitrogen atmosphere, reacted for 4 h, cooled to room temperature, diluted with water (4 ml), extracted with DCM (3×5 ml), and the organic phase was washed with saturated brine (2 mL), dried over Na2SO4, filtered, and concentrated in vacuo to obtain a crude product. After purification by column chromatography on silica gel (petroleum ether), the intermediate product 2 was obtained. The NMR results are as follows Figure 2 shown. 1H NMR (400MHz, CDCl3) δ8.60(s,1H),7.36-7.29(m,4H),5.43(brs,1H),4.30(s,2H),2.47(s,3H),1.44(s,9H). 13 C NMR (101MHz, CDCl3) δ155.8,150.0,148.2,138.8,131.4,130.5,129.2,127.4,79.2,43.9,28.2,15.8.

[0070] (3) Under nitrogen protection, the intermediate product 2 (1 mmol) was dissolved in DCM (5 ml), TFA (5 ml) was added, and the mixture was stirred at room temperature for 2 h. TFA was removed by saturated NaHCO3 solution. The organic phase was extracted with DCM (3×5 ml), and then washed with saturated brine (2 ml) and dried over Na2SO4. The oily residue was further dried under high vacuum to obtain the crude product. The deprotected amine was dissolved in N,N-dimethylformamide (5 ml), boc-L-hydroxyproline (1 mmol) was added, DIPEA (4 mmol) was added while stirring, and HATU (1.1 mmol) was added after 5 min. The mixture was stirred at room temperature for 18 h, water (50 ml) was added, and the mixture was extracted with EtOAc (3×25 ml). The organic phase was then washed with saturated brine (10 ml), dried over Na2SO4, filtered, and concentrated in vacuo to obtain the crude product. After purification by column chromatography on silica gel (petroleum ether), the intermediate product 3 was obtained. The NMR results are as follows: Figure 3 shown. 1 H NMR (400MHz, d 6 -DMSO)δ8.91(s,1H),8.46-8.40(m,1H),7.36-7.29(m,4H),4.96(brs,1H),4.34-4.26(m,1H),4.21-4.08(m ,3H),3.40-3.36(m,1H),3.25-3.20(m,1H),2.37(s,3H),2.05-1.96(m,1H),1.82-1.76(m,1H),1.18(s,9H). 13 C NMR (101MHz,d 6 -DMSO) δ173.6,154.6,148.8,140.4,132.1,131.0,129.8,129.1,128.5,79.5,68.8,59.9,55.8,54.6,42.8,28.9,16.9.

[0071] (4) Under nitrogen protection, the intermediate product 3 (1 mmol), benzoyl chloride (1.5 mmol), and DMAP (1.1 mmol) were dissolved in DCM (15.3 ml). After adding TEA (5 mmol) at 0°C, the mixture was stirred for 30 min, warmed to room temperature and continued to stir for 5 h, H2O (4 ml) was added, and the organic phase was extracted with DCM (3×5 ml). The organic layer was then washed with saturated brine (2 mL), dried over Na2SO4, filtered, and concentrated in vacuo to obtain a crude product. After purification by column chromatography on silica gel (petroleum ether), the intermediate product 4 was obtained. The NMR results are as follows: Figure 4 shown. 1 H NMR (400MHz, CDCl3) δ8.69-8.65(m,1H),7.99-7.95(m,2H),7.58-7.53(m,1H),7.45-7.29(m,6H),5.51(s, 1H),4.54-4.36(m,3H),3.99-3.68(m,2H),2.51-2.49(m,3H),2.39(brs,1H),1.93(brs,1H),1.39(s,9H). 13 C NMR (101MHz, CDCl3) δ171.0,165.8,155.8,150.3,148.5,138.0,133.3,131.5,131. 0,129.6(2C),128.4,127.8,127.7,81.2,73.3,58.6,52.5,43.1,33.7,28.2,16.0.

[0072] (5) Under nitrogen protection, the intermediate product 4 (1 mmol) was dissolved in DCM (5 ml), TFA (5 ml) was added, and the mixture was stirred at room temperature for 2 h. TFA was removed by saturated NaHCO3 solution, and the organic phase was extracted with DCM (3×5 ml), and then washed with saturated brine (2 ml) and dried over Na2SO4. The oily residue was further dried under high vacuum to obtain the crude product. The deprotected amine was dissolved in N,N-dimethylformamide (5 ml), boc-L-tert-leucine (1 mmol) was added, DIPEA (4 mmol) was added while stirring, and HATU (1.1 mmol) was added after 5 min. The mixture was stirred at room temperature for 18 h, water (50 ml) was added, and the mixture was extracted with EtOAc (3×25 ml). The organic phase was then washed with saturated brine (10 ml), dried over Na2SO4, filtered, and concentrated in vacuo to obtain the crude product. After purification by column chromatography on silica gel (petroleum ether), the intermediate product 5 was obtained. The NMR results are as follows: Figure 5 shown. 1H NMR (400MHz, CDCl3) δ8.68 (s, 1H), 8.00 (d, J = 7.6Hz, 1H), 7.53 (t, J = 7.2Hz, 1H), 7.4 1-7.34(m,7H),7.29(t,J=5.2Hz,1H),5.59(s,1H),5.12(d,J=9.6Hz,1H),4.80(t,J =7.6Hz,1H),4.59(dd,J=14.8,6.8Hz,1H),4.37-4.20(m,3H),3.86(dd,J=11.6,4Hz ,1H),2.92-2.85(m,1H),2.51(s,3H),2.40-2.35(m,1H).1.28(s,9H),0.90(s,9H). 13 C NMR (101MHz, CDCl3) δ172.6,170.0,166.0,155.6,150.3,148.4,137.8,133.2,131.6,131.0,129 .7,129.6,128.3,128.2,79.6,73.5,58.8,58.3,53.8,43.4,35.1,33.0,28.1,26.3,25.3,16.0.

[0073] (6) Under nitrogen protection, the intermediate product 5 (1 mmol) was dissolved in DCM (5 ml), TFA (5 ml) was added, and the mixture was stirred at room temperature for 2 h. TFA was removed by saturated NaHCO3 solution. The organic phase was extracted with DCM (3×5 ml), and then washed with saturated brine (2 mL) and dried over Na2SO4. The oily residue was further dried under high vacuum to obtain the crude product. The deprotected amine was dissolved in N,N-dimethylformamide (5 ml), 2-[2-(tert-butoxycarbonylamino)ethoxy]ethoxyacetic acid (1 mmol) was added, DIPEA (4 mmol) was added while stirring, and HATU (1.1 mmol) was added after 5 min. The mixture was stirred at room temperature for 18 h, water (50 ml) was added, and the mixture was extracted with EtOAc (3×25 ml). The organic phase was then washed with saturated brine (10 ml), dried over Na2SO4, filtered, and concentrated in vacuo to obtain the crude product. The reaction product 1 was obtained after purification by column chromatography on silica gel (petroleum ether). HRMS(ESI)m / z:[M+H] + Calcd for C 40 H 53 N5O9S 779.36; Found 779.36, as Figure 6 shown.

[0074] 2. Preparation of compound targeting GATA transcription factor protein degradation consortium

[0075]

[0076] (compound GATA transcription factor protein

[0077] Albumin degradation targeting conjugate compound

[0078] (1) Under nitrogen protection, reactant 1 (1 mmol) was dissolved in DCM (5 ml), TFA (5 ml) was added, TFA was removed with saturated NaHCO3 solution, and the organic phase was extracted with DCM (3×5 ml), and then washed with saturated brine (2 ml) and dried with Na2SO4. The oily residue was further dried under high vacuum to obtain the crude product. The deprotected amine was dissolved in N,N-dimethylformamide (5 ml), 3-(2,5-dimethyl-1H-pyrrol-1-yl)-2-thiophenecarboxylic acid methyl ester (1 mmol) was added, DIPEA (4 mmol) was added while stirring, and HATU (1.1 mmol) was added after 5 minutes. The mixture was stirred at room temperature for 18 h, water (50 ml) was added, and the mixture was extracted with EtOAc (3×25 ml). The organic phase was washed with saturated brine (10 ml), dried with Na2SO4, filtered and concentrated in vacuo to obtain the crude product. After purification by column chromatography on silica gel (petroleum ether), the intermediate product 6 was obtained. HRMS(ESI)m / z:[M+H] + Calcdfor C 46 H 54 N6O8S2 882.34; Found 882.34, such as Figure 7 shown.

[0079] (2) Under nitrogen protection, the intermediate product 6 (1mmol) was dissolved in THF (5ml / mmol). At 0°C, the prepared lithium hydroxide aqueous solution was placed in the mixture, that is, lithium hydroxide (1.2mmol) was dissolved in water (1.25mmol), and stirred at 0°C for 8h. After the mixture was neutralized with 1mol / L HCl, the organic phase was extracted with EtOAc (3×5ml), and then the organic phase was dried with saturated Na2CO3 (2ml), saturated brine (2ml), and Na2SO4 in turn, filtered and concentrated in vacuo to obtain a crude product. After purification by column chromatography on silica gel (petroleum ether), the compound GATA transcription factor protein degradation targeting consortium compound was obtained. The NMR results are shown in the figure below. Figure 8 shown. 1H NMR (400MHz, CDCl3) δ8.67(s,1H),7.54(d,J=5.2Hz,1H),7.50(t,J=6.1Hz,1H),7.38- 7.28(m,5H),6.93(d,J=5.2Hz,1H),5.95(s,2H),5.25(brs,1H),4.69(t,J=8.0Hz,1H) ,4.59-4.49(m,3H),4.35(dd,J=14.8,5.2Hz,1H),4.04-3.91(m,3H),3.63-3.60(m,3H ),3.53-3.51(m,2H),3.45-3.32(m,4H),2.50(s,3H),2.13-1.95(m,8H).0.92(s,9H). 13 CNMR(101MHz, CDCl3)δ171.1,170.8,170.3,160.5,150.3,148.4,138.2,135.6,135.1,131.7,130.8,129.5,129.4, 128.4,128.3,128.2,107.6,71.2,70.4,70.1(2C),69.5,58.5,57.0,56.7,43.2,39.5,35.9,35.2,26.4,16.1,12.4.

