A method for preparing fluorine-containing Fe3O4 nanoassemblies and their application in intracellular protein delivery.

By preparing fluorine-containing Fe3O4 nanoassemblies, the hydrophobicity and electrostatic interaction of fluoroalkyl chains with proteins are utilized to solve the problems of low intracellular protein delivery efficiency and high cytotoxicity, thus achieving efficient and safe protein delivery.

CN117658226BActive Publication Date: 2026-05-29CHINA PHARM UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA PHARM UNIV
Filing Date
2023-12-07
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing intracellular protein delivery methods suffer from low efficiency, poor universality, and high cytotoxicity, especially the insufficient endosome escape ability of Fe3O4 nanoparticles and low protein loading efficiency.

Method used

A method for preparing fluorine-containing Fe3O4 nanoassemblies was adopted. Fe3O4 nanoparticles were synthesized by heating a mixture of iron acetylacetone, oleylamine, and oleic acid. These nanoparticles were then combined with fluorine-containing small molecule ligands to form fluoroalkyl-modified Fe3O4 nanoparticles. The hydrophobicity and electrostatic interaction of the fluoroalkyl chains were utilized to self-assemble with proteins, forming nanoassemblies and achieving efficient protein delivery.

Benefits of technology

It improves the universality and efficiency of intracellular protein delivery, reduces cytotoxicity, enables stable delivery of proteins with different molecular weights and isoelectric points, and further improves delivery efficiency through magnetic guidance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117658226B_ABST
    Figure CN117658226B_ABST
Patent Text Reader

Abstract

The application discloses a preparation method of fluorine-containing Fe3O4 nano-assemblies and application of the fluorine-containing Fe3O4 nano-assemblies in intracellular protein delivery, and the preparation method comprises the following steps: preparing Fe3O4 nanoparticles and small-molecule ligands containing fluorine alkyl chains respectively, and the two are combined through ligand exchange reaction to form fluorine-containing Fe3O4 nanoparticles; the fluorine-containing Fe3O4 nanoparticles can be self-assembled with proteins to form stable complexes through the hydrophobic effect and electrostatic effect of the fluorine alkyl chains. The fluorine-containing Fe3O4 assemblies provided by the application have universality as intracellular protein delivery carriers, can effectively deliver proteins with different isoelectric points and molecular weights to tumor cells, do not affect the biological activity of the cargo proteins, have small toxicity to cells, and have good biocompatibility. The protein delivery efficiency of the assemblies is further improved under the guidance of an external magnetic field, so that the killing effect of therapeutic proteins on tumor cells is enhanced, and the assemblies have application potential in the field of tumor treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of nanomaterial preparation and biomedicine, and particularly to a method for preparing fluorine-containing Fe3O4 nanoassemblies and their application in intracellular protein delivery. Background Technology

[0002] Proteins play a crucial role in maintaining cellular function, and many diseases are caused by protein dysfunction. Therefore, protein drugs have great potential for disease treatment. However, proteins are characterized by their large molecular weight and hydrophilicity, making it difficult for them to cross the cell membrane and enter the cell directly. Therefore, designing efficient, safe, and universally applicable intracellular protein delivery methods is an urgent problem to be solved.

[0003] Currently, commonly used intracellular protein delivery methods can be divided into three categories: physical / mechanical methods, protein covalent modification, and protein nanocarriers. Physical / mechanical methods are highly efficient and versatile for intracellular protein delivery; however, these methods are invasive, as the external force creates pores and transient changes in cell permeability, which, in addition to delivering the cargo protein into the cell, can also introduce other biomolecules. Methods that covalently modify proteins using cell-penetrating peptides or small molecules do not require additional delivery carriers, but in most cases, the modified protein is trapped in the endosome and cannot escape into the cytoplasm. In recent years, protein delivery methods based on nanocarriers have developed rapidly, commonly using liposomes, inorganic nanoparticles (such as gold nanoparticles, silica nanoparticles, and magnetic nanoparticles), polymers, and metal-organic frameworks (MOFs). Magnetic nanoparticles, due to their advantages such as biodegradability, controllable size, ease of surface functionalization, and unique magnetic properties, have been widely used in biomedicine, including magnetic resonance imaging, cancer treatment, tissue engineering, drug and gene delivery. Especially, Fe3O4 nanoparticles, possessing superparamagnetic properties, can be guided to specific tissues by applying an external magnetic field, thus avoiding side effects on other tissues to some extent. Although Fe3O4 nanoparticles have unique advantages as protein delivery carriers in terms of targeting ability, cytotoxicity, and cellular uptake, like other inorganic nanoparticles, insufficient endosome escape ability and low protein loading efficiency remain the biggest obstacles to their application. In recent years, studies have shown that modifying fluoroalkyl chains can help cationic polymers improve complex stability, endocytosis, and endosome escape in multiple aspects. Furthermore, fluoroalkyl chains exhibit excellent self-assembly properties in aqueous solutions, allowing both hydrophilic and hydrophobic substances to be encapsulated in nanostructures, making fluorinated polymers universally applicable as drug carriers. However, fluorinated polymers often present significant toxicity problems due to their large molecular weight. Summary of the Invention

[0004] Purpose of the invention: To address the problems of difficulty in maintaining protein structure and function and lack of universality in intracellular delivery in existing technologies, this invention provides a method for preparing fluorine-containing Fe3O4 nanoassemblies, which can improve the universality and efficiency of carriers in intracellular protein delivery.

[0005] This invention provides a method for preparing fluorine-containing Fe3O4 nanoassemblies and the application of the prepared nanoassemblies in intracellular protein delivery.

[0006] The present invention also provides a method for preparing fluorine-containing Fe3O4 nanoassemblies and the application of the prepared nanoassemblies in the preparation of drugs for treating tumors.

[0007] Technical solution: To achieve the above objectives, this invention provides a method for preparing fluorine-containing Fe3O4 nano-assemblies, comprising the following steps:

[0008] (1) Using acetylacetone iron as a precursor, Fe3O4 nanoparticles coated with oleylamine and oleic acid were synthesized by heating under an inert atmosphere after being mixed with oleylamine and oleic acid.

[0009] (2) Synthesis of fluorine-containing small molecule ligands;

[0010] (3) After refluxing the dopamine hydrochloride and the small molecule ligand prepared in step (2), the reaction solution is added to the solution of Fe3O4 nanoparticles coated with oleylamine and oleic acid to form fluorine-containing Fe3O4 nanoparticles.

[0011] (4) Take the fluorine-containing Fe3O4 nanoparticles prepared in step (3) and mix them with the protein solution, shake, centrifuge, and precipitate redissolve to obtain the fluorine-containing Fe3O4 nano-assemblies.

[0012] In step (1), the heating temperature is raised to 100-120°C and held for 60-90 minutes, then the temperature is raised to 250-350°C and reacted for 30-60 minutes before being cooled to room temperature.

[0013] The Fe3O4 nanoparticles prepared in step (1) have a particle size of approximately 8–10 nm.

[0014] The synthesis method of compound 3 in step (2) is as follows: first, dopamine hydrochloride, tert-butyldimethylchlorosilane, imidazole, and 4-dimethylaminopyridine are stirred and reacted under inert gas protection. After separation and purification, compound 1 is obtained. After redissolving in tetrahydrofuran, 3-(perfluorohexyl)epoxypropane is added dropwise. After stirring and reacting, compound 2 is obtained. Finally, compound 2 and tetrabutylammonium fluoride are redissolved in tetrahydrofuran, stirred and reacted, and then separated and purified to obtain compound 3, which is a fluorine-containing small molecule ligand.

[0015] In this process, the Fe3O4 nanoparticles prepared in step (1) are combined with dopamine and the synthetic fluorine-containing small molecule ligands prepared in step (2) through ligand exchange to form fluorine-containing Fe3O4 nanoparticles. The specific method for synthesizing the fluorine-containing Fe3O4 nanoparticles in step (3) is as follows: Dopamine hydrochloride and the small molecule ligands prepared in step (2) are dissolved in methanol, refluxed, heated, and Fe3O4 nanoparticles redissolved in chloroform are injected into the mixture. After cooling and centrifugation, the resulting precipitate is redissolved in water and ultrasonically dispersed to obtain fluorine-containing Fe3O4 nano-assemblies.

[0016] In step (3), the mass ratio of dopamine hydrochloride to compound 3 is 3:1 to 2.

[0017] In step (4), the mass ratio of protein to fluorine-containing Fe3O4 nanoparticles is 1:2 to 3, and the protein is any one of bovine serum albumin (BSA), β-galactosidase (β-Gal), ribonuclease (RNase A), saponin, or gasdermin A3 protein (GSDMA3).

[0018] Preferably, the present invention provides a method for preparing a fluorine-containing Fe3O4 nano-assembly, comprising the following steps:

[0019] (1) Synthesis of Fe3O4 nanoparticles: Iron acetylacetone was mixed with oleylamine and oleic acid and heated to 120°C in an inert gas and kept at that temperature for 60-90 min. The temperature was then increased to 300°C and reacted for 30-60 min. After cooling to room temperature, the nanoparticles were precipitated with a polar solvent, centrifuged, and the supernatant was removed to obtain Fe3O4 nanoparticles coated with oleylamine and oleic acid.

[0020] (2) Synthesis of fluorine-containing small molecules: Dopamine hydrochloride (DPA), tert-butyldimethylchlorosilane (TBSCl), imidazole, and 4-dimethylaminopyridine (DMAP) were dissolved in anhydrous tetrahydrofuran (THF) and reacted at room temperature for 4 h under inert gas protection. After removing the reaction solvent by rotary evaporation, the product was redissolved in dichloromethane (DCM) and purified by thin-layer chromatography to obtain compound 1. Subsequently, compound 1 was dissolved in tetrahydrofuran (THF), and 3-(perfluorohexyl)epoxypropane was added dropwise. The mixture was stirred at room temperature for 24 h and purified by thin-layer chromatography to obtain compound 2. Finally, compound 2 and tetrabutylammonium fluoride (TBAF) were dissolved in anhydrous THF, stirred at room temperature, and purified to obtain the target product compound 3 (DPA-F).

[0021] (3) Synthesis of fluoroalkyl-modified Fe3O4 nanoparticles: DPA and DPA-F prepared in step (2) were dissolved in MeOH, ultrasonically dispersed to ensure uniformity, and added to a three-necked flask and refluxed. The apparatus was heated to 50°C, and Fe3O4 nanoparticles coated with oleylamine and oleic acid prepared in step (1) were added. This temperature was maintained for 4 hours. After the apparatus cooled, the product was collected, centrifuged, and the precipitate was redissolved in water and ultrasonically dispersed to obtain Fe3O4 nanoparticles (IONPs) modified with DPA and DPA-F.

[0022] (4) Take the fluorine-containing Fe3O4 nanoparticles prepared in step (3) and mix them with the protein solution by vortexing, shaking, centrifuging, and re-dissolving the precipitate to obtain the fluorine-containing Fe3O4 nano-assemblies.

[0023] The application of the nanoassemblies prepared by the method for preparing fluorine-containing Fe3O4 nanoassemblies described in this invention in intracellular protein delivery.

[0024] Furthermore, the nanoassemblies can self-assemble with unmodified proteins and efficiently release bioactive proteins intracellularly through protein exchange.

[0025] As a preferred method, the application of the fluorine-containing Fe3O4 nanoassemblies in intracellular protein delivery is as follows: centrifuge the IONPs / protein complex, reconstitute the precipitate with blank medium, and then incubate it with breast cancer 4T1 cells for 4-8 hours. After incubation, discard the medium and replace it with new blank medium to continue culturing for 20 hours.

[0026] More preferably, the application of the nano-assembly in protein delivery is that the nano-assembly can self-assemble proteins into stable nanocomplexes through fluoride-loving and hydrophobic interactions, effectively delivering active proteins with different isoelectric points and molecular weights to breast cancer 4T1 cells, while increasing protein uptake efficiency through magnetic guidance.

[0027] Specifically, the nanoassembly can release cargo proteins into cells through competitive protein binding. In particular, the nanoassembly can be effectively taken up by 4T1 cells and release biologically active proteins into the cells.

[0028] The nanoassemblies can self-assemble with unmodified proteins and efficiently release biologically active proteins intracellularly through protein exchange.

[0029] The application of the fluorine-containing Fe3O4 nanoassemblies prepared by the method described in this invention in the preparation of tumor therapeutic drugs.

[0030] Mechanism of Invention: The nanoassemblies of this invention consist of fluoroalkyl chain-modified Fe3O4 nanoparticles (IONPs) and proteins. IONPs bind to proteins through hydrophobic and electrostatic interactions, self-assembling into nanoassemblies without complex chemical reactions, simply through mild incubation. Due to the hydrophobicity of the fluoroalkyl chains, they exhibit a strong adsorption tendency on cell membranes, and good cell adhesion facilitates efficient cellular uptake. Furthermore, the oleophobic properties of the fluoroalkyl chains limit their miscibility with phospholipids, reducing the fusion of the assemblies with the biological membrane during endocytosis. The nanoassemblies utilize the hydrophobic and oleophobic properties of the fluoroalkyl chains to efficiently enter tumor cells and escape endosomes, releasing cargo proteins in the cytoplasm through competitive binding with proteins.

[0031] Due to the low toxicity of Fe3O4 nanoparticles, IONP exhibits good biocompatibility, preventing cell death without carrying toxic proteins. Furthermore, the excellent superparamagnetism of Fe3O4 nanoparticles promises to further enhance protein delivery efficiency through magnetic targeting, enabling universal and efficient protein delivery. Introducing fluoroalkyl chains to modify Fe3O4 nanoparticles allows for the delivery of proteins with different isoelectric points and molecular weights without requiring additional protein modification, preserving protein bioactivity, and exhibiting low cytotoxicity. Under the guidance of an in vitro magnetic field, the efficiency of therapeutic protein delivery can be further improved.

[0032] In order to simultaneously utilize the advantages of fluorides in self-assembly, cellular uptake and endosome escape, and the low toxicity and magnetic guidance properties of magnetic nanoparticles, this invention designs and prepares fluorinated functional group modified iron oxide nanoassemblies (IONPs) as intracellular protein delivery carriers.

[0033] The assemblies prepared in this invention are Fe3O4 nanoparticles with good biocompatibility and magnetically guided uptake capability, which promote cellular uptake of fluoroalkyl chains. This invention uses safe and non-toxic Fe3O4. Compared with fluorinated polymers in the prior art, the cell viability of IONPs carrying the non-toxic protein BSA at a concentration of 100 μg / mL in this experiment was approximately 90%, which is comparable to the cell viability of fluorinated polymers at a BSA concentration of approximately 30 μg / mL in the prior art. IONPs can carry more protein into cells while ensuring biocompatibility.

[0034] The small molecule ligands specifically designed in this invention have the best cellular uptake effect. At the same time, fluorine-containing ligands usually have hydrophobic, lipophobic and bioinert properties, which are conducive to the entry of the assembly into the cell and maintain good biocompatibility.

[0035] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0036] (1) The fluoroalkyl chain modified Fe3O4 nanoassemblies synthesized in this invention can self-assemble in aqueous solution through the fluoride-loving effect. The preparation is simple and convenient. Proteins of different molecular weights and isoelectric points do not need additional modification and can form IONPs / protein complexes with nanoassemblies under mild conditions with high loading. The complexes show good stability under simulated normal physiological conditions.

[0037] (2) Fluorine-containing Fe3O4 nanoassemblies loaded with proteins of different molecular weights and isoelectric points can effectively enter tumor cells and exert cargo protein activity.

[0038] (3) This invention utilizes the superparamagnetism of Fe3O4 nanoparticles to further improve protein delivery efficiency through magnetic guidance.

[0039] (4) The fluorine-containing Fe3O4 nanoassemblies of the present invention have low cytotoxicity, deliver non-toxic protein (BSA) at high iron concentrations, and have a cell survival rate of about 90%.

[0040] (5) The fluorine-containing Fe3O4 nanoassemblies described in this invention can effectively inhibit tumor growth in mice by delivering bioactive GSDMA3 protein. Attached Figure Description

[0041] Figure 1 Transmission electron microscopy image of Fe3O4 nanoparticles;

[0042] Figure 2 The mass spectra of compounds 1 (A), 2 (B), and 3 (C) and the proton NMR spectrum of compound 3 (D) are shown respectively.

[0043] Figure 3 Particle size distribution and zeta potential of IONPs;

[0044] Figure 4 Transmission electron microscopy (TEM) images of IONPs;

[0045] Figure 5 The particle size distribution and zeta potential of IONPs / BSA (A), IONPs / β-Gal (B), IONPs / RNase A (C), IONPs / Saporin (D), and IONPs / GSDMA3 (E) are shown respectively.

[0046] Figure 6 The graph shows the particle size variation of IONPs / BSA in different solutions.

[0047] Figure 7 Release curves of IONPs / BSA in FBS at different concentrations;

[0048] Figure 8 Transfection results of IONPs / BSA-FITC(A) and IONPs / BSA-FITC(M+)(B) for BSA protein in 4T1 cells;

[0049] Figure 9 To investigate the toxicity of different concentrations of IONPs, IONPs / BSA, and IONPs / BSA(M+) to 4T1 cells;

[0050] Figure 10 Transfection results of β-Gal, IONPs / β-Gal, and IONPs / β-Gal(M+) in 4T1 cells for β-Gal protein transfection;

[0051] Figure 11 Transfection effects of different concentrations of RNase A, IONPs / RNase A, and IONPs / RNase A (M+) on RNase A protein in 4T1 cells;

[0052] Figure 12 Transfection results of different concentrations of Saporin, IONPs / Saporin, and IONPs / Saporin (M+) in 4T1 cells.

[0053] Figure 13 Transfection results of GSDMA3 protein in 4T1 cells with different concentrations of GSDMA3, IONPs / GSDMA3, and IONPs / GSDMA3(M+);

[0054] Figure 14 A graph evaluating the ability of IONPs to deliver RNase A (A), Saporin (B), and GSDMA3 (C) intracellularly;

[0055] Figure 15 The graph shows the relative tumor volume changes in a 4T1 breast cancer cell tumor model mouse after treatment with different agents.

[0056] Figure 16 This is a graph showing the change in mouse body weight during treatment. Detailed Implementation

[0057] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0058] RPMI-1640 incomplete culture medium: Jiangsu Kaiji Biotechnology Co., Ltd.; 4T1 cells: Zhejiang Meisen Technology Co., Ltd.; BSA: Beijing Solarbio Science & Technology Co., Ltd.; RNase A: Beijing Solarbio Science & Technology Co., Ltd.; β-Gal: Shanghai Beyotime Biotechnology Co., Ltd.; Saporin: Beijing Solarbio Science & Technology Co., Ltd.; Fluorescein isothiocyanate: Xi'an Ruixi Biotechnology Co., Ltd.; β-Gal staining kit: Shanghai Beyotime Biotechnology Co., Ltd.; Trypan blue: Shanghai Beyotime Biotechnology Co., Ltd.; Hoechst live cell staining solution: Shanghai Beyotime Biotechnology Co., Ltd.; BL21 competent cells: Jiangsu Kangwei Century Biotechnology Co., Ltd.; SUMO-GSDMA3 plasmid: Beijing Qingke Biotechnology Co., Ltd., which can provide GSDMA3 protein.

[0059] Example 1

[0060] Synthesis of Fe3O4 nanoparticles

[0061] 700 mg of ferric acetylacetone, 6 mL of oleylamine, and 4 mL of oleic acid were mixed and dissolved thoroughly in a three-necked round-bottom flask. The flask was then placed on a heating mantle, and N2 was introduced while the system was evacuated for 30 min to remove oxygen and water vapor. The system was stirred on a magnetic stirrer and heated to 120 °C and held for 90 min, then further heated to 220 °C and held for 30 min. Further, the system was heated to 300 °C at a rate of 2 °C / min, held for 30 min, then cooled to 120 °C and maintained at this temperature for 90 min. After the reaction, the solution was allowed to cool to room temperature. The liquid in the flask was transferred to a 50 mL centrifuge tube, and anhydrous ethanol was added to 50 mL to precipitate the nanoparticles. The tube was centrifuged at 8000 rpm for 3 min, and the supernatant was discarded. This process was repeated three times to obtain oleylamine-oleic acid-coated (monodispersed) Fe3O4 nanoparticles, which were then dispersed in 4 mL of n-hexane for subsequent use.

[0062] A small amount of the synthesized Fe3O4 nanoparticles was further diluted with n-hexane to 1 mmol / mL, and then sonicated for 30 s to ensure uniform dispersion in the solvent. A copper mesh was placed on filter paper using tweezers, and the Fe3O4 nanoparticles were dropped onto the mesh. After standing for 3 min, the solvent was absorbed with filter paper, and this process was repeated multiple times. Once the solvent on the copper mesh had evaporated, its morphology was imaged using a transmission electron microscope (TEM).

[0063] The results are as follows Figure 1 As shown, the synthesized Fe3O4 nanoparticles are uniform in size, regular in shape, and have a particle size of about 10 nm.

[0064] Example 2

[0065] Synthesis of fluorine-containing small molecule ligands

[0066] 189.6 mg (1 mmol) of 3,4-dihydroxyphenylethylamine hydrochloride (DPA), 600 mg (4 mmol) of tert-butyldimethylchlorosilane (TBSCl), 272 mg (4 mmol) of imidazole, and 48.8 mg (0.4 mmol) of 4-dimethylaminopyridine (DMAP) were dissolved in 5 mL of anhydrous tetrahydrofuran (THF) and reacted at room temperature under an inert N2 atmosphere for 4 h with stirring. The reaction solvent was removed by rotary evaporation, and all products were redissolved in 5 mL of dichloromethane (DCM). The products were purified by thin-layer chromatography (DCM:MeOH = 10:1) to obtain compound 1. Subsequently, 381.3 mg (1 mmol) of compound 1 was dissolved in 5 mL of tetrahydrofuran (THF), and 752.2 mg (2 mmol) of 3-(perfluorohexyl)propane oxide was added dropwise. The mixture was stirred at room temperature for 24 h and purified by thin-layer chromatography (DCM:MeOH = 10:1) to obtain compound 2. Finally, 757.2 mg (1 mmol) of compound 2 and 783 mg (3 mmol) of tetrabutylammonium fluoride (TBAF) were dissolved in 5 mL of anhydrous THF, stirred at room temperature for 3 h, and compound 3 (DPA-F) was obtained by separation and purification by thin-layer chromatography (DCM:MeOH = 10:1). The structures of compounds 1-3 were characterized by mass spectrometry, and... 1 The structure of the final product compound 3 was characterized by 1H NMR.

[0067] The synthetic route for compound 3 is as follows:

[0068]

[0069] The mass spectrometry results of the compound are as follows Figure 2 As shown, Figure 2 (A), (B), and (C) characterize the molecular weights of compounds 1, 2, and 3, respectively. The 1H NMR spectrum of compound 3 is shown below. Figure 2 As shown in (D), this indicates the successful synthesis of the fluorine-containing small molecule ligand. NMR data for compound 3:

[0070] 1 H NMR (400MHz, MeOD) δ 6.76 (d, J = 8.0 Hz, 1H), 6.72 (d, J = 2.1 Hz, 1H), 6.60 (d, J = 8.0 Hz, 1H), 4.28 (s, 1H), 3.64 (d, J = 5.3 Hz, 1H), 3.33 (p, J = 1.6 Hz, 2H), 3.16–3.07 (m, 3H), 2.82 (t, J = 7.7 Hz, 3H), yield calculated to be 78.2%.

[0071] Example 3

[0072] Synthesis and characterization of IONPs (fluorine-containing Fe3O4 nanoparticles)

[0073] 20 mg of compound 3 (DPA-F) prepared in Example 2 and 60 mg of dopamine hydrochloride (DPA) were weighed and dissolved in 5 mL of MeOH. After being ultrasonically dispersed, the solutions were added to a three-necked round-bottom flask, the flask was sealed tightly, and the mixture was refluxed. The apparatus was then heated to 50 °C. An appropriate amount of Fe3O4 nanoparticles stored in n-hexane was added to 5 mL of anhydrous ethanol to precipitate the precipitate. After centrifugation, the precipitate was dried and weighed. 20 mg of the precipitate was redissolved in 2 mL of chloroform (CHCl3) for later use. When the solvent in the three-necked round-bottom flask reached 50 °C, Fe3O4 nanoparticles redissolved in 2 mL of CHCl3 were injected into the flask using a syringe. This temperature was maintained for 4 h. After the apparatus cooled, the product was collected and centrifuged at 8000 r / min for 3 min. 2 mg of the dark brown precipitate was redissolved in 2 mL of water and ultrasonically dispersed for 2 min, finally yielding Fe3O4 nanoparticles (IONPs) modified with DPA and DPA-F at a concentration of 1 mg / mL. A small amount of IONPs was diluted with water and then its particle size and potential were detected by dynamic light scattering.

[0074] A small amount of the synthesized IONPs was taken and further diluted with n-hexane to 1 mmol / mL, followed by sonication for 30 s to ensure uniform dispersion in the solvent. A copper mesh was placed on filter paper using tweezers, and the IONPs were dropped onto the mesh. After standing for 3 min, the solvent was absorbed with filter paper, and this process was repeated multiple times. Once the solvent on the copper mesh had evaporated, its morphology was imaged using transmission electron microscopy (TEM). The results are as follows: Figure 3 , Figure 4 As shown, IONPs are uniform spheres with a particle size of approximately 100 nm and are positively charged.

[0075] Example 4

[0076] Synthesis and characterization of IONPs / protein complexes

[0077] 10 mg of different proteins (BSA, β-Gal, RNase A, Saporin, GSDMA3) were each dissolved in 1 mg / mL PBS. 2 mL of the 1 mg / mL IONPs aqueous solution prepared in Example 3 was mixed with 1 mL of the protein solutions prepared above. The mixtures were vortexed for 10 min and then shaken at room temperature for 2 h. After centrifugation at 3500 rpm for 3 min, unreacted free proteins were removed from the supernatant. The precipitates were then reconstituted with 1 mL of water to obtain the IONPs / protein complexes. The nanoscale size and potential of the nanocomplexes were observed using dynamic light scattering (DLS).

[0078] The results are as follows Figure 5 As shown, the particle sizes of the complexes formed by IONPs with different proteins (BSA, β-Gal, RNase A, Saporin, GSDMA3) range from 140 to 200 nm. The results indicate that IONPs can form uniformly dispersed complexes with proteins of different molecular weights and isoelectric points.

[0079] Example 5

[0080] Determination of the stability of IONPs / BSA complex

[0081] The IONPs / BSA samples prepared in Example 4 were placed in deionized water, PBS (pH 7.4), and RPMI-1640 (10% FBS), respectively. The particle size of the samples in different solvents was measured at 0h, 12h, 24h, 36h, 48h, 60h, and 72h. The particle size was measured by dynamic light scattering at 25°C, and the data were averaged three times.

[0082] The results are as follows Figure 6 As shown, the particle size of IONPs / BSA did not change significantly within 3 days, indicating that the formed nanocomposite has good stability under simulated normal physiological conditions.

[0083] Example 6

[0084] Synthesis of fluorescently labeled BSA

[0085] BSA was dissolved in phosphate-buffered saline (PBS) at pH 7.4, and fluorescein isothiocyanate (FITC) dissolved in dimethyl sulfoxide (DMSO) was added dropwise, with a BSA to FITC molar ratio of 3:1. After reacting at room temperature in the dark for 24 hours, the product was transferred to a 3500 Da dialysis bag and dialyzed with PBS and distilled water to obtain fluorescein-labeled protein (BSA-FITC) dissolved in aqueous solution. Finally, the product was lyophilized to obtain a powder and stored at -20°C. The synthesis methods for RNase A-FITC, Saporin-FITC, and GSDMA3-FITC were the same as for BSA.

[0086] Example 7

[0087] Determination of protein release rate of IONPs / BSA-FITC

[0088] Different concentrations of FBS were used to simulate the intracellular protein environment in vitro to demonstrate that the IONPs / BSA complex prepared in Example 4 could release protein through protein competitive binding. The protein release process was determined using FITC-labeled BSA prepared in Example 6. Following the method of Example 4, BSA was replaced with the fluorescently labeled protein (BSA-FITC) prepared in Example 6 to obtain IONPs / BSA-FITC. 1 mg of the prepared IONPs / BSA-FITC was placed in 2 mL of RPMI-1640 medium without FBS, containing 10% FBS, and containing 50% FBS, respectively. The medium was centrifuged at 3500 rpm for 3 min at 0.5 h, 1 h, 2 h, 3 h, and 4 h to separate unbound BSA-FITC from the IONPs / BSA-FITC. The fluorescence intensity of the supernatant after centrifugation was measured at 520 nm using a fluorescence spectrophotometer, and the amount of protein released at different time points was evaluated to calculate the protein release rate.

[0089] The results are as follows Figure 7 As shown, in an environment without FBS, the IONPs / BSA-FITC complex is relatively stable, with a protein release rate of less than 20% within 4 hours. In an environment with 10% FBS, protein release increases slightly but does not exceed 40%, demonstrating the stability of the IONPs / BSA-FITC complex in 10% FBS. When the IONPs / BSA-FITC complex is placed in an environment with 50% FBS, the protein release rate exceeds 60% within 1 hour, and 80% of the protein is displaced within 4 hours. These results indicate that the IONPs / BSA complex can release protein to varying degrees in environments with different protein concentrations, which is related to the protein concentration in the environment. This provides a basis for understanding the intracellular release of IONPs / protein complexes.

[0090] Example 8

[0091] BSA-FITC transfection experiment of IONPs in 4T1 cells

[0092] healthy 4T1 cells were loaded at 1×10⁶ cells per well. 4Cells were seeded at a density of approximately 50% in 48-well plates. Further processing was performed once cells were fully adhered and the density reached approximately 50%. 4 μL of BSA-FITC (1 mg / mL) prepared in Example 6 was mixed with 8 μL of IONPs (1 mg / mL) prepared in Example 3. The total volume was brought to 50 μL with PBS. The mixture was vortexed for 10 min at room temperature, followed by shaking for 2 h. Centrifugation was performed to purify the mixture, yielding an IONPs / BSA-FITC complex. The precipitate was then reconstituted with blank medium to 400 μL. The culture medium was gently aspirated from the 4T1 cell culture plate, and the cells were washed twice with PBS. 400 μL of the IONPs / BSA-FITC complex was then added. The plate was incubated at 37°C in a 5% CO2 incubator. After 8 h, the culture medium was removed, and the cells were gently washed three times with PBS. Trypan blue (0.2 mg / mL) was added to quench the adsorption of BSA-FITC on the cell membrane, followed by three washes with PBS. Cells were then fixed with 4% paraformaldehyde (10 min), removed, and rinsed three times with PBS. Cell nuclei were stained with Hoechst live cell staining solution. After staining, the cells were rinsed again, and the confocal culture dish was immersed in a small amount of PBS. Cell uptake was observed using a laser scanning confocal microscope (LSCM). The IONPs / BSA-FITC (M+) group (M+ meaning an external magnetic field was applied) received the same conditions as the IONPs / BSA-FITC group, but a magnet (0.5T) was applied below the culture plate and removed after 2 h.

[0093] The results are as follows Figure 8 As shown, diffuse green fluorescence was present in both groups of cells, indicating that BSA-FITC was successfully delivered into the cells. Figure 8 After applying an external magnetic field to B, the intracellular fluorescence intensity of IONPs / BSA-FITC at 8 h was significantly higher than that of B. Figure 8 Group A, which did not have an external magnetic field, demonstrates that magnetic guidance can promote intracellular protein delivery.

[0094] Example 9

[0095] Cytotoxicity evaluation of IONPs

[0096] 4T1 cells were fed at a rate of 1×10 4The cells were seeded at the specified density in 96-well plates and incubated overnight. 100 μL of PBS was added to each well along the outermost ring of the plate to avoid edge effects interfering with the experimental results. Three groups were set up: IONPs (Example 3), IONPs / BSA (Example 4), and IONPs / BSA (M+). Different concentrations of Fe3O4 in the IONPs / BSA complex (Fe concentrations of 0, 12.5, 25, 50, 100, and 200 μg / mL) were prepared using blank medium. When the cell density reached approximately 80%, the samples of different concentrations were added to the 96-well plates, 100 μL per well, with three replicates per group. After incubation at 37°C in a 5% CO2 incubator for 4 hours, the medium was removed and replaced with fresh blank medium for another 20 hours. The IONPs / BSA (M+) group was subjected to a magnetic field for 2 hours, after which the magnetic field was removed. Remove the culture medium, wash the cells three times with PBS, add 100 μL of diluted CCK-8 solution to each well, incubate the 96-well plate in an incubator for 2 hours, then remove it and place it in a microplate reader with shaking for 1 minute. Measure the absorbance of each well at 450 nm to calculate the cell viability. Cell viability % = (OD 实验组 -OD 空白组 / OD 对照组 -OD 空白组 (100%), delivering non-toxic protein (BSA) at high iron concentrations, with a cell viability of approximately 90%.

[0097] like Figure 9 As shown, no significant cytotoxicity was observed in IONPs, IONPs / BSA, and IONPs / BSA(M+) within the Fe concentration range below 200 μg / mL, indicating that the fluorine-containing Fe3O4 nanoassemblies have good biosafety and are not affected by external magnetic fields.

[0098] Example 10

[0099] β-Gal transfection experiment of IONPs in 4T1 cells

[0100] 4T1 cells were fed at a rate of 1×10 4Cells were seeded at a density of 1 / 2 well in 48-well plates and subjected to experiments when cell confluence reached 50%. 8 μL of IONPs / β-Gal (1 mg / mL) prepared according to Example 4 was diluted to 800 μL in blank medium and divided into two groups: IONPs / β-Gal and IONPs / β-Gal (M+), 400 μL in each group. Free β-Gal was diluted to 400 μL in blank medium as the β-Gal group (ensuring the same β-Gal concentration in all groups). For the IONPs / β-Gal (M+) group, a magnet was placed under the cell plate for 2 hours, then removed, and cells were cultured further. After incubation at 37°C in a 5% CO2 incubator for 8 hours, the medium was removed, and cells were washed three times with PBS. 400 μL of the staining and fixative from the β-Gal in situ staining kit was added to each well, and cells were fixed at room temperature for 10 min. The cell fixative was removed, and cells were washed three times with PBS for 3 min each time. Remove the PBS and add 400 μL of staining working solution to each well. Incubate at 37°C for 20–120 min, until some cells turn blue. Remove the working solution, rinse the cells three times with PBS, and observe them under a microscope.

[0101] The results are as follows Figure 10 As shown, free β-Gal cannot enter cells, and no blue product accumulation was observed intracellularly. After delivery using IONPs, a clear blue product was observed to form intracellularly, indicating that β-Gal successfully entered the cells and exerted its biological activity. Cells treated with a magnetic field showed the highest accumulation of blue product, indicating that this group of β-Gal had the highest delivery efficiency, and that the external magnetic field did not affect the biological activity of β-Gal.

[0102] Example 11

[0103] RNase A transfection assay of IONPs in 4T1 cells

[0104] 4T1 cells were loaded at 5 × 10⁴ cells per well. 3Cells were seeded at a density of approximately 50% in 96-well plates overnight for subsequent experiments. Three groups were set up: free RNase A, IONPs / RNase A, and IONPs / RNase A (M+). Different concentrations of free RNase A and the IONPs / RNase A complex prepared according to Example 4 were prepared using blank medium. The RNase A concentrations were 0, 2.5, 5, 10, 20, and 40 μg / mL. 100 μL of sample solution was added to each well, with three replicates for each concentration. For the IONPs / RNase A (M+) group, a magnet was placed under the cell plate for 2 hours, then removed, and cells were cultured further. After 4 hours of culture at 37°C in a 5% CO2 incubator, the medium was removed and replaced with 100 μL of blank medium for another 20 hours. Remove the culture medium, rinse the cells three times with PBS, add 100 μL of diluted CCK-8 solution to each well, incubate the 96-well plate in an incubator for 2 hours, then remove it and place it in a microplate reader with shaking for 1 minute. Detect the absorbance of each well at 450 nm to calculate the cell viability.

[0105] The results are as follows Figure 11 As shown, free RNase A exhibits almost no cytotoxicity because it cannot enter cells to exert its effects. However, after treatment with IONPs / RNase A, cytotoxicity increases with increasing RNase A concentration, demonstrating that RNase A successfully enters the cell and exerts its cytotoxic effect. Even with an RNase A concentration increased to 40 μg / mL, cell viability remained around 60% without an external magnetic field. Treatment with an external magnetic field enhanced cytotoxicity, indicating that the transfection efficiency of RNase A is further improved under external magnetic field conditions.

[0106] Example 12

[0107] Saporin transfection experiment of IONPs in 4T1 cells

[0108] 4T1 cells were loaded at 5 × 10⁴ cells per well. 3Cells were seeded at a density of approximately 50% in 96-well plates overnight for subsequent experiments. Three groups were set up: free saporin, IONPs / Saporin, and IONPs / Saporin (M+). Saporin and the IONPs / Saporin complex prepared according to Example 4 were prepared at different concentrations using blank medium. The saporin concentrations in the three groups were 0, 0.5, 1, 2, 4, and 8 μg / mL. 100 μL of sample solution was added to each well, with three replicates for each concentration. For the IONPs / Saporin (M+) group, a magnet was placed under the cell plate for 2 hours, then removed, and cells were cultured further. After 4 hours of culture in a 37°C incubator containing 5% CO2, the medium was removed and replaced with 100 μL of blank medium for another 20 hours. Remove the culture medium, rinse the cells three times with PBS, add 100 μL of diluted CCK-8 solution to each well, incubate the 96-well plate in an incubator for 2 hours, then remove it and place it in a microplate reader with shaking for 1 minute. Detect the absorbance of each well at 450 nm to calculate the cell viability.

[0109] The results are as follows Figure 12 As shown, free saporin cannot effectively enter 4T1 cells, therefore the cytotoxicity is not significant. Cell viability in the IONPs / Saporin and IONPs / Saporin(M+) groups decreased significantly in a protein concentration-dependent manner. When the saporin concentration was 8 μg / mL, cell viability under magnetic field conditions decreased to 30%, an improvement compared to 52% without a magnetic field, indicating that an external magnetic field can enhance protein delivery.

[0110] In Examples 10-12 above, the assemblies effectively delivered three proteins with different molecular weights and isoelectric points, demonstrating the universality of protein delivery by the assemblies of the present invention. This also demonstrates the tumor therapeutic potential of the assemblies.

[0111] Example 13

[0112] Extraction of GSDMA3 protein

[0113] (1) The complete coding region sequence of the GSDMA3 (NCBI: 450219) gene was selected, a 6×His-SUMO tag was added to its N-terminus, and a Ppase restriction site was added inside it. The designed deoxynucleotide sequence was synthesized at the multiple cloning site of the PET28a vector. The designed fusion protein was purified by nickel column separation, the N-terminal tag was removed by ULP1 restriction enzyme digestion, and Ppase cleavage produced a functional N- and C-terminal complex. Specific primers were designed using Primer Premier 5, and the results are as follows:

[0114] SUMO-GSDMA3-ftm64.2

[0115] CATCATCATCATCATCATTCAAGCG

[0116] SUMO-GSDMA3-rtm63

[0117] TTAGCTCAGTGCACAATAGGTCAGTG

[0118] (2) Transformation of expression plasmid into BL-21 expression host bacteria: Take 4 μg of lyophilized plasmid, centrifuge at 4℃ for 5 min (10000 r / min), prepare a 100 μg / mL plasmid stock solution with 40 μL of enzyme-free sterile water, and further dilute the plasmid to 1 μg / mL with enzyme-free sterile water. Take a new EP tube, add 10 μL of plasmid dilution buffer (1 μg / mL) and 35 μL of competent BL-21 cells, place it on an ice box and let it stand for 30 min, then activate it in a 42℃ water bath for 45 s.

[0119] Weigh 4.8g tryptone, 3g yeast extract, and 1.5g NaCl and dissolve them in 300mL of deionized water in a 500mL Erlenmeyer flask. Seal the flask with sealing film and autoclave at 121℃ for 25min. After cooling, add 450μL of culture medium to the BL-21 cell solution with activated plasmids and incubate at 37℃ for 45min. Then centrifuge the bacterial solution at 5000r / min for 5min, discard 400μL of supernatant, resuspend the cells in the remaining culture medium, mix well, and spread the bacterial solution evenly on an agar plate. After slightly drying, incubate in an inverted incubator at 37℃ overnight. The next day, pick a single colony and add 10mL of culture medium, then incubate at 37℃ overnight.

[0120] (3) Preparation of culture medium: Weigh 16g tryptone, 10g yeast powder and 5g NaCl respectively and dissolve them in 1000mL deionized water. Sterilize by autoclaving at 121℃ for 30min, take out and cool before use;

[0121] (4) Induction of GSDMA3 expression: 180 μL of bacterial culture and 18 μL of kanamycin (50 mg / mL) were added to 18 mL of sterile culture medium and incubated overnight in a shaker at 37°C. 3 mL of the overnight culture medium was added to 300 mL of culture medium, along with 300 μL of kanamycin. The mixture was incubated in a shaker at 37°C for 3.5 h. The absorbance (600 nm) was measured. When the OD value reached 0.8, 300 μL of 0.8 mol / L isopropyl-β-D-thiogalactoside (IPTG) was added, and the mixture was shaken in a shaker at 18°C ​​to induce protein expression. Twenty hours later, the culture medium that had induced protein expression was centrifuged at 4°C and 10,000 r / min for 5 min. The supernatant was then discarded, and the culture medium was reconstituted with PBS and centrifuged at the same speed. The medium was washed twice (5 min each time). The precipitate obtained after centrifugation was the bacterial cell. The solid bacterial cell was weighed and stored at -80°C.

[0122] (5) GSDMA3 extraction and purification: Solid bacterial cells were reconstituted with 30 mL of imidazole solution (10 mmol), vortexed, and poured into a small beaker. 300 μL of glycerol was added and stirred. 3 μL of the protease inhibitor phenylmethylsulfonyl fluoride (PMSF, 100 mmol) and 15 μL of dithiothreitol (DTT, 0.5 mmol) were added and stirred. The beaker was then placed in an ice-water bath and sonicated using a cell disruptor (ultrasonic disruptor settings: amplitude bar 6, power 40%, time 25 min, mode 2s on, 3s off). After sonication, the cells were centrifuged at 12000 r / min for 5 min at 4℃. The supernatant was collected and the GSDMA3 protein was extracted from the supernatant using a nickel column. The column was first rinsed twice with deionized water, and then twice with 10 mmol imidazole solution. After rinsing, the supernatant was poured into the nickel column at a flow rate of approximately 1 second / drop. The nickel column was then washed eight times with 20 mmol imidazole solution. Next, the column was washed three times each with 50 mmol and 100 mmol imidazole solutions, and the eluent was collected; this was the imidazole solution containing GSDMA3. The collected eluent was poured into an ultrafiltration centrifuge tube and centrifuged at 4500 rpm for 5 min to concentrate the protein concentration to approximately 1 mg / mL. ULP1 enzyme was then added (25 μL ULP1 enzyme per 1 mg of protein) and digested at 4°C for 12 h. The digested protein solution was purified by gel filtration chromatography to remove ULP1 enzyme and the N-terminal tag. The gel filtration column was first rinsed twice with deionized water and 10 mmol imidazole solution, then the protein solution was added and the eluent was collected. The collected eluent was poured into an ultrafiltration centrifuge tube and centrifuged at 4500 rpm for 5 min to concentrate the protein concentration to approximately 1 mg / mL. Ppase enzyme was then added (10 μL Ppase enzyme per 1 mg of protein) and digested at 4°C for 12 h. Finally, the protein was purified using glutathione affinity chromatography to remove Ppase enzyme. The glutathione affinity chromatography column was rinsed twice with PBS buffer, the sample was loaded, and the eluent was collected as the final GSDMA3 protein.

[0123] Example 14

[0124] GSDMA3 transfection experiment of IONPs in 4T1 cells

[0125] 4T1 cells were loaded at 5 × 10⁴ cells per well. 3Cells were seeded at a density of approximately 50% in 96-well plates overnight for subsequent experiments. Three groups were set up: free GSDMA3, IONPs / GSDMA3, and IONPs / GSDMA3(M+). Different concentrations of free GSDMA3 and the IONPs / GSDMA3 complex prepared according to Example 4 were prepared using blank medium. The GSDMA3 concentrations in the three groups were 0, 7.5, 15, 30, and 60 μg / mL. 100 μL of sample solution was added to each well, with three replicates for each concentration. For the IONPs / GSDMA3(M+) group, a magnet was placed under the cell plate for 2 hours, then removed, and cells were cultured further. After culturing at 37°C for 4 hours, the medium was removed and replaced with 100 μL of blank medium for another 20 hours. After incubation, the culture medium was removed, and the cells were rinsed three times with PBS. 100 μL of diluted CCK-8 solution was added to each well. The 96-well plate was incubated in an incubator for 2 hours and then removed. The plate was placed in a microplate reader and shaken for 1 minute. The absorbance of each well was measured at 450 nm to calculate the cell viability.

[0126] The results are as follows Figure 13 As shown, the cytotoxicity of free GSDMA3 slightly increases with increasing protein concentration. After IONPs form a complex with GSDMA3, GSDMA3 can be effectively delivered into 4T1 cells, thereby producing significant cytotoxicity. Furthermore, under the guidance of a magnetic field, the uptake of the IONPs / GSDMA3 complex by cells is further enhanced, and the cell viability eventually decreases to about 40%, which also demonstrates that GSDMA3 has an anti-tumor effect at the cellular level, and that it can be promoted by an external magnetic field, resulting in a better anti-tumor effect.

[0127] Example 15

[0128] Evaluation of IONPs' ability to deliver RNase A, Saporin, and GSDMA3 intracellularly

[0129] healthy 4T1 cells were loaded at 1×10⁶ cells per well. 4Cells were seeded at a density of approximately 50% in 48-well plates and administered the drug when the cells were fully adhered. 4 μL of RNase A-FITC (1 mg / mL), Saporin-FITC (1 mg / mL), and GSDMA3-FITC (1 mg / mL) prepared in Example 6 were mixed with 8 μL of IONPs (1 mg / mL) prepared in Example 3. The mixture was then brought to a final volume of 50 μL with PBS. The mixture was vortexed at room temperature for 10 min, followed by shaking for 2 h. After centrifugation, the resulting precipitates were obtained: IONPs / RNase A-FITC, IONPs / Saporin-FITC, and IONPs / GSDMA3-FITC complexes. The precipitates were then reconstituted with blank culture medium to a final volume of 400 μL. Subsequent processing was performed using the method described in Example 8.

[0130] The results are as follows Figure 14 As shown, no green fluorescence was observed intracellularly in proteins not loaded with IONPs (RNase A-FITC, Saporin-FITC, and GSDMA3-FITC groups), while all IONPs / protein complex groups exhibited intracellular green fluorescence, indicating that IONPs can effectively deliver several proteins into cells. Furthermore, the intracellular green fluorescence intensity of the IONPs / protein complex (M+) group was higher than that of the group without an external magnetic field, indicating that the internalization efficiency of IONPs was effectively improved after guidance by an external magnetic field. This also demonstrates that IONPs can deliver proteins of different molecular weights and isoelectric points, making them a universal protein delivery carrier.

[0131] Example 16

[0132] Evaluation of the in vivo antitumor efficacy of IONPs / GSDMA3 complex

[0133] A subcutaneous 4T1 tumor model was established using 3-4 week old Balb / c mice weighing 18-20g. 100μL of a prepared 4T1 cell suspension was subcutaneously injected into the right leg of the mice (cell density 1×10⁻⁶). 6 When the tumor grows to 60mm 3 At approximately 10:00 AM, Balb / c female mice with a 4T1 breast cancer tumor model were randomly divided into 5 groups, with 3 mice in each group. Administered the medication via intratumoral injection. The experimental groups were PBS, IONPs / BSA, free GSDMA3, IONPs / GSDMA3, and IONPs / GSDMA3 (M+). The medication was administered three times (on days 0, 3, and 6), with a protein dose of 10 mg / kg. In the magnetic targeting group (M+), a magnet was fixed to the mouse tumor site after administration. Tumor volume and mouse weight were measured and recorded one day after administration.

[0134] The formula for calculating tumor volume is: V = D × d2 / 2, where D represents the longest diameter of the tumor and d represents the shortest diameter of the tumor. The relative tumor volume is defined as V / V0, where V0 is the initial tumor volume.

[0135] The results are as follows Figure 15 As shown, compared with the blank control group, IONPs / BSA and free GSDMA3 had limited inhibitory effects on tumor growth. The IONPs / GSDMA3 group showed some tumor inhibition, with the tumor volume approximately five times its original size at 14 days; while the IONPs / GSDMA3(M+) group showed the most significant tumor inhibition, with the tumor volume only about 2.8 times its original size at 14 days. This may be because applying a magnet to the tumor site in mice prolongs the drug's residence time at the tumor site, thereby enhancing the drug's efficacy and inhibiting tumor growth more effectively. Figure 16 As shown, the mice's body weight did not change significantly during the administration period, indicating that the drug had no obvious adverse effects on the mice.

Claims

1. A method for preparing a fluorine-containing Fe3O4 nanoassembly, characterized in that, Includes the following steps: (1) Using acetylacetone iron as a precursor, Fe3O4 nanoparticles coated with oleylamine and oleic acid were synthesized by heating under an inert atmosphere after mixing with oleylamine and oleic acid. (2) Synthesis of fluorine-containing small molecule ligands; (3) After refluxing the dopamine hydrochloride and the small molecule ligand prepared in step (2), the reaction solution is added to the solution of Fe3O4 nanoparticles coated with oleylamine and oleic acid to form fluorine-containing Fe3O4 nanoparticles. (4) Take the fluorine-containing Fe3O4 nanoparticles prepared in step (3) and mix them with the protein solution, shake, centrifuge, and reconstitute the precipitate to obtain the fluorine-containing Fe3O4 nano-assemblies; The structure of the fluorine-containing small molecule ligand is shown below: .

2. The method for preparing fluorine-containing Fe3O4 nanoassemblies according to claim 1, characterized in that, In step (1), the temperature is raised to 100-120°C and held for 60-90 minutes. Then the temperature is raised to 250-350°C and reacted for 30-60 minutes before cooling to room temperature.

3. The method for preparing fluorine-containing Fe3O4 nanoassemblies according to claim 1, characterized in that, The Fe3O4 nanoparticles prepared in step (1) have a particle size of 8-10 nm.

4. The method for preparing fluorine-containing Fe3O4 nanoassemblies according to claim 1, characterized in that, The small molecule ligand synthesis method in step (2) is as follows: Dopamine hydrochloride, tert-butyldimethylchlorosilane, imidazole, and 4-dimethylaminopyridine are stirred and reacted under inert gas protection. After separation and purification, compound 1 is obtained. After redissolving in tetrahydrofuran, 3-(perfluorohexyl)propane oxide is added dropwise. After stirring and reaction, compound 2 is obtained. Finally, compound 2 and tetrabutylammonium fluoride are redissolved in tetrahydrofuran, stirred and reacted, and then separated and purified to obtain compound 3, which is the fluorine-containing small molecule ligand.

5. The method for preparing fluorine-containing Fe3O4 nanoassemblies according to claim 1, characterized in that, The method for synthesizing the fluorine-containing Fe3O4 nanoparticles in step (3) is as follows: Dopamine hydrochloride and the small molecule ligand prepared in step (2) are dissolved in methanol, refluxed, heated, and Fe3O4 nanoparticles prepared in step (1) are injected into the mixture and re-dissolved in chloroform. After cooling and centrifugation, the resulting precipitate is re-dissolved in water and ultrasonically dispersed to obtain fluorine-containing Fe3O4 nanoparticles (IONPs).

6. The method for preparing fluorine-containing Fe3O4 nanoassemblies according to claim 5, characterized in that, In step (3), the mass ratio of dopamine hydrochloride to the small molecule ligand is 3:1~2.

7. The method for preparing fluorine-containing Fe3O4 nanoassemblies according to claim 1, characterized in that, In step (4), the mass ratio of protein to fluorine-containing Fe3O4 nanoparticles is 1:2 to 3, and the protein is any one of bovine serum albumin, β-galactosidase, ribonuclease, saponin, or gasdermin A3 protein.

8. A method for preparing the fluorine-containing Fe3O4 nanoassemblies according to claim 1, and the application of the prepared nanoassemblies in the preparation of drugs for intracellular protein delivery.

9. The application according to claim 8, characterized in that, The nanoassemblies can self-assemble with unmodified proteins and efficiently release biologically active proteins intracellularly through protein exchange.

10. The application of the nanoassemblies prepared by the method for preparing fluorine-containing Fe3O4 nanoassemblies according to claim 1 in the preparation of drugs for treating tumors.