A molecular marker tightly linked to the major locus RT.A10 of root size in rapeseed and its application

Abstract

The invention belongs to the technical field of molecular biology and genetic breeding, and specifically relates to a main effect locus related to rapeseed root size. RT.A10 Tightly linked molecular markers and their applications. This invention locates for the first time the major gene loci controlling the root size of rapeseed on the A10 linkage group Rt.A10 , which can explain 13.2% of the phenotypic variation, and obtain a SNP marker closely linked to the site, located at the 14708990th base position on chromosome A10 of the Darmor.v4.1 genome. Based on the SNP variation, the KASP molecular marker A10-1470 was designed. By typing this marker, the root size of rapeseed plants can be predicted, and then individual plants with excellent root systems can be quickly and accurately screened.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and genetic breeding, and particularly relates to a molecular marker tightly linked to a major effect locus RT.A10 of rapeseed root size and an application thereof. Background Art

[0002] The root system is an important organ of plants. It is responsible for fixing plants, storing carbohydrates, and transporting water, mineral nutrients and hormones to the aboveground parts. Excellent root system architecture is the basis for the formation of high crop biomass and yield. A well-developed root system is not only conducive to fixing plants, but also conducive to the absorption and utilization of water and nutrients, as well as the synthesis, secretion and transport of plant hormones (Gruber et al 2013, Kellermeier et al 2014). Studies have shown that changes in the root system architecture of crops such as rice (Uga et al 2013), wheat (Rebetzke et al 2022), corn (Yan et al 2022), soybean (Yang et al 2021) and rapeseed (Pongracet al 2020, Wang et al 2020a) can affect their biomass and yield. Therefore, constructing an excellent root system architecture and improving the efficiency of nutrient and water utilization by rapeseed roots is one of the important ways to increase rapeseed biomass, yield per unit area and total yield.

[0003] In recent years, people have gradually realized the importance of analyzing the molecular mechanism of root traits for crop genetic improvement, and relevant work has been carried out. At present, hundreds of QTLs significantly associated with root traits have been obtained in crops such as wheat, sorghum, soybean, rice, corn and rapeseed, involving multiple root traits such as root fresh weight, root dry weight, rhizome thickness, total root length, total root number and root activity. Uga et al. (2013, 2015) successfully located four QTLs (DEEPER ROOTING1 (DRO1), DRO2, qSOR1, DRO3) that control the root angle of rice, which are located on chromosomes 9, 4, 7 and 7 of rice, respectively. Delhaize et al. (2015) screened six QTLs regulating rhizosphere size through two MAGIC wheat populations, explaining 42% of the phenotypic variation. Ju et al. (2018) detected a total of 36 QTLs related to root traits in the maize recombinant inbred line Zong3×Yu87–1, and 4 QTLs related to root traits were co-located with yield traits. Liu et al. (2021b) obtained the main effect locus QMrl by performing QTL scanning on wheat root length, and further verified it using near-isogenic lines, and found that the root length, root area and root dry weight of A-NILs were higher than those of B-NILs at the seedling stage, jointing stage and maturity stage. These studies show the effectiveness of using QTL scanning to study root-related traits and obtain the main effect QTL that regulates root development, as well as the important breeding application value of the above QTL L in improving root system and thus improving plant productivity.

[0004] The present invention aims to find gene loci that have an improvement effect on rapeseed root traits through scanning, detection and positioning of rapeseed root size QTLs, which can be used for marker-assisted selection in rapeseed root breeding improvement, and provide technical support for rapeseed high biomass and high yield breeding from the perspective of root morphology construction. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP molecular marker tightly linked to the main effect site RT.A10 of rapeseed root size, which is located at the 14708990th base on the A10 chromosome of the publicly published Brassica napus Darmor.v4.1 genome.

