A highly active unfolded protein response element, and screening method and application thereof

Abstract

The present invention discloses a highly active unfolded protein response element and its screening method and application. The screening method can efficiently and quickly screen out UPRE elements with high response activity. The obtained highly active UPRE2 element has been improved in both response intensity and response amplitude. Tandem connection of these highly active UPRE elements can further improve their performance. Inserting the obtained highly active UPRE2 element upstream of the core region of the promoter can achieve dynamic regulation of synthetic pathway genes, improve the yield of target products such as recombinant proteins or natural products, and has broad application prospects and important practical significance.

Description

Technical Field

[0001] The present invention relates to a highly active unfolded protein response element and a screening method and application thereof, belonging to the field of biotechnology. Background Art

[0002] The endoplasmic reticulum is a key organelle in eukaryotic cells and plays an important role in the folding of secreted and membrane proteins. When the proteins produced by cells exceed their load capacity, misfolded proteins are generated in the endoplasmic reticulum. The accumulation of these misfolded proteins imposes a burden on cells and activates the cellular stress response pathway. The unfolded protein response pathway (UPR) is an adaptive signal transduction mechanism that maintains endoplasmic reticulum homeostasis by enhancing the protein folding ability of cells. The transcription factor Hac1p can change the expression levels of approximately 400 genes by interacting with the unfolded protein response element (UPRE) upstream of the promoter. By using a promoter mediated by UPRE to drive the expression of a fluorescent protein, a UPR biosensor for detecting endoplasmic reticulum stress caused by the accumulation of unfolded proteins can be constructed. This sensor is superior to traditional detection methods based on HAC1 mRNA splicing in terms of sensitivity. However, its design is limited by the limited combination of UPRE and non-UPR promoters, such as CYC1p, or certain specific natural UPR promoters, such as HAC1p, KAR2p, and ERO1p. Among them, UPRE1 is a cis-acting element of the KAR2p promoter and is used to regulate its activity. UPRE2 was first discovered in the upstream region of the ERO1p promoter. Compared with UPRE1, UPRE2 provides a wider dynamic regulation range and stronger response intensity for the promoter.

[0003] Genetic elements are key components applied in the fields of metabolic engineering and synthetic biology. Controlling gene expression levels requires promoters with different transcriptional strengths. Currently, there are various strategies for promoter modification and construction of promoter libraries, such as random mutagenesis by error-prone PCR, saturation mutagenesis, hybrid promoter engineering, etc. However, screening these libraries requires a large number of tests. Commonly used screening methods include agar plates, microplate screening, and fluorescence-activated cell sorting (FACS) based on flow cytometry. Although the agar plate method is simple and easy to operate, its quantitative ability is limited. The microplate screening method can provide relatively accurate quantification, but the throughput still needs to be further improved. FACS can achieve high-throughput sorting, but the sorting process is highly technical and requires a large amount of systematic optimization for different target products or enzymes. Therefore, developing a rapid screening method to obtain highly efficient UPRE elements and applying them to gene regulation in synthetic pathways to increase the yield of target products not only has theoretical significance but also has broad practical application value. Summary of the Invention

[0004] The primary object of the present invention is to overcome the deficiencies of the prior art and provide a screening method for highly active unfolded protein response elements. This screening method combines plate screening and microplate detection to achieve efficient screening of mutant libraries.

[0005] Another object of the present invention is to provide highly active unfolded protein response elements obtained by the above screening method.

[0006] Another object of the present invention is to provide the application of the above highly active unfolded protein response elements.

[0007] The object of the present invention is achieved by the following technical solutions:

[0008] A screening method for highly active unfolded protein response elements uses the fusion of chromoprotein EforRed and green fluorescent protein GFP as a reporter protein. By combining plate observation (chromoprotein) and microplate reader quantitative detection (green fluorescent protein), preliminary screening of strains containing highly active unfolded protein response elements is achieved; subsequently, secondary verification is performed on the initially screened strains to obtain highly active response elements; preferably, it includes the following steps:

[0009] (1) Construction of a recombinant vector with UPRE2 and a reporter gene: Clone the coding nucleic acid of the fusion protein formed by chromoprotein EforRed and green fluorescent protein GFP onto an expression vector, and at the same time insert a promoter with UPRE2 upstream of the coding nucleic acid to obtain a recombinant vector;

[0010] (2) Construction of the UPRE2 mutant library: The recombinant vector obtained in step (1) was amplified with mutant primers containing degenerate codons to obtain a repair fragment for integration with mutated UPRE2. Since the repair fragment was amplified with mutant degenerate primers, the repair fragment also had diversity. The helper vector and the aforementioned repair fragment were transferred into the engineered Saccharomyces cerevisiae strain to achieve the integration of the repair fragment onto the yeast chromosome, and a UPRE2 mutant library with integrated diverse fragments was obtained.

[0011] (3) Primary screening: Observed under sunlight, the yeast clones with darker colors were marked; observed under blue light, the yeast clones with stronger fluorescence were marked. Yeast clones simultaneously marked under sunlight and blue light were preliminarily screened and transferred to fresh SC-URA solid medium; then inoculated in SC-URA liquid medium for culture, and during the culture, the stress inducer dithiothreitol (DTT) was added. The bacterial liquid was collected and subjected to GFP fluorescence detection to obtain the quantitative value of the GFP fluorescence intensity of the marked strains.

[0012] (4) Secondary screening:

[0013] 1) Using the yeast clones simultaneously marked under sunlight and blue light with high fluorescence intensity obtained in step (3) as templates, the UPRE2m fragment was obtained; the UPRE2m fragment, promoter, and red fluorescent protein RFP were integrated onto the chromosome of the engineered Saccharomyces cerevisiae strain to obtain a recombinant yeast strain, where the red fluorescent protein RFP was located downstream of the promoter.

[0014] 2) The recombinant yeast strain obtained in step 1) was expanded in culture, and during the culture, the stress inducer dithiothreitol (DTT) was added. The bacterial liquid was collected and subjected to RFP fluorescence detection to obtain a recombinant yeast strain with stronger fluorescence intensity.

[0015] (5) Sequencing: UPRE2m was amplified from the recombinant yeast strain with stronger fluorescence intensity, sequenced, and a highly active unfolded protein response element was obtained.

[0016] In step (1):

[0017] The chromoprotein EforRed can strongly absorb visible light and show distinct colors in ambient light, and the sequence of its encoding nucleic acid is preferably as shown in Seq ID No.1.

[0018] The sequence of the encoding nucleic acid of the green fluorescent protein GFP is preferably as shown in Seq ID No.2.

[0019] The fusion protein is a green fluorescent protein GFP fused to the C-terminus of the chromoprotein EforRed, and the linker used is (GGGGS)×3.

[0020] The nucleotide sequence of the linker-encoding nucleic acid is preferably as follows: GGCGGTGGTGGTTCCGGTGGTGGTGGTTCTGGTGGTGGTGGTTCT.

[0021] The expression vector is a high-copy plasmid p426GPD or a low-copy plasmid p416GPD.

[0022] The sequence of the UPRE2 is 5’-ATACGGAGTACGTGTCATAAAAAC-3’, and its core sequence is 5’-TACGTG-3’. The core sequence is the base necessary for activity, but its function can be affected by changing its flanking sequences.