[0080] Example 2

[0081] 1. Experimental Materials

[0082] 1.1 Cell lines

[0083] The cells used in the present invention are listed in the cell lines shown in Table 1:

[0084] Table 1 Cell lines

[0085]

[0086] 1.2 Experimental animals and feeding-related materials

[0087] The Balb / c mice used in the present invention were purchased from Jiangsu Huachuang Xinnuo Pharmaceutical Technology Co., Ltd., license number: SCXK (Su) 2020-0009; all experimental mice were kept in the SPF (specific pathogen free) grade laboratory room of the Animal Experiment Center of Nanjing Normal University. According to the feeding requirements, the breeding density of all experimental mice is less than or equal to 5 per cage, the breeding temperature is maintained in the range of 20-25°C, the humidity is maintained at around 50%, and the light is automatically controlled (12h light / 12h dark). The feed and bedding for mice were purchased from Qinglongshan Animal Breeding Farm in Jiangning District, Nanjing.

[0088] 1.3 Experimental Reagents

[0089] (1) The reagents used for cell culture are listed in Table 2 Cell culture reagents

[0090] Table 2 Cell culture reagents

[0091]

[0092]

[0093] (2) The reagents used in the biochemical experiments are listed in Table 3

[0094] Table 3 Biochemical and molecular reagents

[0095]

[0096] (3) The antibodies used in the present invention are listed in Table 4

[0097] Table 4 Antibodies

[0098]

[0099] 1.4 Experimental instruments

[0100] (1) Milli-Q ultrapure water system, Millipore, USA;

[0101] (2) UB-7 pH meter, Nanjing Henglian Biotechnology Co., Ltd.;

[0102] (3) 0.1-2.5 μL, 0.5-10 μL, 2-20 μL, 10-100 μL, 20-200 μL and 100-1000 μL pipettes, Eppendorf, Germany;

[0103] (4) XD-202 microscope, Nanjing Jiangnan Yongxin Optics Co., Ltd.;

[0104] (5) SW-CJ-IF clean bench, Suzhou Antai Air Technology Co., Ltd., Suzhou Group;

[0105] (6) Desktop refrigerated centrifuge, Eppendorf, Germany;

[0106] (7) DTH-100 metal bath, Nanjing Henglian Biotechnology Co., Ltd.;

[0107] (8) VOTTEX-2 vortex oscillator, Nanjing Henglian Biotechnology Co., Ltd.;

[0108] (9) HWS12 electric constant temperature water bath, Shanghai Yiheng Technology Co., Ltd.;

[0109] (10) Cell culture incubator, Thermo Fisher Scientific;

[0110] (11) StepOnePlusTM Real-Time PCR instrument, Bio-Rad, USA;

[0111] (12) Nanodrop 2000, Thermo Scientific, USA;

[0112] (13) BCD-328EDPT refrigerator, Qingdao Haier Co., Ltd.;

[0113] (14) BCD-539WT low temperature refrigerator, Qingdao Haier Co., Ltd.;

[0114] (15) DW-86L626 ultra-low temperature refrigerator, Qingdao Haier Co., Ltd.;

[0115] (16) Vernier caliper, Nanjing Suce measuring instrument;

[0116] (17) Monolith NT.115, Nanotemper Technology;

[0117] (18) VE-180 vertical electrophoresis tank, transfer electrophoresis tank, Shanghai Tianneng Technology Co., Ltd.;

[0118] (19) UV-2000 UV analyzer, Shanghai Tianneng Technology Co., Ltd.;

[0119] (20) HVE-50 high pressure sterilizer, HIRAYAMA, Japan

[0120] (21) Thermo Mixer F1.5 constant temperature mixer, Eppendorf, Germany;

[0121] (22) Leica DMI8 inverted fluorescence microscope, Beijing Zhongxian Hengye Instrument Co., Ltd.;

[0122] (23) Drying oven, Nanjing Henglian Biotechnology Co., Ltd.;

[0123] (24) MS-H280-pro magnetic stirrer, Shanghai Shengke Instrument Equipment Co., Ltd.;

[0124] (25) TY-80S decolorization shaker, Puyang Scientific Instrument Institute;

[0125] (26) Flow cytometer, BD Biosciences;

[0126] (27) Microwave ovens, Guangdong Galanz Group;

[0127] (28) DTH-100 metal bath, Nanjing Henglian Biotechnology Co., Ltd.;

[0128] (29) Scotsman Ice Machine, Scotsman Company;

[0129] (30) Fully automatic chemiluminescence spectrum analysis system, Shanghai Tianneng Technology Co., Ltd.

[0130] (31) 90° suction joint, vacuum dryer, splash-proof ball, thick-walled eggplant bottle for rotary evaporator, liquid addition funnel, flash chromatography column, chromatography cylinder, single-necked round-bottom ball bottle, oblique three-necked ball bottle, straight three-necked ball bottle, solvent storage bottle, separating funnel (PTFE joint), double-row vacuum gas distributor, Xinweier.