[0006] Another object of the present invention is to provide an application of a molecular marker tightly linked to the main effect locus RT.A10 of rapeseed root size in the breeding of rapeseed root configuration. By detecting the genotype of the 14708990th base on the A10 chromosome of the Darmor.v4.1 genome of Brassica napus, the screening and breeding of excellent rapeseed roots can be achieved.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] Obtaining the main QTL locus RT.A10 for rapeseed root size:

[0009] (1) F1 was constructed by hybridizing Zhongshuang 11 and 4D122 (“Using the remaining heterozygous lines to locate the major QTL locus RT.C08 for root development in rapeseed”). After six generations of continuous self-pollination by single seed propagation, F1 was selected. 2:6 The 267 families in the next generation constituted the recombinant inbred line population (RIL population).

[0010] (2) Individual leaves of 267 lines in the above RIL population and the parents of Shuang11 and 4D122 were collected, and total DNA was extracted by CTAB method. The rapeseed 50K SNP chip developed by Wuhan Shuanglvyuan Chuangxin Technology Research Institute Co., Ltd. using Illumina's Infinium SNP chip technology was used to analyze the genotype of each sample. The genotype of the population was consistent with the genotype of the parent ZS11, and the genotype consistent with the parent 4D122 was represented by "2", and the heterozygous genotype was represented by "1". The genetic type of polymorphic loci in the population was statistically analyzed, and the rapeseed genetic map based on SNP markers was constructed using Joinmap 4.0 analysis software. Among the 28,491 loci on the SNP chip, a total of 6,407 markers were integrated into the linkage map.

[0011] (3) The root traits (including root fresh weight, root dry weight, number of lateral roots, total root length, root surface area, etc.) of 7 individuals from each of the 267 lines of the RIL population and the parents, Shuang 11 and 4D122, were measured at maturity using the field root digging method, and the average values ​​were calculated.

[0012] (4) Using the genotype data of the RIL population and the field root phenotype data, the composite interval mapping method of WinQTLCart 2.5 software was used to perform QTL detection scanning. Finally, the major QTL locus RT.A10 controlling the fresh weight of rapeseed root was detected on chromosome A10, with the maximum contribution rate to this trait being 13.2%.

[0013] (5) A SNP marker closely linked to RT.A10 was detected in the RT.A10 positioning interval. The SNP mutation site (variation from A to C) is located at base 14708990 on chromosome A10 of the Brassica napus Darmor.v4.1 genome (http: / / cbi.hzau.edu.cn / bnapus / index.php).

[0014] The use of a reagent for detecting the 14708990th base on chromosome A10 of the Darmor.v4.1 genome of Brassica napus in screening and breeding of excellent root systems of rapeseed falls within the protection scope of the present invention.

[0015] The reagents described above are preferably primers. The detection primers designed using conventional SNP detection methods in the art can achieve the above applications, including but not limited to HRM technology, TaqMan probe detection method, ARMS-PCR, CAPS method, and KASP method.

[0016] In the above application, the applicant developed KASP marker A10-1470 based on the above SNP site, and the primers designed based on the marker are:

[0017] RT.A10 root freshness allele-specific primer A10-1470-F1: GTCTTCTGGTGGTGGATGAG AA

[0018] RT.A10 root fresh weight small allele specific primer A10-1470-F2: GTCTTCTGGTGGTGGATGAG AC

[0019] Reverse primer A10-1470-R: ATTACAGAATATGGGTCTACCGAGA.

[0020] The above primers must be developed according to the principles of KASP labeling and must be added with a KASP-labeled universal adapter before use.

[0021] In the above application, the breeding is the screening breeding of rapeseed root fresh weight.

[0022] Beneficial effects of the present invention:

[0023] (1) The present invention locates the major QTL locus that controls root size in rapeseed under field conditions. This locus can explain 13.2% of the phenotypic variation and can be effectively applied to the genetic improvement of excellent root architecture in rapeseed.

[0024] (2) For the first time, the study discovered a molecular marker A10-1470 that was tightly linked to the major QTL locus Rt.A10 for rapeseed root size, providing a reliable source of molecular markers for pre-selection of rapeseed root size.

