Cucumber CsHMGR1 gene and its application in resisting Fusarium wilt
By constructing transgenic material overexpressing the CsHMGR1 gene in cucumber, the content of mevalonic acid in root exudates was increased, which solved the problem of cucumber wilt disease and achieved effective enhancement of cucumber's resistance to wilt disease.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-13
- Publication Date
- 2026-04-03
AI Technical Summary
Frequent outbreaks of cucumber wilt disease severely affect the high-quality and efficient cultivation of cucumbers. The wilt resistance function of the cucumber CsHMGR1 gene has not been reported in existing technologies.
We constructed transgenic material overexpressing the CsHMGR1 gene in cucumber to increase the content of mevalonic acid in root exudates and enhance the resistance of cucumber to Fusarium wilt.
By overexpressing the CsHMGR1 gene, the content of mevalonic acid in cucumber root exudates was significantly increased, enhancing the resistance of cucumber to Fusarium wilt and providing innovative germplasm materials with high resistance to Fusarium wilt.
Smart Images

Figure CN117925653B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a cucumber CsHMGR1 gene and its application in resisting Fusarium wilt, belonging to the fields of genetic engineering and molecular biology. Background Technology
[0002] Cucumber (Cucumis sativus L., 2n=2x=14) is an annual vine-like herbaceous plant belonging to the Cucurbitaceae family and the Cucumis genus. Originating in the southern foothills of the Himalayas, it is one of the world's ten most important vegetable crops and a major vegetable crop in my country. According to statistics from the Food and Agriculture Organization of the United Nations, in 2021, my country's cucumber cultivation area reached 1.292 million hectares, with an annual output of 75.6 million tons, accounting for 59.5% and 80.8% of the world's total, respectively. However, with the expansion of greenhouse cucumber cultivation, cucumber wilt disease has become frequent, seriously restricting the high-quality and efficient cultivation of cucumbers.
[0003] Cucumber wilt is a devastating soil-borne fungal disease caused by *Fusarium oxysporum* f.sp. *cucumerinum* (Foc). This pathogen has an extremely long incubation period and can affect all stages of cucumber growth and development, especially in the mid-to-late stages. The incidence increases as plant vigor declines, and in severe cases, it can lead to complete crop failure. Continuous cropping in greenhouse cucumber cultivation causes a continuous accumulation of *Fusarium wilt* pathogens in the soil, exacerbating the disease's damage. Therefore, identifying candidate genes in cucumber and applying them to verify *Fusarium wilt* resistance and to innovate germplasm is of significant production importance.
[0004] The protein encoded by the cucumber CsHMGR1 (CsaV3_6G009990) gene belongs to the 3-hydroxy-3-methylglutaryl-CoA reductase family and is a key enzyme in the mevalonic acid (MA) synthesis pathway, catalyzing the conversion of 3-hydroxy-3-methylglutaryl-CoA to MA (Park et al., 2022; