A recombinant protein capable of recruiting dendritic cells and its application in immunotherapy

Abstract

The present invention relates to a recombinant protein capable of recruiting dendritic cells and its application in immunotherapy, belonging to the technical field of biomedicine. The present invention discloses a recombinant protein capable of recruiting dendritic cells, and its amino acid sequence includes any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6. This recombinant protein contains a high proportion of glycine or serine, can promote the chemotaxis and migration of dendritic cells (DCs), and is a safe and non-toxic natural component, having good application prospects in immunomodulation.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technologies, and relates to a recombinant protein capable of recruiting dendritic cells and its application in immunotherapy. Background Art

[0002] Dendritic cells (DCs) are antigen-presenting cells (APCs) and have great potential in immunotherapy. They can uptake, process antigens and present them to T cells to activate immune responses, thereby generating a greater immune reaction. Naturally activated dendritic cells mature and migrate to the draining lymph nodes, stimulating the production of T helper cells (CD4 + ) and cytotoxic T cells (CD8 + ), activating the adaptive immune response, and may generate a memory response when encountering tumor antigens in the future, avoiding the chance of recurrence. However, DCs are sparsely distributed in the blood, skin, mucous membranes and other sites in contact with the outside world, and their dispersed state greatly limits the opportunity to contact antigens. Free antigens will be rapidly cleared during metabolism, and DC cells will not be able to capture enough antigens (drugs) for processing and presentation, and the immune monitoring efficiency is limited. In this case, DC cells are unlikely to be activated enough to provide sufficient co-stimulatory signals to T cells. Therefore, increasing the utilization of antigens and improving the presentation efficiency are expected to further improve the translational potential of the loaded tumor vaccines, which is of great significance for clinical immunotherapy.

[0003] In recent years, natural protein materials based on immunomodulation have attracted increasing attention and favor. Human hair keratin, as a natural biomaterial, has good biocompatibility and degradability and has been widely used in the field of biomedical engineering. In addition to showing excellent abilities in hemostasis, promoting fibroblast proliferation and migration, and collagen synthesis, keratin also exhibits special immunomodulatory abilities on macrophage phenotypes. Therefore, human hair keratin has great potential in immunomodulation. How to increase the innate immune response sensitivity while minimizing adverse events in immunotherapy is the new requirement and goal for keratin-based biomaterials to regulate the immune microenvironment and achieve clinical precision therapy. However, the structure-activity relationship of keratin has not been clearly defined yet, which greatly limits the ability to perform immunomodulation at the molecular level and affects its biological activity, safety and feasibility.

[0004] Therefore, it is necessary to explore the key domains in keratin that have regulatory immune functions such as recruiting DC cells, and provide methods for preparing the domain proteins into gels and microneedles to improve the antigen presentation efficiency, with a view to improving the clinical trial / research effect of tumor vaccines in immunotherapy. Summary of the Invention

[0005] In view of this, one of the objectives of the present invention is to provide a recombinant protein capable of recruiting dendritic cells; another objective of the present invention is to provide a preparation method of a recombinant protein capable of recruiting dendritic cells; the third objective of the present invention is to provide an application of a recombinant protein capable of recruiting dendritic cells in the preparation of protein microneedles or protein gels; the fourth objective of the present invention is to provide a protein microneedle; the fifth objective of the present invention is to provide a preparation method of a protein microneedle; the sixth objective of the present invention is to provide a protein gel; the seventh objective of the present invention is to provide a preparation method of a protein gel; the eighth objective of the present invention is to provide an application of a protein gel or protein microneedle in immune cell regulation.

[0006] To achieve the above objectives, the present invention provides the following technical solutions:

[0007] 1. A recombinant protein capable of recruiting dendritic cells, wherein the amino acid sequence of the recombinant protein comprises any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.