[0025] (3) The molecular marker A10-1470 can be used to quickly screen rapeseed varieties or lines for excellent alleles of the main QTL locus RT.A10 that controls the rapeseed root system during the rapeseed seedling growth period. This can greatly reduce the workload of breeding screening, shorten the breeding cycle, and accelerate the breeding process for rapeseed root system improvement. DETAILED DESCRIPTION

[0026] The technical solutions described in the present invention, unless otherwise specified, are all conventional technologies in the art; the reagents or materials described, unless otherwise specified, are all from commercial channels.

[0027] Embodiment 1:

[0028] Obtaining the main QTL locus Rt.A10 for rapeseed root size:

[0029] (1) F1 was constructed by hybridizing the parent Shuang 11 and 4D122. After six generations of continuous self-pollination by single seed propagation, F 2:6 The 267 families in the next generation constituted the recombinant inbred line population (RIL population).

[0030] (2) Individual leaves of 267 lines in the above RIL population and the parents of Shuang11 and 4D122 were collected, and total DNA was extracted by CTAB method. The rapeseed 50K SNP chip developed by Wuhan Shuanglvyuan Chuangxin Technology Research Institute Co., Ltd. using Illumina's Infinium SNP chip technology was used to analyze the genotype of each sample. The genotype of the population was consistent with the genotype of the parent ZS11, and the genotype consistent with the parent 4D122 was represented by "2", and the heterozygous genotype was represented by "1". The genetic type of polymorphic loci in the population was statistically analyzed, and the rapeseed genetic map based on SNP markers was constructed using Joinmap 4.0 analysis software. Among the 28,491 loci on the SNP chip, a total of 6,407 markers were integrated into the linkage map.

[0031] (3) The root traits (including root fresh weight, root dry weight, number of lateral roots, total root length, root surface area, etc.) of 7 individuals from each of the 267 lines of the RIL population and the parents, Shuang 11 and 4D122, were measured at maturity using the field root digging method, and the average values ​​were calculated.

[0032] (4) Using the genotype data of the RIL population and the field root phenotype data, the composite interval mapping method of WinQTLCart 2.5 software was used to perform QTL detection scanning. Finally, the major QTL locus RT.A10 controlling the fresh weight of rapeseed root was detected on chromosome A10, with the maximum contribution rate to this trait being 13.2%.

[0033] Table 1: Basic information of the major QTL locus RT.A10 for the number of lateral roots in linkage group A10

[0034]

[0035] RFW20 and RFW21 represent the field traits investigated at the Yangluo Experimental Base of the Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences in 2020 and 2021, respectively. 2 Indicates the phenotypic contribution of the site.

[0036] Embodiment 2:

[0037] Obtaining a molecular marker primer tightly linked to the major QTL locus Rt.A10 of root size in rapeseed

[0038] (1) Based on the SNP marker information in the initial positioning interval of Rt.A10 on the genetic linkage group of the RIL population, it was found that there was a variation from A to C at the 14708990th base position on the A10 chromosome of the publicly published Brassica napus Darmor.v4.1 genome, which was closely linked to Rt.A10. The 100 bp sequence upstream and downstream of the base was extracted, and the KASP (Kompetitive Allele-Specific PCR, i.e. competitive allele-specific PCR) molecular marker primer design principle was used to develop the KASP molecular marker A10-1470. The marker includes two competitive forward primers A10-1470-F1 and A10-1470-F2, which correspond to the sequence bases A and C of the above-mentioned SNP variation site, respectively, and a reverse universal primer A10-1470-R. The primer sequences are as follows:

[0039] A10-1470-F1:GTCTTCTGGTGGTGGATGAGAA

[0040] A10-1470-F2:GTCTTCTGGTGGTGGATGAGAC

[0041] A10-1470-R:ATTACAGAATATGGGTCTACCGAGA

[0042] The above primers must be developed according to the principles of KASP labeling and must be added with a KASP-labeled universal adapter before use.

[0043] The linker sequence added before A10-1470-F1 is GAAGGTCGGAGTCAACGGATT, and the linker sequence added before A10-1470-F2 is GAAGGTGACCAAGTTCATGCT.

[0044] The sequence amplified in Brassica napus ZS11 is genotype A (i.e., AA genotype, synergistic genotype), and the sequence is as follows:

[0045] GTCTTCTGGTGGTGGATGAGAAAATTTTATGAAAGAGAAATGGTCTCGGTAGACCCATATTCTGTAAT.