[0131] 1.5 Experimental consumables

[0132] (1) 10 μL, 100 μL, and 1000 μL common and DNase- / RNase-free tips, from Jiangsu Haimen Jiawei Glass Instrument Factory;

[0133] (2) 0.2 mL DNase- / RNase-free PCR tubes, 1.5 mL DNase- / RNase-free flat-cap centrifuge tubes, Axygen, USA;

[0134] (3) 1.5 mL and 2 mL ordinary centrifuge tubes, Jiangsu Haimen Jiawei Glass Instrument Factory;

[0135] (4) 2 mL external rotation cell cryopreservation tube, Corning;

[0136] (5) 100 mm and 60 mm cell culture dishes, Nanjing Shanqingbo Biotechnology Co., Ltd. (SORFA);

[0137] (6) 10 mL and 50 mL pipettes, Nanjing Shanqingbo Biotechnology Co., Ltd. (SORFA);

[0138] (7) Disposable PE gloves, Jiangsu Haimen Jiawei Glass Instrument Factory;

[0139] (8) Disposable dust-free latex gloves, Jiangsu Haimen Jiawei Glass Instrument Factory;

[0140] (9) Capillary, Nanotemper Technologies;

[0141] (10) 15 mL, 50 mL centrifuge tubes, 6-well plates, 12-well plates, 24-well plates, 96-well plates, cell culture dishes, Guangzhou Jiete Biofiltration Co., Ltd.;

[0142] (11) 0.22 μm and 0.45 μm disposable filters and PVDF membranes, Millipore, USA;

[0143] (12) BRAUN surgical needles and syringes, Nanjing Boqiao Biological Co., Ltd.;

[0144] (13) Experimental filter paper, Xi’an Dingyu Filter Material Co., Ltd.

[0145] 2. Experimental methods

[0146] 2.1 Cell culture

[0147] 4T1 mouse breast cancer cells, T47D human breast cancer cells, and MCF7 human breast cancer cells were cultured in 1640 medium supplemented with 10% serum and 1% penicillin / streptomycin in a cell culture incubator at 37° C. containing 5% CO 2 .

[0148] 293T human kidney embryonic cells were cultured in DMEM medium supplemented with 10% serum and 1% penicillin / streptomycin in a cell culture incubator at 37°C containing 5% CO2.

[0149] 2.2 Construction of stable cell lines of lentiviral system

[0150] (1) Construct the pCDH-GFP-Puro-GATA3-WT eukaryotic expression plasmid.

[0151] 1) Primer design, synthesis and sequencing

[0152] Primers were designed according to the specific gene sequence numbers on the NCBI website, and primer sequences were blasted on the NCBI website to ensure template specificity. Primer synthesis and sequencing services were provided by Suzhou Genewise Biotechnology Co., Ltd. and Nanjing Qingke Biotechnology Co., Ltd.

[0153] Primer sequences:

[0154] Forward: 5'TA GCTAGC ATG TAC CCA TAC GAC GTC CCA GAC TAC GCTATGGAGGTGACGGCGGACCAGCCG 3'

[0155] Reverse: 5'T GCGGCCGC CTA ACCCATGGCGGTGACCATGCT 3'

[0156] Using GATA3 WT plasmid as template, set up the PCR program according to the following system:

[0157] PCR reaction system

[0158]

[0159] PCR reaction procedure

[0160]

[0161] 2) Take the PCR recovery product and the target vector (pCDH-CMV-MCS-EF1-GFP-Puro vector, Ubao Bio VT8070) for restriction digestion reaction. According to the restriction digestion system, the PCR recovery product and the target vector are mixed in EP tubes respectively, and placed in a 37°C constant temperature incubator. After 1-2 hours of restriction digestion, DNA gel electrophoresis is performed and purified using the Axgen gel recovery kit.

[0162] Enzyme digestion system

[0163]

[0164] 3) Take the purified target DNA fragment and vector, mix them in an EP tube according to the ligation system, and transform the ligation product into DH5α competent cells after ligation at room temperature for 2 hours.

[0165] Connection system

[0166]

[0167] 4) After transformation, the cells were cultured, plasmids were extracted using a plasmid extraction kit, and plasmids were collected for sequencing and identification. The plasmids with correct sequencing were transformed, expanded, and the plasmids were extracted for standby use to obtain the target plasmid pCDH-GFP-Puro-GATA3-WT.

[0168] (2) HEK-293T cells were cultured in a 10 cm culture dish. When the cells grew to 70-90%, the constructed pCDH-GFP-Puro-GATA3-WT target plasmid and the pMDLg / pRRE, pRSV-Rev, and VSVG packaging plasmids purchased from Ubest Biotech were transferred into 293T cells.

[0169] (3) 48 hours after transfection, collect the supernatant virus solution and filter it with a 0.45 μm filter membrane (it can be stored at -80°C for future use).

[0170] (4) The cells to be infected are plated into a 6-well plate or a 10 cm culture dish. When the cell density reaches 30%-40%, the original culture medium is discarded and replaced with fresh culture medium and concentrated virus solution. At the same time, PB is added at a dilution of 1:1000-1:1500 and the cells are placed in an incubator for further culture.

[0171] (5) 24 hours after infection, the medium was changed and appropriate concentrations of puromycin were added to select surviving cells according to the cell types. The cells were cultured continuously until a cell line that could be stably subcultured was selected, namely, 4T1 mouse breast cancer cells that stably and highly expressed GATA3 (4T1-GATA3-WT cells).

[0172] 2.3 Western blotting

[0173] 2.3.1 Protein extraction (operation on ice)

[0174] (1) Take out the cultured cells from the incubator, discard the culture medium and wash with PBS. After the cells are digested with trypsin at 37°C, the digestion process is terminated with complete culture medium and transferred to a 1.5 mL centrifuge tube. Centrifuge at 1000g for 5 minutes, discard the supernatant, and collect the cell pellet. Wash the cell pellet with PBS for later use;

[0175] (2) Prepare RIPA lysis buffer with PMSF at a concentration of 1 mg / ml, resuspend the cell pellet, and place on ice for 15 min.

[0176] (3) After lysis, centrifuge at 4°C and 13,000 rpm for 10 min. Transfer the supernatant to a new 1.5 mL centrifuge tube, add an appropriate amount of 5× Loading buffer, mix well, place on a metal bath, and cook at 95°C for 15 min. After cooking, centrifuge for 5 min and store at -20°C for later use.

[0177] 2.3.2 SDS-PAGE gel electrophoresis

[0178] The formula of separation gel and concentration gel is shown in Table 5:

[0179] Table 5 Separation gel and concentration gel formula

[0180]

[0181] (1) Select separation gels of different concentrations according to the size of the protein to be detected;

[0182] (2) Prepare an appropriate SDS-PAGE separation gel according to Table 5, mix well and inject it between two clean glass plates with a side strip thickness of 1.0 mm, add a thin layer of isopropanol on it, and let it stand at room temperature for 30 min;

[0183] (3) After the lower layer of gel is completely solidified, pour out the upper layer of isopropanol, place the mixture upside down in a 37°C oven for 5 min, slowly add concentrated gel, insert the sample comb, and let stand at room temperature for 30 min;

[0184] (4) Prepare 1× SDS running buffer, fix the gel on the electrophoresis device, pour the electrophoresis buffer into the upper and lower tanks, carefully remove the sample comb, and check whether the sample wells are vertical;

[0185] (5) Take out the unused protein sample from the -20°C refrigerator, boil it at 95°C for 5 min on a metal bath, and centrifuge it at 12000 rpm for 5 min;

[0186] (6) Turn on the power of the gel electrophoresis instrument and adjust the voltage to 120V. After the protein sample is pressed into a line on the concentrated gel, adjust the voltage to 180V and continue electrophoresis. After the electrophoresis is completed, take out the gel, pre-cooled transfer buffer, four filter papers of the same size as the gel plate, and a PVDF membrane of the same size as the gel and activated in methanol from the glass plate. Lay out and clamp the black side of the transfer clamp, sponge pad, two layers of filter paper, gel, PVDF membrane, two layers of filter paper, sponge pad, and transparent side of the transfer clamp in this order (do not allow bubbles to be generated during this process);

[0187] (7) Place the transfer plate into the transfer tank in the positive and negative directions, fill it with pre-cooled transfer solution, and place the entire transfer electrophoresis tank into a foam box mixed with ice and water, connect the power supply, constant current 200 mA, 2h;

[0188] (8) After the transfer, the PVDF membrane was rinsed twice with TBST solution and then immersed in 5% skim milk or 5% BSA for blocking, and shaken slowly on a shaker at room temperature for 1 h;

[0189] (9) After blocking, rinse the PVDF membrane three times with TBST to remove the residual blocking solution. Cut the PVDF membrane of appropriate width according to the size of the protein marker and target protein band, and incubate the primary antibody slowly overnight at 4°C on a shaker;

[0190] (10) The next day, take out the PVDF membrane and place it in a membrane washing box. Rinse it with TBST 5 times, 3 min each time. Transfer the washed PVDF membrane to the corresponding secondary antibody prepared in proportion and incubate at room temperature for 1 h.

[0191] (11) Continue to wash the PVDF membrane in the membrane washing box with TBST for 5 times, each time for 3 min;

[0192] (12) Development. According to the size of the PVDF membrane, mix the two color developing substrates in equal volumes of 1:1 to prepare an appropriate amount of ECL luminescent solution. First, dry the PBST on the PVDF membrane, add the luminescent solution, and then place it in the fully automatic chemiluminescence spectrum analysis system for detection.

[0193] 2.4IC 50 Detection

[0194] (1) Take cells in good growth state, digest them into single cells with 0.25% trypsin, count them with a hemocytometer, place the cells in a 96-well plate at a number of 3000 cells / well, and culture them in a cell culture incubator at 37°C and 5% CO2;

[0195] (2) After the cells are completely attached and expanded, the experimental group is treated with drugs at different concentrations, and the control group is treated in equal proportions according to the drug volume of the experimental group, with 3 replicate wells set up for each group;

[0196] (3) After 48 hours, according to the needs, mix the complete medium and CCK-8 reagent in a ratio of 9:1, discard the medium in the wells, add 100 μL of the mixture to each well, and continue to culture in the incubator for 2 hours. After the incubation, transfer the mixture into a new 96-well plate in order (be careful not to generate bubbles in the wells to avoid affecting the OD value), and measure the absorbance at 450 nm with a microplate reader;

[0197] (4) Cellular IC 50 =(A value of the experimental group - A value of the zero-adjustment group) / (A value of the control group - A value of the zero-adjustment group)*100%. The above experiment was repeated three times and the average value was taken.