[0008] 2. The preparation method of the above recombinant protein, and the preparation method comprises the following steps:

[0009] (1) Construction of recombinant plasmid and protein expression: Translate the above recombinant protein into the corresponding gene sequence to construct a recombinant plasmid, transfer it into Escherichia coli BL21(DE3) competent cells, and then inoculate it into a sterile liquid LB medium containing 50 μg / ml ampicillin, and culture it in a shaker at 37 °C at a rotation speed of 170 rpm for 8 - 10 h. When the OD value reaches 0.8 - 1.0, lower the temperature to 25 °C, and use isopropyl β-D-thiogalactoside (IPTG) with a final concentration of 1 mM to induce for 8 h, and then centrifuge at 8000 rpm for 5 min at 4 °C to retain the precipitate (i.e., Escherichia coli);

[0010] (2) Purification of the protein: a. Ultrasonically disrupt the precipitate obtained in step (1) and then centrifuge it to obtain a precipitate containing the target protein. Resuspend the precipitate containing the target protein at a mass-to-volume ratio of 1:5 mg:mL with washing solution I, homogenize and disrupt it at 800 - 1000 bar, and then centrifuge it at 12,000 rpm for 1 h at 4°C. Discard the supernatant to obtain a bacterial cell precipitate. b. Then, resuspend the bacterial cell precipitate at a mass-to-volume ratio of 1:10 mg:mL with washing solution II and precipitate it, and discard the supernatant to obtain precipitate III. c. Next, resuspend precipitate III at a mass-to-volume ratio of 1:10 mg:mL with washing solution III and precipitate it, and discard the supernatant to obtain precipitate IV. d. Wash precipitate IV twice with pure water, resuspend it, and place it at -80°C for freeze-drying;

[0011] The washing solution I is an aqueous solution with pH = 8.0 and containing 50 mM Tris-HCL, 5 mM EDTA, and 20 mM β-mercaptoethanol;

[0012] The washing solution II is an aqueous solution with pH = 8.0 and containing 50 mM Tris-HCL, 5 mM EDTA, 20 mM β-mercaptoethanol, 1 M urea, and 5 mL / L Triton X-100;

[0013] The washing solution III is an aqueous solution with pH = 8.0 and containing 50 mM Tris-HCL, 5 mM EDTA, and 20 mM β-mercaptoethanol.

[0014] Preferably, the resuspension and precipitation specifically are: ultrasonicate for more than 3 min and centrifuge at 8000 - 12000 rpm for 10 - 20 min;

[0015] The freeze-drying is carried out in a freeze dryer.

[0016] 3. Application of the above recombinant protein in the preparation of protein microneedles or protein gels.

[0017] 4. A protein microneedle, which comprises microneedles and the above recombinant protein fixed on the surface of the microneedles.

[0018] 5. Preparation method of the above protein microneedle, the preparation method comprising the following steps:

[0019] (1) Preparation of the recombinant keratin composite gel: Dissolve the above recombinant protein in a mixed solution of carboxymethyl cellulose (CMC) and polyvinylpyrrolidone (PVP) so that the mass fraction of the recombinant protein is 15%, add glucose oxidase, and form a composite gel after magnetic stirring at 37°C for 24 hours;

[0020] (2) Preparation of protein microneedles: Pour the composite gel prepared in step (1) into a polydimethylsiloxane (PDMS) mold containing a microporous array, deposit a recombinant protein / carboxymethyl cellulose (CMC) / polyvinylpyrrolidone (PVP) mixed gel in the needle cavity, place it in a vacuum drying oven with a vacuum degree of 0.09 - 0.1 MPa for vacuum degassing for 10 min, repeat the vacuum degassing three times to remove air bubbles and allow the mixed solution to fully enter the micropores of the mold. Then, prepare a backing layer on the mold with carboxymethyl cellulose (CMC) / polyvinylpyrrolidone (PVP) gel, and place it in a vacuum drying oven with a vacuum degree of 0.09 - 0.1 MPa for 5 min to remove the excess solution;

[0021] (3) Protein microneedle forming: Place the microneedle mold treated by the method in step (2) in a constant temperature environment at 4°C for drying and equilibration for 12 h;

[0022] (4) Demolding: Take out the microneedles from the mold to obtain the protein microneedles.

[0023] Preferably, the weight ratio of carboxymethyl cellulose (CMC) to polyvinylpyrrolidone (PVP) in the mixed solution is 1:2;

[0024] The concentration of glucose oxidase added to the solution is 0.8 mg / mL.

[0025] 6. A protein gel, which is an aqueous solution of the above recombinant protein formed by dissolving the recombinant protein in water.

[0026] 7. The preparation method of the above protein gel, the preparation method includes the following steps: Dissolve the above recombinant protein in water to obtain a mass fraction of the recombinant protein of 5 - 45%, and magnetically stir for 24 h at 25 - 37°C to form a protein gel.

[0027] 8. The application of the above protein microneedles or protein gel in immunocyte regulation.