[0023] The promoter is a promoter active in yeast, preferably TDH3p, TEF1p, TPI1p or CYC1p. The strengths of these promoters are as follows: TDH3p > TEF1p > TPI1p > CYC1p.

[0024] The promoter with UPRE2 is preferably with UPRE2 located upstream (5’ end) of the promoter.

[0025] In step (2):

[0026] The degenerate codon-containing mutant primer is a primer capable of introducing random mutations into the flanking sequences of UPRE2 by PCR technology.

[0027] The repair fragment is a sequence in which the mutant UPRE2, promoter, and fusion protein-encoding nucleic acid are sequentially linked; preferably a fragment obtained by introducing random mutations into the flanking sequences of UPRE2 using the DNA fragment UPRE2-TDH3p CORE-EforRed-GFP-CYC1t as a template by PCR technology.

[0028] The auxiliary vector is preferably a yeast fungal gene knockout gene editing vector carrying gRNA targeting the chromosomal neutral integration site.

[0029] The chromosomal neutral integration site is preferably the X3 site.

[0030] The yeast fungal gene knockout gene editing vector is preferably pROS10.

[0031] The engineered Saccharomyces cerevisiae strain is preferably a strain with a CEN.PK background. CEN.PK background strains are commonly used yeast strains and are widely used in metabolic engineering and systems biology research in the industrial and academic fields (Microb Cell Fact, 2012, 11, 36), with good representativeness and universality; preferably the yeast strain IMX581.

[0032] The integration described above is achieved through gene editing technology; more preferably, it is the CRISPR / Cas9 gene technology.

[0033] In step (3):

[0034] The blue light described above is light with a wavelength of 450 - 500 nm.

[0035] The addition time of the pressure inducer dithiothreitol is preferably when the cell density OD of the culture medium 600 ≈0.2 - 0.5; more preferably, the cell density OD 600 ≈0.3 - 0.4.

[0036] The dosage of the pressure inducer dithiothreitol is preferably a concentration of 1 mM - 8 mM in the culture medium; more preferably, it is 5 mM.

[0037] The treatment time of the pressure inducer dithiothreitol is preferably 2 h - 6 h; more preferably, it is 4 h.

[0038] The conditions for the fluorescence detection are preferably as follows: Pipette 200 μL of the cell suspension into a 96-well plate, and use a microplate reader to measure OD 600 , and measure the fluorescence intensity of GFP at an excitation wavelength of 485 nm and an emission wavelength of 525 nm.

[0039] In step (4):

[0040] Step 1) is preferably as follows: First, construct a yeast strain with a red fluorescent protein RFP fragment with a promoter integrated on the chromosome; then, using the yeast clone labeled under sunlight and blue light obtained in step (3) as a template, obtain the UPRE2m fragment; integrate the UPRE2m fragment upstream of the promoter in the red fluorescent protein RFP fragment with a promoter to obtain a recombinant yeast strain.

[0041] The sequence of the coding nucleic acid of the red fluorescent protein RFP is preferably as shown in SEQ ID NO.3.

[0042] The integration site described in step 1) is preferably the X3 site.

[0043] The culture medium for the scale-up culture described in step 2) is preferably SC-URA medium.

[0044] The conditions for the scale-up culture described in step 2) are preferably culturing at 28 - 32 °C and 150 - 250 rpm; more preferably, culturing at 30 °C and 200 rpm.

[0045] The addition time of the pressure inducer dithiothreitol in step 2) is preferably when the cell density OD of the culture medium 600≈0.2 - 0.5; more preferably, the cell density OD 600 ≈0.3 - 0.4.

[0046] The dosage of the pressure inducer dithiothreitol described in step 2) is preferably a concentration of 1 mM to 8 mM in the culture medium; more preferably 5 mM.

[0047] The treatment time of the pressure inducer dithiothreitol described in step 2) is preferably 2 h to 6 h; more preferably 4 h.

[0048] The conditions for fluorescence detection described in step 2) are preferably to pipette 200 μL of the cell suspension into a 96-well plate and measure OD 600 , and measure the fluorescence intensity of RFP at an excitation wavelength of 532 nm and an emission wavelength of 610 nm.

[0049] A highly active unfolded protein response element obtained by the above screening method, which is m77 - 97 with a nucleotide sequence as shown in SEQ ID NO. 12 - 32.

[0050] The application of the above highly active unfolded protein response element in the preparation of a modular unfolded protein response element.

[0051] A modular unfolded protein response element is obtained by repeating and concatenating one of the above highly active unfolded protein response elements, or by concatenating at least two of the above highly active unfolded protein response elements, or by concatenating one of the above highly active unfolded protein response elements with UPRE2; preferably m94 - m94, m86 - m86, m84 - m84, m94 - m86, m94 - m84, UPRE2 - m86 or UPRE2 - m84.

[0052] The application of the above highly active unfolded protein response element or modular unfolded protein response element in the expression of exogenous proteins is to use UPRE2m to achieve dynamic regulation of the gene target of the protein production strain, so as to overcome the problem of mismatch between the continuous overexpression of molecular chaperones and the actual production requirements of the strain in the prior art, and improve the protein yield; preferably includes the following steps: setting the above highly active unfolded protein response element or modular unfolded protein response element upstream (i.e., the 5' end) of the core region of the gene promoter that regulates the expression of recombinant proteins.

[0053] The exogenous protein is preferably α - amylase.

[0054] The gene that regulates the expression of recombinant proteins is preferably ERO1, PDI1, SEC24.

[0055] The core region of the promoter is the 200 - 250 bp upstream of the promoter coding region.

[0056] The above-mentioned highly active unfolded protein response element or modular unfolded protein response element is set upstream of the promoter core region by fusion PCR technology.

[0057] Application of the above-mentioned highly active unfolded protein response element or modular unfolded protein response element in increasing the yield of natural products. The above-mentioned highly active unfolded protein response element or modular unfolded protein response element is used to dynamically regulate the enzyme (such as truncated HMG-CoA reductase tHMG1) that catalyzes the synthesis of natural products to eliminate feedback inhibition and increase the yield of natural products; preferably, it includes the following steps: setting the above-mentioned highly active unfolded protein response element or modular unfolded protein response element upstream of the promoter core region connected to the enzyme that catalyzes the synthesis of natural products.

[0058] The natural product is preferably squalene.

[0059] The enzyme that catalyzes the synthesis of natural products is preferably truncated HMG-CoA reductase (tHMG1).

[0060] The promoter is preferably TDH3p.

[0061] The position of the upstream is preferably 0-500 bp; more preferably 0 bp, -50 bp, -100 bp, -150 bp, -200 bp, -300 bp, -400 bp, -500 bp.

[0062] The present invention has the following advantages and effects compared with the prior art:

[0063] The present invention has developed a screening method using the fusion protein EforRed-GFP as a reporter protein. This method first conducts a preliminary screening by observing the color of transformed plate clones under sunlight and blue light and detecting the GFP fluorescence intensity. Subsequently, strains showing high fluorescence intensity in the preliminary screening are selected for secondary screening verification. The UPRE2m sequence is amplified from the screened strains and placed upstream of TDH3pCORE, and a UPRE2m mutant is reconstructed using RFP as the reporter protein. Finally, the response of the reconstructed UPRE2m mutant under untreated and DTT-treated conditions is tested and confirmed in a well plate to obtain the dominant UPRE2m element. Compared with traditional screening methods, this method has the advantages of simple operation and short time consumption. By constructing a UPRE2 mutant library and screening the library, a series of elements with different response activities are obtained. Among them, the highest activity element m84 is 3.72 times the response activity of natural UPRE2; the dynamic response range of m94 is increased by 103%. Inserting the element m94 as a response module upstream of the promoter can enhance the stress expression level of the target gene and improve protein expression. Compared with a constitutive promoter, when using a responsive hybrid promoter constructed with UPRE elements to regulate tHMG1 in a strain, the squalene production of the strain can be increased by 85%. It shows that the UPRE2m element screened using the fusion protein EforRed-GFP as a reporter protein has broad application prospects and important practical significance. Brief Description of the Drawings

[0064] Figure 1 It is a schematic diagram of the imaging of the reporter protein EforRed-GFP in yeast cells under a fluorescence microscope after introduction.

[0065] Figure 2 It is a graph showing the expression analysis results of the reporter protein EforRed-GFP; among them, A is a schematic diagram of constructing a driving reporter gene using promoters with different expression intensities on different expression vectors; B is a photo of expressing the reporter protein using promoters with different expression intensities (TDH3p > TEF1p > TPI1p > CYC1p) on different expression vectors (high-copy plasmid p426 series, low-copy plasmid p416 series, and chromosomal integration), from top to bottom are 1 day, 4 days, and 9 days of expression, the left column is sunlight, and the right column is blue light; C is a statistical graph of B; D is a photo of the plate containing mutants placed under blue light, and visible fluorescence can be observed; the white arrow indicates clones with higher fluorescence intensity.

[0066] Figure 3 It is a graph showing the response of the hybrid promoter UPRE2m-TDH3p CORE with high activity under 5 mM DTT treatment.

[0067] Figure 4It is a diagram showing the response of the hybrid promoter 2×UPRE2m-TDH3p CORE under 5 mM DTT treatment; among them, A is a schematic diagram of different constructs; B is a diagram of the response situation.

[0068] Figure 5 It is a diagram showing the influence of the UPRE2m element m94 at different positions upstream of the core region of the promoter TDH3p on the signal output (expression response intensity); among them, A is a schematic diagram of different constructs; B is a diagram of the response situation.

[0069] Figure 6 It is a diagram showing the influence of the UPRE2m element m94 used as a plug-in for gene target regulation on the yield of α-amylase; among them, A is a schematic diagram of different constructs; B is the result of the α-amylase yield.

[0070] Figure 7 It is a diagram showing the influence of the constitutive promoter and the responsive promoter regulating the expression of tHMG1 on the yield of squalene; among them, A is a schematic diagram of the generation process of squalene in vivo and different constructs; B is the yield of squalene; it can be seen that the responsive promoter containing the UPRE2m element has a better effect than the traditional constitutive promoter. Detailed implementation manners

[0071] The present invention will be further described in detail below in conjunction with the embodiments and the accompanying drawings, but the implementation manners of the present invention are not limited thereto.

[0072] The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels without special instructions.

[0073] The experimental methods without specific conditions noted in the following embodiments are usually carried out under conventional conditions, such as those described in "Molecular Cloning: A Laboratory Manual" (Beijing: Science Press, 2017) and "Experimental Guide for Yeast Genetics Methods" (Beijing: Science Press, 2016).

[0074] For the CRISPR technology applied in the following embodiments, refer to the prior art (FEMS Yeast Research, 2015, 15, fov004). In addition, the plasmids p416GPD and p426GPD used in the following embodiments have been disclosed in the literature "Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 1995, 156:119 - 122."; the plasmid pAlphaAmyCPOT has been disclosed in the literature "Engineering the protein secretory pathway of Saccharomyces cerevisiae enables improved protein production. PNAS 2018, 115:E11025 - E11032"; the plasmid P416 - P TDH3 -RFP has been disclosed in the literature "Overexpression of genes by stress-responsive promoters increases protein secretion in Saccharomyces cerevisiae. World Journal of Microbiology and Biotechnology, 2023, 39, 203."; the plasmids pROS10 and pROS13 have been disclosed in the literature "CRISPR / Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae. FEMS Yeast Research, 2015, 15, fov004" and are available from EUROSCARF. The strain MSBP003 has been disclosed in the literature "Comprehensive analysis of signal peptides in Saccharomyces cerevisiae reveals features for efficient secretion. Advanced Science 2023, 10, 2203433".

[0075] To better understand the content of the present invention, the strain IMX581 (obtainable from EUROSCARF) with the background of Saccharomyces cerevisiae CEN.PK was used as the starting strain for further illustration of the specific examples.

[0076] The media involved in the following examples are as follows:

[0077] LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, with deionized water as the solvent; 2% agar powder was added to the solid medium.

[0078] LB / AMP medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, with deionized water as the solvent; 2% agar powder was added to the solid medium. After autoclaving and cooling to about 40 °C, 100 μg / mL ampicillin (filtered and sterilized) was added.

[0079] YPD medium: 20 g / L peptone, 10 g / L yeast extract, 20 g / L glucose (sterilized separately and then added), with deionized water as the solvent; 2% agar powder was added to the solid medium.

[0080] SC-URA auxotrophic medium: 0.77 g / L CSM-Ura, 1.7 g / L YNB w / o AA&w / o(NH4)2SO4 (Yeast Nitrogen Base without Amino acids and without Ammonium sulphate), 5.0 g / L (NH4)2SO4, 20 g / L glucose (note: glucose was sterilized separately), adjust the pH value to 5.5 - 6.0; 2% agar powder was added to the solid medium; deionized water was used as the solvent.

[0081] The methods involved in the following examples are as follows:

[0082] Plasmid construction:

[0083] (1) The Gibson assembly method, and the specific operation was carried out according to the instructions of the NEB Gibson Assembly Cloning kit (product number E2611, NEB).

[0084] (2) 5 μL of the assembly system was transformed into 50 μL of E. coli DH5α competent cells, and spread on LB / AMP solid medium for overnight culture.

[0085] (3) Screen to obtain positive clones, culture them by amplification, and then extract plasmids. The specific extraction process is carried out according to the instructions of the HiPure Plasmid Micro Kit (product number P1001-03, Magen).

[0086] Transformation of yeast strains:

[0087] Unless otherwise specified, the lithium acetate transformation method is used. The specific operation can be found in the relevant standard specifications.

[0088] The primer sequences involved in the following examples are shown in Table 1:

[0089] Table 1: Primer sequences (5'-3')

[0090]

[0091]

[0092]

[0093] Example 1 Obtaining the coding gene

[0094] According to the amino acid sequences of chromoprotein EforRed (ACD13196.1), GFP (AAA27722.1), and RFP (AHW57114.1) publicly available in the UniProt database, codon optimization for Saccharomyces cerevisiae was performed. Subsequently, the corresponding gene-encoding nucleic acids were synthesized by a gene synthesis company (see SEQ ID No.1, SEQ ID No.2, and SEQ ID No.3). The coding nucleic acid of EforRed after codon optimization is driven by UPRE2-TDH3p CORE for expression, and it was cloned onto the vector pUC57 to obtain the plasmid pUC57-UPRE2-TDH3pCORE-EforRed. The coding nucleic acids of GFP and RFP after codon optimization were cloned onto the vector pUC57 to obtain pUC57-GFP and pUC57-RFP.

[0095] Example 2 Construction of Saccharomyces cerevisiae engineering bacteria expressing fusion proteins on plasmids

[0096] To determine the optimal expression intensity of the elements, we used traditional promoters with different expression intensities to mediate the expression of the fusion protein, and inserted the expression cassette into the high-copy plasmid p426 framework, low-copy plasmid p416 framework, and chromosomal locus for expression respectively. The specific construction processes for expressing the reporter protein with different intensity promoters on low- and high-copy plasmids are as follows:

[0097] (1) Using primers PEGP1 / PEGP2, the p416 and p426 plasmid frameworks were amplified with p416GPD and p426GPD plasmids as templates respectively; PCR amplification included conventional denaturation, annealing, and extension steps (the same below); among them, the annealing temperature was 56 °C, extension was performed at 72 °C for 180 s, and 34 cycles of amplification were carried out.

[0098] (2) Using primer pairs GPDEP1 / GPDEP2, TEFEP1 / TEFEP2, TPIEP1 / TPIEP2, and CYCEP1 / CYCEP2 respectively, promoter fragments of TDH3p, TEF1p, TPI1p, and CYC1p with homologous arms were amplified with the Saccharomyces cerevisiae IMX581 genome as a template; using primer pair X1 / TDH3EP2 with the pUC57-UPRE2-TDH3p CORE-EforRed plasmid as a template, the UPRE2-TDH3pCORE promoter fragment was obtained by PCR amplification; the annealing temperature was 56 °C, extension was performed at 72 °C for 30 s, and 34 cycles of amplification were carried out.

[0099] (3) Using primers EP1 / EflinP2, the EforRed fragment with homologous arms was amplified with the pUC57-UPRE2-TDH3p CORE-EforRed plasmid as a template; the annealing temperature for PCR amplification was 56 °C, extension was performed at 72 °C for 30 s, and 34 cycles of amplification were carried out.

[0100] (4) Using primers EGP1 / EGP2, the GFP fragment with homologous arms was amplified with the pUC57-GFP plasmid as a template; the annealing temperature for PCR amplification was 56 °C, extension was performed at 72 °C for 30 s, and 34 cycles of amplification were carried out.

[0101] (5) Using Gibson assembly technology, the four fragments obtained in the above steps (1) to (4) were spliced together and transformed into Escherichia coli DH5α. The constructed plasmids were named p426-TDH3p-EforRed-GFP, p426-TEF1p-EforRed-GFP, p426-TPI1p-EforRed-GFP, p426-CYC1p-EforRed-GFP, p426-UPRE2-TDH3p CORE-EforRed-GFP; p416-TDH3p-EforRed-GFP, p416-TEF1p-EforRed-GFP, p416-TPI1p-EforRed-GFP, p416-CYC1p-EforRed-GFP, p416-UPRE2-TDH3p CORE-EforRed-GFP.

[0102] (6) By the lithium acetate transformation method, the constructed plasmid was transformed into the strain IMX581, spread on SC-URA solid medium, and cultured at 30 °C for 3 - 4 days to screen for positive transformants (the results are shown as A - C in Figure 1 and Figure 2 ). Figure 1 The results of Figure 2 show that the fusion protein EforRed - GFP was correctly expressed.

[0103] Example 3 Construction of a Saccharomyces cerevisiae strain expressing a fusion protein on the chromosome

[0104] (1) Construction of plasmid pROS10 - X - 3

[0105] Plasmid pROS10 contains two gRNA reverse expression cassettes. Using plasmid pROS10 as a template, the plasmid framework for knockout was amplified by primer PSNR52. The annealing temperature for PCR amplification was 56 °C, with extension at 72 °C for 150 s, and 34 cycles of amplification. Using plasmid pROS10 as a template, a fragment with a 20 - bp gRNA targeting the chromosomal neutral site was amplified by primer gRNA - X - 3. Using Gibson assembly technology, the above two fragments were spliced together and transformed into Escherichia coli DH5α. The constructed plasmid was named pROS10 - X - 3.

[0106] (2) PCR amplification of repair fragments

[0107] Using primer pairs dxP3 / X2, respectively, with plasmids p426 - TDH3p - EforRed - GFP, p426 - TEF1p - EforRed - GFP, p426 - TPI1p - EforRed - GFP, p426 - CYC1p - EforRed - GFP, p426 - UPRE2 - TDH3p CORE - EforRed - GFP as templates, repair fragments containing homologous arms TDH3p - EforRed - GFP - CYC1t, TEF1p - EforRed - GFP - CYC1t, TPI1p - EforRed - GFP - CYC1t, CYC1p - EforRed - GFP - CYC1t, UPRE2 - TDH3pCORE - EforRed - GFP - CYC1t were PCR - amplified.

[0108] (3) By the lithium acetate transformation method, the plasmid pROS10-X-3 was co-transformed with the repair fragments TDH3p-EforRed-GFP-CYC1t, TEF1p-EforRed-GFP-CYC1t, TPI1p-EforRed-GFP-CYC1t, CYC1p-EforRed-GFP-CYC1t, UPRE2-TDH3p CORE-EforRed-GFP-CYC1t into the strain IMX581, and then spread on the SC-URA solid medium and cultured at 30 °C for 3 - 4 days to screen for positive transformants (as shown in A - C in the results Figure 2 . The results in the figure show that there is a significant correlation between the promoter strength and the depth of colony color when expressing the fusion protein on the chromosome. The fluorescence intensity of GFP is consistent with the promoter strength, indicating that the fusion protein can be used as a reliable reporter gene in subsequent screening experiments. Based on the above experimental results, a library containing the UPRE2m mutant was further constructed by integrating the expression vector into the chromosome.

[0109] Example 4 Construction of the UPRE2m mutant library

[0110] (1) PCR amplification of the UPRE2m-TDH3p CORE-EforRed-GFP-CYC1t fragment

[0111] Using the plasmid p426-UPRE2-TDH3p CORE-EforRed-GFP as a template, the primer pair X3 / X2 was used to amplify the sequence library UPRE2m-TDH3p CORE-EforRed-GFP-CYC1t with mutations introduced in UPRE2. The annealing temperature for PCR amplification was 54 °C, and the extension was carried out at 72 °C for 65 s for 34 cycles.

[0112] (2) By the lithium acetate transformation method, the plasmid pROS10-X-3 was co-transformed with the repair fragment UPRE2m-TDH3p CORE-EforRed-GFP-CYC1t into the yeast strain IMX581. Fresh SC-URA medium was added, and it was cultured at 30 °C for 3 h and then spread on the SC-URA (added with 2 mM DTT) solid medium and cultured at 30 °C for 3 - 4 days to screen for positive transformants.

[0113] Example 5 Primary screening of the UPRE2m mutant library

[0114] The growth of the UPRE2m mutant library on the transformation plate is as shown in Figure 2 D in the figure.

[0115] (1) Observe the transformation clones under sunlight

[0116] Colonies of Saccharomyces cerevisiae expressing EforRed can appear pink; the stronger the expression intensity of EforRed, the darker the color of the colonies. Under daylight observation, mark the clones with darker colors.

[0117] (2) Observe the transformed clones under blue light

[0118] Under the blue light irradiation of a blue light instrument, observe the colonies on the plate and mark the clones with stronger fluorescence.

[0119] (3) Transfer the dominant clones to a new plate

[0120] Dip an inoculation loop into the dominant clones marked under daylight and blue light, and transfer them to fresh SC-URA solid medium. As shown by the white arrow in D of Figure 2 , the position of the dominant clone is indicated.

[0121] (4) Detect fluorescence in a 96-well plate

[0122] Inoculate the marked yeast colonies on the plate into 1 mL of SC-URA liquid medium, and culture them overnight at 30 °C and 200 rpm to prepare a seed solution. The next day, transfer the seed solution to fresh 1 mL of SC-URA liquid medium, and adjust the initial cell density of the bacterial solution to OD 600 ≈0.1. Culture the cells until OD 600 ≈0.3 - 0.4, then add the pressure-inducing chemical reagent DTT (final concentration 5 mM) and treat for 4 h. Pipette 200 μL of the bacterial solution into a 96-well plate, and perform 3 parallel replicates for each sample. Use the bacterial solution without expressing the fluorescent protein as a fluorescent background blank reference, and use a microplate reader to measure OD 600 , and measure the fluorescence intensity of GFP at an excitation wavelength of 485 nm and an emission wavelength of 525 nm to obtain the GFP fluorescence quantification value for selecting dominant clones based on daylight and blue light.

[0123] Example 6 Rescreen the UPRE2m mutant

[0124] Rescreen and verify the strains showing high fluorescence intensity in the preliminary screening. The rescreening verification is carried out in the strain X-3::gRNA-TDH3p CORE-RFP-CYC1t / IMX581, and the gRNA sequence used is 5’-CGTTTCTAAGGCCACTTTTC-3’.

[0125] (1) Construct the strain X-3::gRNA-TDH3p CORE-RFP-CYC1t / IMX581.

[0126] Using plasmid p416-UPRE2-TDH3p CORE-RFP-CYC1t (the construction process of this plasmid is shown in Example 8) as a template, primer pair XRP1 / X2 was used for PCR amplification; using the PCR product as a template, primer pair XRP3 / X2 was used for PCR amplification to obtain the homologous repair fragment gRNA-TDH3p CORE-RFP-CYC1t; by the lithium acetate transformation method, plasmid pROS10-X-3 and the repair fragment gRNA-TDH3p CORE-RFP-CYC1t were respectively transformed into strain IMX581. Coated on SC-URA solid medium and cultured at 30 °C for 3-4 days, single colony PCR verification was performed using primer pair JX3P1 / RFPP2, and the final PCR product was sent to Shanghai Sangon Biological Engineering Co., Ltd. for sequencing to screen for positive transformants, namely X-3::gRNA-TDH3p CORE-RFP-CYC1t / IMX581.

[0127] (2) Construction of plasmid pROS10-gRNA

[0128] Plasmid pROS10 contains two gRNA reverse expression cassettes. Using plasmid pROS10 as a template, the knockout plasmid framework was amplified by primer PSNR52. The annealing temperature for PCR amplification was 56 °C, the extension was at 72 °C for 150 s, and 34 cycles were amplified. Using plasmid pROS10 as a template, the fragment with a 20bp gRNA targeting the chromosomal neutral site was amplified by primer gRNAP1. Using Gibson assembly technology, the above two fragments were spliced together and transformed into Escherichia coli DH5α. The constructed plasmid was named pROS10-gRNA.

[0129] (3) PCR amplification of the repair fragment

[0130] Using the chromosome of the strain with high fluorescence intensity presented in the preliminary screening as a template, primer pair TDH3XP1 / TDH3XP2 was used for PCR amplification to obtain the homologous repair fragment UPRE2m-TDH3p CORE.

[0131] (4) By the lithium acetate transformation method, the UPRE2m-TDH3p CORE fragment and plasmid pROS10-gRNA were co-transformed into IMX581, coated on SC-URA solid medium, cultured at 30 °C for 3-4 days, single colony PCR verification was performed using primer pair JX3P1 / RFPP2, and positive transformants were screened.

[0132] (5) Fluorescence detection in microtiter plates

[0133] Inoculate the yeast colonies on the plate into 1 mL of SC-URA liquid medium and culture overnight at 30 °C and 200 rpm to prepare the seed solution. The next day, transfer the seed solution to fresh 1 mL of SC-URA liquid medium and adjust the initial cell density of the bacterial solution to OD 600 ≈0.1. When the cells are cultured to OD 600 ≈0.3 - 0.4, add the pressure-inducing chemical reagent DTT (final concentration 5 mM) and treat for 4 h. Pipette 200 μL of the cell suspension into a 96-well plate, and perform 3 parallel replicates for each sample. Use the bacterial solution without expressing the fluorescent protein as the fluorescent background blank reference, and use an enzyme-linked immunosorbent assay (ELISA) reader to measure OD 600 . Measure the fluorescence intensity of RFP at an excitation wavelength of 532 nm and an emission wavelength of 610 nm. The calculation formula for the change range value is: [the value of the DTT group (treatment group)] ÷ [the untreated group]. This value reflects the response ability of the element constructed in the present invention. The larger the change range, the stronger the response ability. The response activity of the highly active UPRE2m mutant is as shown in Figure 3 . For the control sample TDH3p, the change range is only about 1.3, and there is almost no change in the response ability. The change ranges of the constructs containing UPRE2m are mostly more than 10-fold. Figure 3 The results in

[0134] Example 7 Obtaining the sequence information of the UPRE2m element

[0135] Using the yeast cell lysate as a template, perform PCR amplification with the primer pair TDH3XP1 / TDH3XP2 to obtain a 217 bp fragment containing the UPRE2m sequence; the annealing temperature for PCR amplification is 56 °C, extend at 72 °C for 20 s, and perform 34 cycles of amplification. Send the PCR product to a sequencing company (Sangon Biotech Co., Ltd., Shanghai) for sequencing to obtain the sequence information of the UPRE2m element. The UPRE2m sequence is shown in Table 2.

[0136] Table 2 The sequence of highly active UPRE2m

[0137]

[0138] Example 8 Tandem of the UPRE2m element

[0139] The process of constructing the X-3::2×UPRE2m-TDH3p CORE-RFP-CYC1t / IMX581 strain is as follows:

[0140] (1) Construction of p416-UPRE2-TDH3p CORE-RFP-CYC1t plasmid

[0141] Using yeast genome as a template, the UPRE2-TDH3p CORE fragment was amplified by the primer pair UPRE2 P1 / TDH3P2; using plasmid P416-P TDH3 -RFP as a template, the p416 plasmid framework with homologous arms and the RFP-CYC1t fragment were amplified by the primer pairs PEGP1 / PEGP2 and TDH3-R P3 / X2 respectively. Using the fragment UPRE2-TDH3p CORE+RFP-CYC1t as a template, the UPRE2-TDH3p CORE+RFP-CYC1t fragment with homologous arms was amplified by the primer pair dxP3 / X2. The annealing temperature of PCR was 56 °C, extended at 72 °C for 180 s, and amplified for 34 cycles. Using Gibson assembly technology, the p416 plasmid framework and the UPRE2-TDH3p CORE+RFP-CYC1t fragment were spliced together and transformed into Escherichia coli DH5α. The constructed plasmid was named p416-UPRE2-TDH3pCORE-RFP-CYC1t.

[0142] (2) PCR amplification of 2×UPRE2m-TDH3p CORE-RFP-CYC1t fragment

[0143] With the primer pairs annealing and matching and serving as templates for each other, the 2×UPRE2m fragments 2×UPRE2, m94-m94, m86-m86, m84-m84, m94-m86, m94-m84, UPRE2-m86, and UPRE2-m84 were amplified by the primer pairs 2UPRE2 P1 / 2UPRE2 P2, m94 m94P1 / m94 P2, m86m86P1 / m86 P2, m84 m84P1 / m84 P2, m94 m86P1 / m86 P2, m94 m84P1 / m84 P2, UPRE2 m86P1 / m86 P2, and UPRE2 m84P1 / m84 P2 respectively. The annealing temperature of PCR amplification was 56 °C, extended at 72 °C for 15 s, and amplified for 34 cycles.

[0144] Using plasmid p416-UPRE2-TDH3p CORE-RFP-CYC1t as a template, the TDH3pCORE-RFP-CYC1t fragment was amplified by the primer pair TDH3P2 / X2. The annealing temperature of PCR was 56 °C, extended at 72 °C for 40 s, and amplified for 34 cycles.

[0145] Using the 2×UPRE2m fragment and the TDH3p CORE-RFP-CYC1t fragment as templates, the primer pair dxP3 / X2 was used for amplification to obtain the fragment 2×UPRE2m-TDH3p CORE-RFP-CYC1t containing the homologous arm of the neutral integration site X-3. The annealing temperature for PCR amplification was 56°C, with extension at 72°C for 60 s, and 34 cycles of amplification were performed.

[0146] (3) By the lithium acetate transformation method, the 2×UPRE2m-TDH3p CORE-RFP-CYC1t fragment and the plasmid pROS10-X-3 were co-transformed into IMX581, spread on SC-URA solid medium, and cultured at 30°C for 3 - 4 days. The primer pair JX3P1 / RFPP2 was used for single colony PCR verification to screen for positive transformants, such as X-3::m94-m84-TDH3p-RFP-CYC1t / IMX581, etc.

[0147] (4) Detection of RFP

[0148] The yeast colonies on the plate were inoculated into 1 mL of SC-URA liquid medium and cultured overnight at 30°C and 200 rpm to prepare the seed solution. The next day, the seed solution was transferred to fresh 1 mL of SC-URA liquid medium, and the initial cell density of the bacterial solution was adjusted to OD 600 ≈0.1, and the cells were cultured until OD 600 ≈0.3 - 0.4, and then treated with a pressure-inducing chemical reagent for 4 h. 200 μL of the cell suspension was aspirated into a 96-well plate, and 3 parallel replicates were performed for each sample. The bacterial solution without expressing the fluorescent protein was used as the fluorescent background blank reference, and the OD 600 was measured using a microplate reader, and the fluorescence intensity of RFP was measured at an excitation wavelength of 532 nm and an emission wavelength of 610 nm (the results are as Figure 4 shown). This result indicates that modular assembly of UPRE2m can further improve the response activity of the promoter.

[0149] Example 9 Position effect of UPRE2m in the promoter

[0150] The construction process of placing the element m94 at different positions upstream of the core region of the promoter TDH3p is as follows:

[0151] (1) PCR amplification of the homologous repair fragment

[0152] Using the plasmid P416-P TDH3Using -RFP as a template, PCR amplification was performed with primers X3-GPD P1 and primers GU 0P2, GU 50P2, GU100P2, GU 150P2, GU 200P2, GU 300P2, GU 400P2, GU 500P2 respectively to obtain fragments 0-1, 50-1, 100-1, 150-1, 200-1, 300-1, 400-1, 500-1 containing the upstream homologous arm of the neutral integration site X-3 and element m94 placed at different positions upstream of the core region of promoter TDH3p. The annealing temperature for PCR amplification was 56 °C, with extension at 72 °C for 30 s, and 34 cycles of amplification were performed.

[0153] Using plasmid P416-P TDH3 Using -RFP as a template, PCR amplification was performed with primers GU 0P1, GU 50P1, GU 100P1, GU 150P1, GU 200P1, GU 300P1, GU 400P1, GU 500P1 and primer X2 respectively to obtain fragments 0-2, 50-2, 100-2, 150-2, 200-2, 300-2, 400-2, 500-2 of -RFP-CYC1t with element m94 placed at different positions upstream of the core region of promoter TDH3p and the downstream homologous arm of the neutral integration site X-3. The annealing temperature for PCR amplification was 56 °C, with extension at 72 °C for 60 s, and 34 cycles of amplification were performed.

[0154] Using fragment combinations 0-1+0-2, 50-1+50-2, 100-1+100-2, 150-1+150-2, 200-1+200-2, 300-1+300-2, 400-1+400-2, 500-1+500-2 as templates respectively, fusion PCR amplification was performed with primer pair X3-GPD P1 / X2 to obtain the corresponding expression frame fragments containing the homologous arms of the X-3 integration site with element m94 placed at different positions upstream of the core region of promoter TDH3p. The annealing temperature for PCR amplification was 56 °C, with extension at 72 °C for 60 s, and 34 cycles of amplification were performed.

[0155] (2) By the lithium acetate transformation method, the response expression frame fragments with element m94 placed at different positions upstream of the core region of promoter TDH3p were co-transformed with plasmid pROS10-X-3 into yeast strain IMX581, spread on SC-URA solid medium, and cultured at 30 °C for 3-4 days. Single colony PCR verification was performed using primer pair JX3P1 / RFPP2 to screen for positive transformants.

[0156] (3) Detect RFP

[0157] Inoculate the yeast colonies on the plate into 1 mL of SC-URA liquid medium and culture overnight at 30 °C and 200 rpm to prepare the seed solution. The next day, transfer the seed solution to fresh 1 mL of SC-URA liquid medium and adjust the initial cell density of the bacterial solution to OD 600 ≈ 0.1. Culture the cells until OD 600 ≈ 0.3 - 0.4, and add pressure-inducing chemical reagents for treatment for 4 h. Pipette 200 μL of the cell suspension into a 96-well plate, and perform 3 parallel replicates for each sample. Use the bacterial solution that does not express the fluorescent protein as the fluorescent background blank reference, and use a microplate reader to measure OD 600 . Measure the fluorescence intensity of RFP at an excitation wavelength of 532 nm and an emission wavelength of 610 nm (results Figure 5 shown). The results show that the promoter containing the m94 element exhibits enhanced activity, and its response expression intensity is affected by the distance between the insertion site and the core promoter.

[0158] Example 10 Application of UPRE2m in Regulating Gene Targets of Recombinant Protein Expression Strains

[0159] Use PCR technology to insert the UPRE2m element m94 into the 5'-end (0 bp upstream) of the core region of the gene target promoter to regulate the gene targets of recombinant protein expression strains. A homologous recombination method with the antibiotic G418 marker was used to achieve the sequence integration of the UPRE2m regulatory element. The specific construction process is as follows:

[0160] (1) PCR amplification of homologous repair fragments

[0161] Using plasmid pROS13 as a template, the Kan expression frames E1, P1, and S1 containing the 5'-end homologous sequences of the upstream sequences of the ERO1p, PDI1p, and SEC24p promoters were amplified by primer pairs I-KERO1 P1 / I-KERO1 P2, I-KPDI1 P1 / I-KERO1 P2, and I-KSEC24 P1 / I-KERO1 P2 respectively. The annealing temperature for PCR amplification was 56 °C, and the extension was carried out at 72 °C for 50 s for 30 cycles.

[0162] Using yeast genomic DNA as a template, the fragments E2, P2, and S2 containing the m94 sequence and the homologous sequences of the core regions of the ERO1p, PDI1p, and SEC24p promoters were amplified by primer pairs I-KERO1 P3 / I-KERO1 P4, I-KPDI1 P3 / I-KPDI1 P4, and I-KSEC24P3 / I-KSEC24 P4 respectively. The annealing temperature for PCR amplification was 56 °C, and the extension was carried out at 72 °C for 50 s for 34 cycles.

[0163] Using E1+E2, P1+P2, S1+S2 as templates, homologous repair fragments E, P, and S with the m94 sequence inserted at the 3' end of the upstream sequences of the ERO1p, PDI1p, and SEC24p promoters containing the antibiotic marker Kan were amplified by primer pairs I-KERO1 P3 / I-KERO1 P6, I-KPDI1P1 / I-KPDI1P6, and I-KSEC24 P1 / I-KSEC24 P6, respectively. The annealing temperature for PCR amplification was 56°C, with extension at 72°C for 60 s, and 34 cycles of amplification were performed.

[0164] (2) Construct a recombinant protein expression strain using UPRE2m to regulate gene targets

[0165] By the lithium acetate transformation method, plasmid pAlphaAmyCPOT was transformed into strain MSBP003 to obtain strain MSBP003 / pAlphaAmyCPOT. Then, fragments E, P, and S were transformed into MSBP003 / pAlphaAmyCPOT, and the mixture was spread on YPD + 200 μg / ml G418 solid medium and cultured at 30°C for 3 - 4 days. Single colony PCR verification was performed using primer pairs JKERO P1 / KanaP2, JKPDIP1 / KanaP2, and JKSEC24 P1 / KanaP2, respectively, to screen for positive transformants. The transformants were inoculated into the fermentation medium SD - 2×SCAA and cultured at 30°C and 200 rpm for 96 h. After fermentation, the bacterial liquid was centrifuged at 12,000×g for 1 min, and the supernatant was taken for measuring the extracellular α-amylase activity. The measurement was completed using an α-amylase assay kit (K-CERA, Megazyme), and commercial Aspergillus oryzae α-amylase (Sigma-Aldrich) was used as a standard. The results Figure 6 showed that regulating gene targets using UPRE2m could increase the yield of recombinant proteins.

[0166] Example 11 Application of UPRE2m in enhancing the squalene yield of strains

[0167] The process of constructing a squalene-producing strain is as follows:

[0168] (1) Construct an inducible promoter expression plasmid

[0169] Using primers p426-K-F / p426-K-R, the plasmid framework was amplified with the p426GPD plasmid as the template; the annealing temperature was 56°C, extension was carried out at 72°C for 300 s, and 30 cycles of amplification were performed; using the primer pair Primer-A2F / Primer-A2R, a GAL7 promoter fragment with homologous arms was amplified with the yeast genome as the template; the annealing temperature for PCR amplification was 56°C, extension was carried out at 72°C for 20 s, and 30 cycles of amplification were performed; using the primer pair Primer-A3F / Primer-A3R, a tHMG1 fragment with homologous arms was amplified with the yeast genome as the template; the annealing temperature for PCR amplification was 54°C, extension was carried out at 72°C for 20 s, and 30 cycles of amplification were performed. Using Gibson assembly technology, the above three fragments were spliced together and transformed into Escherichia coli DH5α. The plasmid p426-GAL7p-tHMG1-CYC1t was constructed.

[0170] (2) Construction of constitutive promoter and responsive promoter expression plasmids

[0171] Using the plasmid p426-GAL7p-tHMG1-CYC1t as the template, the plasmid framework p426t containing tHMG1-CYC1t was amplified by the primer pair PHMG P1 / PHMG P2; using the plasmid P416-P TDH3 -RFP and the lysate of the X-3::m94-m84-TDH3p-RFP-CYC1t / IMX581 strain prepared in Example 8 as templates, the promoter fragments of TDH3p and m94-m84-TDH3p containing homologous arms were amplified by the primer pairs GPD-HMG P1 / GPD-HMG P2 and UGPD-HMG P1 / UGPD-HMG P2 respectively. The annealing temperature of PCR was 56°C, extension was carried out at 72°C for 240 s, and 34 cycles of amplification were performed. Using Gibson assembly technology, the p426t plasmid framework was spliced with the TDH3p and m94-m84-TDH3p promoter fragments respectively and transformed into Escherichia coli DH5α. The constructed plasmids were named p426-TDH3p-tHMG1 and p426-UTDH3p-tHMG1.

[0172] (2) By the lithium acetate transformation method, the plasmid was transformed into IMX581, spread on SC-URA solid medium, cultured at 30°C for 3 - 4 days, and single colony PCR verification was performed using the primer pair JHMG P1 / JHMG P2 to screen for positive transformants.

[0173] (3) Detection of squalene

[0174] The engineered Saccharomyces cerevisiae strain was inoculated into YPD medium and cultured at 30 °C and 200 rpm for 96 h. The fermentation broth was diluted 50-fold and then the OD was measured using an ultraviolet spectrophotometer. 600 500 μL of the fermented bacterial liquid, 1 mL of ethyl acetate and 0.7 g of zirconia beads (diameter 0.5 mm) were mixed in a 2 mL microcentrifuge tube and run at 6.5 m / min on a cell homogenizer (Allsheng, Bioprep-24R) for 2 minutes. The mixture was shaken and mixed well, and 800 μL of the organic phase supernatant was taken after centrifugation and filtered by suction. The squalene extract was injected into an Aminex HPX-87H column (Bio-Rad) and analyzed in an HPLC system (Shimadzu) with acetonitrile as the mobile phase at a flow rate of 1.2 mL / min at 25 °C. The results are as Figure 7 shown. The application of the UPRE2m element can effectively improve the squalene yield of the engineered strain.

[0175] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. A screening method for a highly active unfolded protein response element, characterized in that: The chromoprotein EforRed and the green fluorescent protein GFP were fused to form a reporter protein. Through the method of observing the chromoprotein by binding to a plate and quantitatively detecting the green fluorescent protein with an enzyme-labeled instrument, the preliminary screening of strains containing highly active unfolded protein response elements was achieved; subsequently, the preliminarily screened strains were verified a second time to obtain highly active response elements. The fusion was the fusion of the green fluorescent protein GFP at the C-terminus of the chromoprotein EforRed, and the linker used was (GGGGS)×3.

2. The screening method of the highly active unfolded protein response element according to claim 1, characterized in that It includes the following steps: (1) Construction of a recombinant vector with UPRE2 and a reporter gene: The coding nucleic acid of the fusion protein formed by the chromoprotein EforRed and the green fluorescent protein GFP was cloned onto an expression vector, and at the same time, a promoter with UPRE2 was inserted upstream of the coding nucleic acid to obtain a recombinant vector; the promoter with UPRE2 was that UPRE2 was set upstream of the core region of the promoter. (2) Construction of a UPRE2 mutant library: The recombinant vector obtained in step (1) was amplified with mutant primers with degenerate codons to obtain a repair fragment for integration with mutated UPRE2; since the repair fragment was amplified with mutant degenerate primers, the repair fragment also had diversity; the helper vector and the aforementioned repair fragment were transferred into a Saccharomyces cerevisiae engineering strain to achieve the integration of the repair fragment on the yeast chromosome, obtaining a UPRE2 mutant library with diverse fragment integration; the mutant primers with degenerate codons were primers that could introduce random mutations into the flanking sequence of UPRE2 through PCR technology; the repair fragment was a fragment in which the mutated UPRE2, the core region of the promoter, and the coding nucleic acid of the fusion protein were sequentially connected. (3) Preliminary screening: Observed under sunlight, the yeast clones with darker colors were marked; observed under blue light, the yeast clones with stronger fluorescence were marked; the yeast clones marked simultaneously under sunlight and blue light were preliminarily screened and transferred to a fresh SC-URA solid medium; then inoculated in an SC-URA liquid medium for culture, during which the stress inducer dithiothreitol was added, the bacterial solution was collected, and GFP fluorescence detection was performed to obtain the quantitative value of the GFP fluorescence intensity of the marked strain. (4) Re-screening: 1) Using the yeast clone with high fluorescence intensity marked simultaneously under sunlight and blue light obtained in step (3) as a template, the UPRE2m fragment was obtained; the UPRE2m fragment, the promoter, and the red fluorescent protein RFP were integrated onto the chromosome of the Saccharomyces cerevisiae engineering strain to obtain a recombinant yeast strain, where the red fluorescent protein RFP was located downstream of the promoter. 2) The recombinant yeast strain obtained in step 1) was cultured on a large scale, during which the stress inducer dithiothreitol was added, the bacterial solution was collected, and RFP fluorescence detection was performed to obtain a recombinant yeast strain with stronger fluorescence intensity. (5) Sequencing: UPRE2m was amplified from the recombinant yeast strain with stronger fluorescence intensity and sequenced to obtain a highly active unfolded protein response element. The sequence of the aforementioned UPRE2 is 5’-ATACGGAGTACGTGTCATAAAAAC-3’, and its core sequence is 5’-TACGTG-3’; The aforementioned auxiliary vector is a yeast fungal gene knockout gene editing vector with gRNA targeting the chromosomal neutral integration site.

3. The screening method for highly active unfolded protein response elements according to claim 2, wherein: In step (1): The aforementioned expression vector is the high-copy plasmid p426GPD or the low-copy plasmid p416GPD; In step (2): The aforementioned engineered Saccharomyces cerevisiae strain is a strain with a CEN.PK background.

4. The screening method for highly active unfolded protein response elements according to claim 3, wherein: The sequence of the coding nucleic acid of the chromoprotein EforRed is as shown in Seq ID No.1; The sequence of the coding nucleic acid of the green fluorescent protein GFP is as shown in Seq ID No.2; The sequence of the coding nucleic acid of the linker is as follows: GGCGGTGGTGGTTCCGGTGGTGGTGGTTCTGGTGGTGGTGGTTCT; The promoter described above is TDH3 p,[[]] TEF1 p,[[]] TPI1 p or CYC1 p; The repair fragment is a fragment obtained by introducing random mutations into the flanking sequence of UPRE2 using the DNA fragment UPRE2- TDH3 p CORE-EforRed-GFP- CYC1 t as a template through PCR technology; The aforementioned chromosomal neutral integration site is the X3 site; The aforementioned yeast fungal gene knockout gene editing vector is pROS10; The aforementioned engineered Saccharomyces cerevisiae strain is the yeast strain IMX581.

5. The screening method for highly active unfolded protein response elements according to claim 2, wherein: In step (3): The aforementioned blue light is light with a wavelength of 450 - 500 nm; The addition time of the pressure inducer dithiothreitol is when the cell density OD of the culture solution is 600 ≈0.2 - 0.5; The dosage of the stress inducer dithiothreitol is a concentration of 1 mM - 8 mM in the culture medium; The treatment time of the stress inducer dithiothreitol is 2 h - 6 h; The conditions for fluorescence detection are as follows: 200 μL of the cell suspension is pipetted into a 96-well plate, and the OD is measured using a microplate reader. 600 The fluorescence intensity of GFP is measured at an excitation wavelength of 485 nm and an emission wavelength of 525 nm.

6. The screening method for highly active unfolded protein response elements according to claim 2, wherein: In step (4): Step 1) is: First, construct a yeast strain with a red fluorescent protein RFP fragment with a promoter integrated on the chromosome; then, using the yeast clones simultaneously labeled under sunlight and blue light obtained in step (3) as a template, obtain the UPRE2m fragment; integrate the UPRE2m fragment upstream of the promoter in the red fluorescent protein RFP fragment with a promoter to obtain a recombinant yeast strain.

7. The screening method for highly active unfolded protein response elements according to claim 6, wherein: The sequence of the coding nucleic acid of the red fluorescent protein RFP is as shown in SEQ ID NO.3; The integration site described in step 1) is the X3 site; The medium for the amplification culture described in step 2) is SC-URA medium; The conditions for the amplification culture described in step 2) are culture at 28 - 32 °C and 150 - 250 rpm; The addition time of the pressure inducer dithiothreitol described in step 2) is when the cell density OD of the culture medium 600 ≈0.2 - 0.5; The dosage of the stress inducer dithiothreitol described in step 2) is a concentration of 1 mM - 8 mM in the culture medium; The treatment time of the stress inducer dithiothreitol described in step 2) is 2 h - 6 h; The conditions for fluorescence detection described in step 2) are as follows: 200 μL of the cell suspension is aspirated into a 96-well plate, and the OD is measured using a microplate reader. 600 The fluorescence intensity of RFP is measured at an excitation wavelength of 532 nm and an emission wavelength of 610 nm.

8. A highly active unfolded protein response element, characterized in that: Obtained by the screening method according to any one of claims 1 to 7, which are m77 to 97 corresponding in sequence to the nucleotide sequences shown in SEQ ID NOs. 12 to 32.

9. Use of the highly active unfolded protein response element according to claim 8 in the preparation of a modular unfolded protein response element, characterized in that: The modular unfolded protein response element is m94-m94, m86-m86, m84-m84, m94-m86, m94-m84, UPRE2-m86 or UPRE2-m84; The nucleotide sequence of the UPRE2 is as shown in SEQ ID NO.

5.

10. A modular unfolded protein response element, characterized in that: The modular unfolded protein response element is m94-m94, m86-m86, m84-m84, m94-m86, m94-m84, UPRE2-m86 or UPRE2-m84; The nucleotide sequence of the UPRE2 is as shown in SEQ ID NO. 5; The nucleotide sequence of the m84 is as shown in SEQ ID NO. 19; The nucleotide sequence of the m86 is as shown in SEQ ID NO. 21; The nucleotide sequence of the m94 is as shown in SEQ ID NO.

29.

11. Use of the highly active unfolded protein response element according to claim 8 or the modular unfolded protein response element according to any one of claims 9 to 10 in the expression of exogenous proteins, characterized in that Comprising the following steps: setting the highly active unfolded protein response element according to claim 8 or the modular unfolded protein response element according to any one of claims 9 to 10 upstream of the core region of the gene promoter that regulates the expression of the recombinant protein.

12. Use of the highly active unfolded protein response element according to claim 8 or the modular unfolded protein response element according to any one of claims 9 to 10 in increasing the yield of natural products, characterized in that: It is to use the highly active unfolded protein response element according to claim 8 or the modular unfolded protein response element according to any one of claims 9 to 10 and set it upstream of the core region of the promoter connected to the enzyme catalyzing the synthesis of natural products.

Images