[0198] 2.5 Cell proliferation

[0199] (1) Cells in logarithmic growth phase were obtained and digested with 0.25% trypsin to prepare a single cell suspension. The cells were counted using a hemocytometer and placed in a 96-well plate at a number of 1500 cells / well and cultured in a cell culture incubator at 37°C and 5% CO2;

[0200] (2) The next day, the cells that were completely attached and stretched were treated with concentration gradients or without drug addition. Three replicate wells were set up in each group, and the mixed solution was added to the corresponding well plate at a volume of 100 μL per well. The cells were cultured in the incubator for another 2 h, and the absorbance at 450 nm was measured using an ELISA reader. The detected value at this time was the absorbance on day 0.

[0201] (3) After that, taking day 0 as the reference, discard the old culture medium in the 96-wells every 24 hours, add 100 μL of the prepared CCK-8 working solution to each well, place the well in the incubator and continue culturing for 2 hours. Measure the absorbance of the cells at 450 nm every day thereafter using an ELISA reader.

[0202] 2.6 Cell apoptosis detection

[0203] MCF7 and T47D cells were plated in 10 cm cell dishes. When the cell density reached about 70%, different concentrations of GATA transcription factor protein degradation targeting consortium compounds and corresponding volumes of DMSO were added as negative controls for 24 h. The cells in the 10 cm dish were carefully collected into centrifuge tubes. After washing with PBS, the cells were digested with trypsin without EDTA. When the cells can be gently blown down with a pipette or gun tip, all the attached cells were slowly blown down. Centrifuge at about 1000 rpm for 5 min to precipitate the cells. Resuspend the cells in PBS precooled at 4 ° C, centrifuge the precipitated cells again, and carefully remove the supernatant. Set up the negative control group cells, that is, do not add Annexin V / FITC and propidium iodide solution (PI), which is used to adjust the voltage of the single staining tube. Add Annexin V / FITC and PI alone as the positive control group, which is used to adjust the compensation detection tube. Dilute 10×Binding Buffer to 1× with deionized water at a ratio of 1:9. After resuspending the cells, adjust its concentration to 1-5×10 6 / ml, add 5μl Annexin V / FITC, mix well and incubate at room temperature in the dark for 5 minutes, add 5μl propidium iodide solution (PI) again, add PBS to the flow tube, and perform flow cytometry detection immediately.

[0204] 2.7 Mouse tumor model and drug administration

[0205] Construction of breast cancer cells stably expressing GATA3 (i.e., 4T1-GATA3-WT cells) by homologous transplantation lentiviral system in mouse model: 4-5 week-old Balb / c female mice were purchased from commercial sources and marked by toe clipping. 1×10 5 4T1-GATA3-WT cells. After tumor formation (volume is about 100mm 3 ), GATA transcription factor protein degradation targeting consortium compound was dissolved in 20% β-cyclodextrin, and the tumor was treated by tail vein administration at a single dose of 25 mg / kg / mouse and 50 mg / kg / mouse once every two days, and normal saline was used as a control. During the experiment, the GATA transcription factor protein degradation targeting consortium compound was monitored for signs of toxicity to the animals.

[0206] 2.8 Evaluation of the activity of experimental compounds in mouse tumor models

[0207] Change the bedding, mouse food and drinking water for mice 1-2 times a week. Starting from the injection of 4T1-GATA3-WT cells, palpate each mouse every 3 days to check whether the mouse breast has a nodular touch, that is, a mammary tumor. Record the time when the mammary tumor begins to be touched, and weigh and record the length and width of the mouse tumor every 2 days. According to the formula, tumor volume = (length × width2 ) / 2 Calculate and record the tumor volume of each mouse. The length and width of the tumor were measured using a vernier caliper. 3 Afterwards, the tumor-bearing mice were randomly assigned and injected with saline and different concentration gradient drugs, i.e. 25 mg / kg / mouse and 50 mg / kg / mouse, by tail vein administration. 3 All mice in the experimental and control groups were euthanized. At the same time, the breast tumor tissues of tumor-bearing mice were washed with PBS, wiped clean with absorbent paper, wrapped with tin foil, marked with mouse number, treatment method and date, and stored at -80 degrees.

[0208] 2.9 Protein expression and microscale thermophoresis (MST)

[0209] GATA3 was cloned into the pEGFP-N2-Vector vector (Ubao Bio VT1111) and transfected into 293T to overexpress the GATA3 protein fused with EGFP. After 48 hours of transfection, the cell mass was collected, the cells were lysed on ice to extract the protein, and the protein concentration was determined by the Coomassie Brilliant Blue method. The fluorescence intensity of the GATA3 protein after fusion with EGFP was pre-detected using Monolith NT.115 software, and the protein concentration was diluted to an appropriate level in PBST according to the detected fluorescence intensity. The EGFP-labeled protein was mixed with 16 different series of unlabeled compounds of the same volume at room temperature and incubated at room temperature. After 5 minutes, the sample was loaded into a capillary tube, and the binding affinity of GATA3 and the compound was directly detected and calculated at 25°C. The Kd value was analyzed using MO.Affinity Analysisv.2.3 software.

[0210] 3. Experimental results

[0211] 3.1 The in vitro binding ability of the GATA transcription factor protein degradation targeting consortium compound to the GATA3 protein was identified using the above-mentioned protein expression and microthermophoresis MST method.

[0212] The full-length GATA3 gene was constructed on the pEGFP-N2-Vector vector, and 293T cells highly expressed the GATA3 protein fused with EGFP. After the cells were lysed and the supernatant was taken, the protein concentration was adjusted to an appropriate level with PBST according to the fluorescence intensity of the fusion protein expression. The binding force of the unlabeled GATA transcription factor protein degradation targeting complex compound with the EGFP-labeled GATA3 protein in vitro was detected by microfluidics (MST). Fig. 9As shown in the figure, the binding force between the two reaches the nanomolar level, indicating that the binding force between the GATA transcription factor protein degradation targeting consortium compound and GATA3 is relatively strong. At the same time, the binding force of the GATA3 ligand shown in Formula II with the EGFP-labeled GATA3 protein in vitro is at the millimolar level as a control. The binding force of the compound of the present invention is more than 30,000 times higher than that of the GATA3 ligand ( Fig. 9 ).

[0213] 3.2GATA transcription factor protein degradation targeting consortium compound is a GATA3 degrader that effectively degrades GATA3 protein using the above-mentioned protein blotting method.

[0214] Using breast cancer cell lines, the expression of GATA3 in various cells was detected at the protein level, such as Fig.10 As shown in the figure, GATA3 expression levels in BT474, T47D, and MCF7 are high. Among them, T47D and BT474 have the same GATA3 expression pattern, so only T47D and MCF7 were selected as model cells for subsequent verification. After T47D and MCF7 cells were treated with DMSO and GATA transcription factor protein degradation targeting consortium compounds with different concentration gradients for 24 hours, the cell pellets were collected and the protein supernatant was extracted after lysis. After the protein concentration was determined, the protein content of GATA3 in the cells was detected. The results are shown in the figure. Fig.11 As shown. With the increase of drug concentration, the ability of GATA transcription factor protein degradation targeted consortium compounds to degrade GATA3 protein also increased, indicating that the degradation activity of GATA transcription factor protein degradation targeted consortium compounds depends on the concentration of the drug. In addition, the principle of GATA transcription factor protein degradation targeted consortium compounds to inhibit GATA3 is based on the intracellular ubiquitination proteasome degradation pathway. Therefore, the addition of proteasome inhibitor MG132 can also restore the degradation of GATA3 by GATA transcription factor protein degradation targeted consortium compounds, such as Fig.12 shown.

[0215] 3.3GATA transcription factor protein degradation targeting consortium compounds significantly improved the efficacy of anti-breast cancer in vitro. 50 Methods for detection, cell proliferation, and cell apoptosis.

[0216] The killing ability of GATA transcription factor protein degradation targeting consortium compounds treated with different concentrations on MCF7 and T47D was detected, in which Pyrrothigatain and Tamoxifen were used as negative and positive controls respectively. Figure 13-14As shown, compared with the ligand Pyrrothigatain that only binds to GATA3 shown in Formula II, the GATA transcription factor protein degradation targeted consortium compound has a significant killing ability against the two types of cancer cells, and its efficacy is increased by 40 to 70 times. The killing performance of the GATA transcription factor protein degradation targeted consortium compound in MCF7 is comparable to classic drugs such as Tamoxifen for the treatment of ER-positive breast cancer, while the effect of the GATA transcription factor protein degradation targeted consortium compound in T47D is even higher than that of Tamoxifen. The above results indicate that the GATA transcription factor protein degradation targeted consortium compound can directly kill the two types of cancer cells, MCF7 and T47D. Next, the effects of the GATA transcription factor protein degradation targeted consortium compounds with different concentration gradients on the proliferation and apoptosis abilities of MCF7 and T47D were detected, and the results are shown in the figure. Figure 15-19 The results showed that the GATA transcription factor protein degradation targeted consortium compound significantly inhibited the proliferation ability of MCF7 and T47D and promoted cell apoptosis, and the therapeutic effect depended on the concentration of the GATA transcription factor protein degradation targeted consortium compound.