[0028] The beneficial effects of the present invention are as follows: The present invention discloses a recombinant protein capable of recruiting dendritic cells, and its amino acid sequence includes any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6. This recombinant protein contains a high proportion of glycine or serine, can promote the chemotaxis and migration of dendritic cells (DCs), and is a safe and non-toxic natural component, having good application prospects in immunotherapy.

[0029] Other advantages, objects, and features of the present invention will be set forth in part in the following description, and in part will be obvious to those skilled in the art upon examination of the following, or may be learned by practice of the present invention. The objects and other advantages of the present invention may be realized and attained by means of the instrumentalities and combinations particularly pointed out hereinafter. Brief Description of the Drawings

[0030] In order to make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be described in detail preferably with reference to the accompanying drawings, where:

[0031] Figure 1 Agarose gel electrophoresis diagrams of recombinant proteins KRT81-T, KRT82-T, KRT83-T, KRT84-T, KRT85-T, and KRT86-T;

[0032] Figure 2 SPR fitting results of the affinities of the recombinant proteins KRT84-T, KRT86-T, and BSA prepared in Example 1 with DC2.4 cell vesicles at pH = 6.2 and pH = 7.4, respectively;

[0033] Figure 3 Transwell chemotaxis test results of the recombinant protein RK81-T and BSA prepared in Example 1 at pH = 6.2 and pH = 7.4, 50 μm, respectively;

[0034] Figure 4 Quantitative results of migrating DC2.4 cells of the recombinant proteins RK81-T and BSA prepared in Example 1 at pH = 6.2 and pH = 7.4, respectively, after culturing in a medium containing 10% serum for 24 hours;

[0035] Figure 5 Scanning electron microscope images of the protein microneedles prepared from the recombinant protein RK83-T in Example 1 at 5000 μm (a) and 2500 μm (b);

[0036] Figure 6 Effect diagram of recruiting DC2.4 cells around the protein gel prepared from the recombinant protein RK82-T (scale bar is 100 μm);

[0037] Figure 7 Effect diagram of recruiting DC2.4 cells around the protein microneedles prepared from the recombinant protein RK84-T (scale bar is 100 μm);

[0038] Figure 8 Effect of the protein microneedles prepared from the recombinant protein RK85-T in Example 1 on recruiting in vivo skin dendritic cells (scale bar is 50 μm);

[0039] Figure 9 Quantitative results (per unit area) of dendritic cell recruitment in the in vivo skin by the protein microneedles prepared with the recombinant protein RK85-T in Example 1;

[0040] Figure 10 Ex vivo fluorescence images of tumor-draining lymph nodes (TDLNs) after microneedle injection. Detailed implementation manners

[0041] The following specific examples illustrate the implementation manners of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific implementation manners. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the diagrams provided in the following examples only illustrate the basic concept of the present invention in a schematic manner. Without conflict, the following examples and the features in the examples can be combined with each other.

[0042] The amino acids of the recombinant proteins involved in the following examples are shown as follows:

[0043] KRT81-T: EQRLCEGIGAVNVCVSSSRG GVVCGDLCVS GSRPVTGSVC SAPCNGNVAVSTGLCAPCGQ LNTTCGGGSC GVGSCGISSL GVGSCGSSCR KC (SEQ ID NO: 1);

[0044] KRT82-T: EHRLCEGIGP VNISVSSSKG AFLYEPCGVS TPVLSTGVLR SNGGCSIVGTGELYVPCEPQ GLLSCGSGRK SSMTLGAGGS SPSHKH (SEQ ID NO: 2);

[0045] KRT83-T: EQRLCEGVEA VNVCVSSSRG GVVCGDLCVS GSRPVTGSVC SAPCNGNLVVSTGLCKPCGQ LNTTCGGGSC GQGRH (SEQ ID NO: 3);

[0046] KRT84-T: ESRLCEGVGP VNISVSSSRG GLVCGPEPLV AGSTLSRGGV TFSGSSSVCATSGVLASCGPSLGGARVAPA TGDLLSTGTR SGSMLISEAC VPSVPCPLPT QGGFSSCSGG RSSSVRFVSTTTSCRTKY (SEQ ID NO: 4);

[0047] KRT85-T: EHRLCEGVGS VNVCVSSSRG GVSCGGLSYS TTPGRQITSGPSAIGGSITVVAPDSCAPCQ PRSSSFSCGS SRSVRFA (SEQ ID NO: 5);

[0048] KRT86-T: EQRLCEGVGS VNVCVSSSRG GVVCGDLCAS TTAPVVSTRV SSVPSNSNVVVGTTNACAPS ARVGVCGGSC KRC (SEQ ID NO: 6).

[0049] The above amino acid sequences were translated according to codons, and the corresponding gene sequences are as follows:

[0050] The gene sequence corresponding to the translation of KRT81-T is:

[0051] GAACAGCGCCTGTGCGAAGGCATTGGCGCGGTGAACGTGTGCGTGAGCAGCAGCCGCGGCGGCGTGGTGTGCGGCGATCTGTGCGTGAGCGGCAGCCGCCCGGTGACCGGCAGCGTGTGCAGCGCGCCGTGCAACGGCAACGTGGCGGTGAGCACCGGCCTGTGCGCGCCGTGCGGCCAGCTGAACACCACCTGCGGCGGCGGCAGCTGCGGCGTGGGCAGCTGCGGCATTAGCAGCCTGGGCGTGGGCAGCTGCGGCAGCAGCTGCCGCAAATGC (SEQ ID NO: 7); The gene sequence corresponding to the translation of KRT82-T is:

[0052] GAACATCGCCTGTGCGAAGGCATTGGCCCGGTGAACATTAGCGTGAGCAGCAGCAAAGGCGCGTTTCTGTATGAACCGTGCGGCGTGAGCACCCCGGTGCTGAGCACCGGCGTGCTGCGCAGCAACGGCGGCTGCAGCATTGTGGGCACCGGCGAACTGTATGTGCCGTGCGAACCGCAGGGCCTGCTGAGCTGCGGCAGCGGCCGCAAAAGCAGCATGACCCTGGGCGCGGGCGGCAGCAGCCCGAGCCATAAACAT(SEQ ID NO:8);

[0053] The gene sequence corresponding to the translation of KRT83-T is:

[0054] GAACAGCGCCTGTGCGAAGGCGTGGAAGCGGTGAACGTGTGCGTGAGCAGCAGCCGCGGCGGCGTGGTGTGCGGCGATCTGTGCGTGAGCGGCAGCCGCCCGGTGACCGGCAGCGTGTGCAGCGCGCCGTGCAACGGCAACCTGGTGGTGAGCACCGGCCTGTGCAAACCGTGCGGCCAGCTGAACACCACCTGCGGCGGCGGCAGCTGCGGCCAGGGCCGCCAT(SEQ ID NO:9);

[0055] The gene sequence corresponding to the translation of KRT84-T is:

[0056] GAAAGCCGCCTGTGCGAAGGCGTGGGCCCGGTGAACATTAGCGTGAGCAGCAGCCGCGGCGGCCTGGTGTGCGGCCCGGAACCGCTGGTGGCGGGCAGCACCCTGAGCCGCGGCGGCGTGACCTTTAGCGGCAGCAGCAGCGTGTGCGCGACCAGCGGCGTGCTGGCGAGCTGCGGCCCGAGCCTGGGCGGCGCGCGCGTGGCGCCGGCGACCGGCGATCTGCTGAGCACCGGCACCCGCAGCGGCAGCATGCTGATTAGCGAAGCGTGCGTGCCGAGCGTGCCGTGCCCGCTGCCGACCCAGGGCGGCTTTAGCAGCTGCAGCGGCGGCCGCAGCAGCAGCGTGCGCTTTGTGAGCACCACCACCAGCTGCCGCACCAAATAT(SEQ ID NO:10);

[0057] The gene sequence corresponding to the translation of KRT85-T is:

[0058] GAACATCGCCTGTGCGAAGGCGTGGGCAGCGTGAACGTGTGCGTGAGCAGCAGCCGCGGCGGCGTGAGCTGCGGCGGCCTGAGCTATAGCACCACCCCGGGCCGCCAGATTACCAGCGGCCCGAGCGCGATTGGCGGCAGCATTACCGTGGTGGCGCCGGATAGCTGCGCGCCGTGCCAGCCGCGCAGCAGCAGCTTTAGCTGCGGCAGCAGCCGCAGCGTGCGCTTTGCG(SEQ ID NO:11);

[0059] The gene sequence corresponding to the translation of KRT86-T is:

[0060] GAACAGCGCCTGTGCGAAGGCGTGGGCAGCGTGAACGTGTGCGTGAGCAGCAGCCGCGGCGGCGTGGTGTGCGGCGATCTGTGCGCGAGCACCACCGCGCCGGTGGTGAGCACCCGCGTGAGCAGCGTGCCGAGCAACAGCAACGTGGTGGTGGGCACCACCAACGCGTGCGCGCCGAGCGCGCGCGTGGGCGTGTGCGGCGGCAGCTGCAAACGCTGC(SEQ ID NO:12).

[0061] Example 1

[0062] Prepare a recombinant protein capable of recruiting dendritic cells, and the specific method is as follows:

[0063] (1) Construction of recombinant plasmid and protein expression: Transfer the gene sequences corresponding to the translated amino acid sequences above into Escherichia coli BL21(DE3) competent cells respectively, and then inoculate them into a sterile liquid LB medium containing 50 μg / ml ampicillin. Culture them in a shaker at 37 °C with a rotation speed of 170 rpm for 8-10 h. When the OD value reaches 0.8-1.0, lower the temperature to 25 °C, and use isopropyl thiogalactoside (IPTG) with a final concentration of 1 mM to induce for 8 h. After centrifuging at 8000 rpm for 5 min at 4 °C, retain the precipitate;

[0064] (2) Protein purification: a. The precipitate obtained in step (1) is ultrasonically disrupted and then centrifuged to obtain a precipitate containing the target protein. According to a mass-volume ratio of 1:5 mg:mL, washing solution I (this washing solution I is an aqueous solution with pH = 8.0 and containing 50 mM Tris-HCL, 5 mM EDTA, and 20 mM β-mercaptoethanol) is added to the precipitate containing the target protein for resuspension. After homogenization and disruption at 800 - 1000 bar, it is centrifuged at 12,000 rpm at 4°C for 1 h, and the supernatant is discarded to obtain a bacterial cell precipitate. b. Then, according to a mass-volume ratio of 1:10 mg:mL, washing solution II (this washing solution II is an aqueous solution with pH = 8.0 and containing 50 mM Tris-HCL, 5 mM EDTA, 20 mM β-mercaptoethanol, 1 M urea, and 5 mL / L Triton X-100) is added to the bacterial cell precipitate for resuspending the precipitate, and the supernatant is discarded to obtain precipitate III. c. Next, according to a mass-volume ratio of 1:10 mg:mL, washing solution III (this washing solution III is an aqueous solution with pH = 8.0 and containing 50 mM Tris-HCL, 5 mM EDTA, and 20 mM β-mercaptoethanol) is added to precipitate III for resuspending the precipitate, and the supernatant is discarded to obtain precipitate IV. d. The precipitate IV is washed twice with pure water and then resuspended, and freeze-dried at -80°C to obtain different recombinant proteins, namely KRT81-T, KRT82-T, KRT83-T, KRT84-T, KRT85-T, and KRT86-T.

[0065] To identify whether the purified target protein is successfully obtained by running sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Figure 1 It is the agarose gel electrophoresis pattern of recombinant proteins KRT81-T, KRT82-T, KRT83-T, KRT84-T, KRT85-T, and KRT86-T. From Figure 1 it can be seen that the single-band target protein prepared by the method in Example 1 is consistent with the expected protein molecular weight.

[0066] Example 2

[0067] Investigate the interaction between the recombinant proteins KRT84-T and KRT86-T prepared in Example 1 above and DC cell vesicles (taking DC2.4 cells as an example), specifically as follows:

[0068] The Open SPR system (Nicoya Lifesciences, Waterloo, Canada) was used to investigate the binding affinity between DC2.4 vesicles and the recombinant proteins KRT84-T and KRT86-T prepared in Example 1 under acidic conditions: (1) The DC2.4 cell membrane was extracted, and after ultrasonic treatment, it was repeatedly extruded using an extruder (pore size = 100 nm) to prepare a lipid membrane with a uniform particle size; (2) The SPR instrument was connected and adjusted. The prepared lipid membrane was fixed on the Lip-1 sensor chip, and different concentrations of the recombinant protein dilution (from 0.06 to 1.93 μM) were tested under PBS buffer solution with a flow rate of 20 μL / min (pH = 6.2 and pH = 7.4), and the resonance changes were recorded. The obtained data were fitted and calculated to evaluate the binding affinity. Then, the chip was regenerated with 200 μL of 20 mM CHAPS, and each concentration was tested three times.

[0069] At the same time, bovine serum albumin (BSA) was used as a control group and tested in the same manner as described above.

[0070] Figure 2 SPR fitting results of the recombinant proteins KRT84-T, KRT86-T, and BSA prepared in Example 1 and the affinity of DC2.4 cell vesicles under the conditions of pH = 6.2 and pH = 7.4, respectively. From Figure 2 It can be seen that under acidic conditions, KRT84-T and KRT86-T can bind to DC cell vesicles in a concentration-dependent manner, indicating that the recombinant proteins have strong affinity for DC cells.

[0071] Example 3

[0072] The chemotactic effect of the recombinant protein KRT81-T prepared in Example 1 on DC cells (taking DC2.4 cells as an example) was studied as follows:

[0073] The Transwell system was used for chemotaxis assay to evaluate the chemotactic effect of the recombinant protein RK81-T prepared in Example 1 on DC cells: A 5.0 μm polycarbonate membrane was used. DC2.4 cells (5×10 4 ) were seeded in the upper chamber, and the recombinant protein KRT81-T solution (1.6 mg / mL) prepared in Example 1 was added to the lower chamber to study the effect of the protein components in the lower culture medium on cell migration (where both the upper and lower chambers were filled with medium containing 10% serum); after culturing for 24 hours, the cells on the cell membrane were fixed and stained with 0.5% crystal violet dye; after removing non-migrating cells, the migrating cells were imaged and counted using a bright-field microscope.

[0074] Figure 3Results of Transwell chemotaxis assays of the recombinant protein KRT81-T prepared in Example 1 and BSA under the conditions of pH = 6.2 and pH = 7.4, respectively (scale bar = 50 μm). From Figure 3 It can be seen that under acidic conditions, dendritic cells (recombinant protein KRT81-T prepared in Example 1) have the effect of migrating towards the recombinant protein.

[0075] Figure 4 Quantitative results of migrating DC2.4 cells of the recombinant protein KRT81-T and BSA prepared in Example 1 after culturing in a medium containing 10% serum for 24 hours under the conditions of pH = 6.2 and pH = 7.4, respectively. From Figure 4 It can be seen that the number of dendritic cells migrating under acidic conditions (recombinant protein KRT81-T prepared in Example 1) is significantly different from that of the control group (BSA).

[0076] Example 4

[0077] The recombinant protein KRT83-T prepared in Example 1 was used to prepare a protein gel with the ability to recruit DC cells. The specific preparation method is as follows:

[0078] The recombinant protein KRT83-T prepared in Example 1 was dissolved in an aqueous solution to make the mass fraction of the recombinant protein KRT83-T 15%, and a protein gel was formed after magnetic stirring at 37 °C for 24 hours;

[0079] Example 5

[0080] The recombinant protein KRT83-T prepared in Example 1 was used to prepare protein microneedles with the ability to recruit DC cells. The specific preparation method includes the following steps:

[0081] (1) Preparation of recombinant keratin composite gel: The recombinant protein KRT83-T prepared in Example 1 was dissolved in a mixed solution of carboxymethyl cellulose (CMC) and polyvinylpyrrolidone (PVP) (where the ratio of CMC to PVP is 1:2, w:w) to make the mass fraction of the recombinant protein KRT83-T 15%, and then glucose oxidase was added thereto (the concentration of glucose oxidase in the mixed solution after addition was 0.8 mg / mL), and a composite gel was formed after magnetic stirring at 37 °C for 24 hours;

[0082] (2) Preparation of protein microneedles: Pour the composite gel prepared in step (1) into a polydimethylsiloxane (PDMS) mold containing a microporous array, deposit the recombinant protein KRT83-T / CMC / PVP mixed gel in the needle cavity, place it in a vacuum drying oven with a vacuum degree of 0.09 - 0.1 MPa for vacuum degassing for 10 minutes, repeat the vacuum degassing three times to remove air bubbles and allow the mixed solution to fully enter the micropores of the mold. Then, prepare a backing layer with CMC / PVP gel on the mold, place it in a vacuum drying oven with a vacuum degree of 0.09 - 0.1 MPa for 5 minutes to remove the excess solution;

[0083] (3) Protein microneedle forming: Place the microneedle mold processed by the method in step (2) in a constant temperature (temperature is 4 °C) environment for drying and equilibration for 12 hours;

[0084] (4) Demolding: Take out the microneedles from the mold to obtain the protein microneedles. Conduct electron microscopy scanning on them. The scanning electron micrographs with scales of 500 μm and 250 μm are shown as Figure 5 a and b in the figure respectively.

[0085] Similarly, protein microneedles of other recombinant proteins in Example 1 can be prepared according to the above method.

[0086] Example 6

[0087] Examine the recruitment ability of the KRT82-T protein gel and KRT84-T microneedles prepared by the methods of Example 4 and Example 5 on DC cells (taking DC2.4 cells as an example), as follows:

[0088] To determine the effect of the KRT82-T protein gel and KRT84-T microneedles on the recruitment of DC cells, suspend the DC2.4 cells, and then co-culture them with the protein gel and microneedle array in a 6-well plate; culture for 24 h under acidic conditions, and observe the cells recruited around the surface of the microneedles with an optical microscope and a laser confocal microscope (LSCM) respectively.

[0089] Figure 6 Effect diagram of recruiting DC2.4 cells around the protein gel prepared for the recombinant protein KRT82-T (scale is 100 μm). From Figure 6 It can be seen that DC2.4 cells migrate towards the gel containing the KRT82-T protein, indicating its function of recruiting dendritic cells.

[0090] Figure 7 Effect diagram of recruiting DC2.4 cells around the protein microneedles prepared for the recombinant protein KRT84-T (scale is 100 μm). From Figure 7 It can be seen that DC2.4 cells migrate towards the microneedles containing the KRT84-T protein, indicating its function of recruiting dendritic cells.

[0091] Example 7

[0092] Examine the recruitment effect of the protein microneedles prepared with the recombinant protein KRT85-T in Example 1 on dendritic cells around the subcutaneous tissue (including the epidermis and dermis), as specifically shown below:

[0093] Anesthetize Balb / c mice (female, 6 - 8 weeks old, weighing 18 - 22 g) with sodium pentobarbital. When the mice are lethargic, shave the hair on the back of the mice with a razor, and gently wipe the back with a dry and clean cotton ball dipped in an appropriate amount of 75% alcohol for disinfection; insert the protein microneedle patch with the recombinant protein KRT85-T immobilized on the surface prepared in Example 5 into the shaved mouse skin. Take skin tissues at 1, 2, 4, 6, 8, 12, and 24 h respectively for cryosectioning. Embed the excised tissues with O.T.C for frozen sectioning, and observe the fluorescence distribution and quantification in each skin section by CLSM, as shown respectively in Figure 8 and Figure 9 shown.

[0094] Figure 8 The recruitment effect of the protein microneedles prepared with the recombinant protein KRT85-T in Example 1 on dendritic cells in the in vivo skin (scale bar is 50 μm). From Figure 8 it can be seen that dendritic cells have the effect of migrating towards the protein microneedles prepared with the recombinant protein KRT85-T under acidic conditions.

[0095] Figure 9 The quantitative results (per unit area) of the protein microneedles prepared with the recombinant protein KRT85-T in Example 1 for recruiting dendritic cells in the in vivo skin. From Figure 9 it can be seen that there is a significant difference in the number of migrating dendritic cells under acidic conditions compared with the control group.

[0096] Example 8

[0097] Examine the effect of the protein microneedles prepared with the recombinant protein KRT83-T in Example 1 on antigen presentation efficiency, as specifically shown below:

[0098] Load the model antigen into the protein microneedles prepared with the recombinant protein KRT83-T. Anesthetize Balb / c mice (female, 6 - 8 weeks old, weighing 18 - 22 g) with sodium pentobarbital. When the mice are lethargic, shave the hair on the back of the mice with a razor, and gently wipe the back with a dry and clean cotton ball dipped in an appropriate amount of 75% alcohol for disinfection; insert the microneedle patch loaded with the antigen into the shaved mouse skin. Sacrifice the mice at different time points of 1, 2, 4, and 6 hours respectively, collect the tumor-draining lymph nodes and take pictures.

[0099] Figure 10It is an ex vivo fluorescence image of tumor-draining lymph nodes (TDLNs) after microneedle injection. From Figure 10 it can be seen that the fluorescence of the protein microneedle-draining lymph nodes (TDLNs) ex vivo is relatively strong, indicating that the microneedles increase the antigen presentation efficiency in vivo.

[0100] In summary, the present invention discloses a recombinant protein capable of recruiting dendritic cells, and its amino acid sequence includes any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6. The recombinant protein contains a high proportion of glycine or serine, can promote the chemotaxis and migration of dendritic cells (DCs), and is a safe and non-toxic natural component. Therefore, it can be used to prepare protein microneedles and has good application prospects in immunotherapy.

[0101] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the purpose and scope of the present technical solution, and they should all be covered within the scope of the claims of the present invention.

Claims

1. Use of recombinant keratin composite gel in the preparation of a preparation for immunocyte regulation, characterized in that: The recombinant keratin is dissolved in a mixed solution of carboxymethyl cellulose and polyvinylpyrrolidone. The mass fraction of the recombinant keratin is 15%. Glucose oxidase is added, and after magnetic stirring at 37°C for 24 hours, a recombinant keratin composite gel is formed. The amino acid sequence of the recombinant keratin is any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO:

6. The weight ratio of carboxymethyl cellulose to polyvinylpyrrolidone in the mixed solution is 1:

2. The concentration of glucose oxidase added to the solution is 0.8 mg / mL.

2. The use of the recombinant keratin composite gel according to claim 1 in the preparation of a preparation for immunocyte regulation, characterized in that, The preparation method of the recombinant keratin includes the following steps: (1) Construction of recombinant plasmid and protein expression: Translate the recombinant keratin described in claim 1 into the corresponding gene sequence to construct a recombinant plasmid, transfer it into Escherichia coli BL21 competent cells, and then inoculate it into a sterile liquid LB medium containing 50 μg / ml ampicillin. Culture it in a shaker at 37°C at a rotation speed of 170 rpm for 8 - 10 h. When the OD value reaches 0.8 - 1.0, lower the temperature to 25°C, induce it with isopropyl thiogalactoside at a final concentration of 1 mM for 8 h, and then centrifuge at 8000 rpm for 5 min at 4°C to retain the precipitate. (2) Protein purification: a. Ultrasonically disrupt the precipitate obtained in step (1) and then centrifuge to obtain a precipitate containing the target protein. Resuspend the precipitate containing the target protein according to the mass - volume ratio of 1:5, mg:mL, with washing solution I, homogenize and disrupt it at 800 - 1000 bar, and then centrifuge at 12000 rpm for 1 h at 4°C. Discard the supernatant to obtain a cell precipitate. b. Then resuspend the cell precipitate according to the mass - volume ratio of 1:10, mg:mL, with washing solution II, and discard the supernatant to obtain precipitate III. c. Then resuspend precipitate III according to the mass - volume ratio of 1:10, mg:mL, with washing solution III, ultrasonicate for more than 3 min, centrifuge at 8000 - 12000 rpm for 10 - 20 min, and discard the supernatant to obtain precipitate IV. d. Wash precipitate IV twice with pure water, resuspend it, and place it at - 80°C for freeze - drying. The washing solution I is an aqueous solution with pH = 8.0 and containing 50 mM Tris - HCL, 5 mM EDTA and 20 mM β - mercaptoethanol. The washing solution II is an aqueous solution with pH = 8.0 and containing 50 mM Tris - HCL, 5 mM EDTA, 20 mM β - mercaptoethanol, 1 M urea, and 5 mL / L TritonX - 100. The washing solution III is an aqueous solution with pH = 8.0 and containing 50 mM Tris - HCL, 5 mM EDTA, and 20 mM β - mercaptoethanol.

3. Use of keratin microneedles in the preparation of a preparation for immunocyte regulation, characterized in that, The keratin microneedle includes microneedles and the recombinant keratin composite gel described in claim 1 fixed on the surface of the microneedles.

4. The use of the keratin microneedles according to claim 3 in the preparation of a preparation for immunocyte regulation, characterized in that, The preparation method of the keratin microneedles comprises the following steps: (1) Preparation of keratin microneedles: Pour the recombinant keratin composite gel into a polydimethylsiloxane mold containing a microporous array, deposit the recombinant keratin / carboxymethyl cellulose polyvinylpyrrolidone mixed gel in the needle cavity, place it in a vacuum drying oven with a vacuum degree of 0.09-0.1 MPa for vacuum degassing for 10 min, repeat the vacuum degassing three times, remove the bubbles to make the mixed solution fully enter the micropores of the mold, then prepare a backing layer on the mold with carboxymethyl cellulose polyvinylpyrrolidone gel, and place it in a vacuum drying oven with a vacuum degree of 0.09-0.1 MPa for 5 min to remove the excess solution; (2) Shaping of keratin microneedles: Place the microneedle mold treated by the method in step (2) in a constant temperature environment of 4 °C for drying and equilibration for 12 h; (3) Demolding: Take out the microneedles from the mold to obtain the keratin microneedles.

Images