[0046] The sequence amplified in Brassica napus 4D122 was of genotype B (i.e., CC genotype), and the sequence was as follows: GTCTCTGGTGGTGGATGAGACAATTTTATGAAAGAGAAATGGTCTCGGTAGACCCATATTCTGTAAT.

[0047] (2) The competitive allele-specific PCR technique was used to genotype the markers in the near-isogenic line of rapeseed Rt.A10. The amplification kit used was the five-primer amplification blocked mutation system (PAMS). According to the instructions of the PAMS pro SNPGentyping PCR mix kit, a 10uL reaction system was designed: 2×PARMS master mix 5μL, Allele Xprimer (10μM) 0.15μL, Allele Y primer (10μM) 0.15μL, Common R primer (10μM) 0.4μL, rapeseed genomic DNA 10-100ng. The amplification program was: 94℃15min; 94℃20s, 65-57℃ (Touch-down) 1min, 10 cycles; 94℃20s, 57℃1min, 30 cycles; collect the fluorescence signal once and output the genotype results, which clearly showed that A10-1470 was significantly associated with the main effect QTL locus Rt.A10 of rapeseed root size.

[0048] Embodiment 3:

[0049] Application of a molecular marker primer closely linked to the main effect QTL locus Rt.A10 of rapeseed root size in rapeseed root architecture breeding, the application process comprising:

[0050] The F1 obtained by hybridizing the parents Zhongshuang 11 and 4D122 was used for continuous backcrossing with Zhongshuang 11. The BC1F1, BC2F1 and BC3F1 materials were analyzed by the markers on the left and right sides of the main effect QTL site Rt.A10. In each generation, the heterozygous individual plants of the main effect QTL site Rt.A10 were selected for backcrossing. Finally, the heterozygous individual plants were selected for bagging and self-pollination in BC4F1 to obtain BC4F2 seeds. The root trait phenotype of the BC4F2 individual plants was identified at the mature stage in the field; at the same time, the genotype of each BC4F2 individual plant was determined by A10-1470. The genotype consistent with Zhongshuang 11 was recorded as "A", the genotype consistent with 4D122 was recorded as "B", and if there was an individual plant with the genotype of both Zhongshuang 11 and 4D122, it was a heterozygous genotype recorded as "H". The results are shown in Table 2.

[0051] Table 2: BC4F2 population root fresh weight data obtained using A10-1470

[0052] genotype <![CDATA[Average fresh root weight (g) of BC4F2 population]]> Number of plants AA 52.3 103 BB 38.9 87 HH 42.1 212 Group mean 44.0 402

[0053] The data in the table are the mean fresh root weights of the genotypes in the population. The phenotypic data of the two populations were analyzed and the results showed that the fresh root weights of the AA genotype, BB genotype and HH genotype in the BC4F2 population all reached significant differences (P<0.05) after T test.

[0054] The above results are sufficient to show that the molecular marker A10-1470 prepared by us can be used for molecular marker-assisted selection of rapeseed root size.

Claims

1. Use of a reagent for detecting the 14708990th base on chromosome A10 of the Darmor.v4.1 genome of Brassica napus in the screening and breeding of excellent root systems of Brassica napus; using the reagent for detection, if the SNP site is detected to be an AA genotype, it indicates that the root fresh weight of the Brassica napus is high; if the SNP site is detected to be a CC genotype, it indicates that the root fresh weight of the Brassica napus is low, and the parents of the Brassica napus are Zhongshuang 11 and 4D122.

2. The use according to claim 1, wherein the reagent is a primer.

3. The use according to claim 2, wherein the primers are: A10-1470-F1: GTCTTCTGGTGGTGGATGAGAA, A10-1470-F2: GTCTTCTGGTGGTGGATGAGAC and reverse A10-1470-R: ATTACAGAATATGGGTCTACCGAGA.

4. The use according to claim 1, wherein the breeding is screening breeding of Brassica napus root fresh weight.

Images