[0217] 3.4 Effects of GATA transcription factor protein degradation targeting consortium compounds on mouse breast tumor growth

[0218] A certain number of 4T1 mouse breast cancer cells (4T1-GATA3-WT cells) that stably and highly express GATA3 were injected into the fat pad of Balb / c mice to construct a homologous transplant tumor model. 3 Afterwards, the mice were randomly assigned and injected with 25 mg / kg / mouse and 50 mg / kg / mouse of the GATA transcription factor protein degradation targeted consortium compound via tail vein administration every two days, and the weight of each mouse was recorded. Among them, physiological saline was used as a control. Figure 20-21 The results showed that compared with normal saline, the tumor volume of mice in the low-concentration and high-concentration groups was significantly inhibited compared with the control group without obvious toxic side effects. Among them, the therapeutic effect of the tumor volume of mice in the high-concentration group was significantly higher than that of the low-concentration group. When the tumor volume of mice in the control group grew to 1500cm 3 At about 1:10 pm, all mice in the experimental group and the control group were euthanized. At the same time, the breast tumor tissues of the tumor-bearing mice were removed and weighed, and the volume of the tumor after removal was recorded with a vernier caliper. The results are shown in Fig. 22 The above results all indicate that the GATA transcription factor protein degradation targeting consortium compound significantly inhibits mouse tumor growth and can be used to prepare drugs for the treatment of breast cancer.

Claims

1. A GATA transcription factor protein degradation targeting consortium compound and a pharmaceutically acceptable salt thereof, characterized in that: The structure of the compound is shown in formula (I):

2. A method for preparing the GATA transcription factor protein degradation targeted consortium compound and a pharmaceutically acceptable salt thereof according to claim 1, characterized in that: The reaction process is as follows:

3. The preparation method according to claim 2, characterized in that: The preparation method comprises the following steps: (1) slowly adding Et3SiH and TFA to tert-butyl carbamate and 4-bromobenzaldehyde in a solvent, stirring the reaction, quenching the reaction, extracting, washing, drying, filtering, and vacuum concentrating to obtain a crude product, which is separated and purified to obtain an intermediate 1; (2) Dissolving the intermediate product 1, 4-methylthiazole, Pd(OAc)2, and K2CO3 in N,N-dimethylacetamide, heating for reaction, cooling to room temperature, diluting, extracting, washing, drying, filtering, and vacuum concentrating to obtain a crude product, which is separated and purified to obtain the intermediate product 2; (3) The intermediate product 2 is dissolved in DCM, TFA is added, and the mixture is stirred for reaction, extracted, washed, and dried. The obtained crude deprotected amine is dissolved in N,N-dimethylformamide, boc-L-hydroxyproline is added, DIPEA is added while stirring, and then HATU is added. After stirring for reaction, water is added, the mixture is extracted, washed, and dried, and the mixture is filtered and concentrated in vacuo to obtain a crude product. After separation and purification, the intermediate product 3 is obtained. (4) The intermediate product 3, benzoyl chloride and DMAP were dissolved in DCM, TEA was added under ice bath conditions, the reaction was stirred, H2O was added, extraction was performed, washing was performed, drying was performed, filtration was performed, and vacuum concentration was performed to obtain a crude product, which was separated and purified to obtain the intermediate product 4; (5) The intermediate product 4 is dissolved in DCM, TFA is added, the reaction is stirred, extracted, washed, and dried, and the obtained crude deprotected amine is dissolved in N,N-dimethylformamide, boc-L-tert-leucine is added, DIPEA is added while stirring, and then HATU is added. After stirring, water is added, extraction, washing, drying, filtering, and vacuum concentration are performed to obtain a crude product, which is separated and purified to obtain an intermediate product 5; (6) The intermediate product 5 is dissolved in DCM, TFA is added, the reaction is stirred, extracted, washed, and dried, and the obtained crude deprotected amine is dissolved in N,N-dimethylformamide, 2-[2-(tert-butoxycarbonylamino)ethoxy]ethoxyacetic acid is added, DIPEA is added while stirring, and then HATU is added, the reaction is stirred, water is added, extraction, washing, drying, filtering, and vacuum concentration are performed to obtain a crude product, which is separated and purified to obtain the reactant 1; (7) The reactant 1 was dissolved in DCM, TFA was added, the reaction was stirred, extracted, washed, and dried, and the obtained crude deprotected amine was dissolved in N,N-dimethylformamide, 3-(2,5-dimethyl-1H-pyrrol-1-yl)-2-thiophenecarboxylic acid methyl ester was added, DIPEA was added while stirring, and then HATU was added, the reaction was stirred, water was added, extraction, washing, drying, filtering and vacuum concentration were performed to obtain a crude product, and after separation and purification, an intermediate product 6 was obtained; (8) The intermediate product 6 is dissolved in THF, and the prepared lithium hydroxide aqueous solution is placed in the mixture under ice bath conditions, and the reaction is stirred. After the mixture is neutralized, extraction, drying, filtering and vacuum concentration are performed to obtain a crude product. After separation and purification, a compound GATA transcription factor protein degradation targeted consortium compound is obtained.

4. Use of the compound according to claim 1 and a pharmaceutically acceptable salt thereof in the preparation of a degradation agent for degrading GATA3 protein.

5. Use of the compound according to claim 1 and a pharmaceutically acceptable salt thereof in the preparation of a drug for treating breast cancer.

6. A GATA transcription factor protein degradation targeted consortium pharmaceutical composition, characterized in that: The invention comprises the compound according to claim 1 or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

7. The pharmaceutical composition according to claim 6, characterized in that The pharmaceutical composition is in the form of capsules, powders, tablets, granules, pills, injections, syrups, oral liquids, inhalants, ointments, suppositories or patches.

Images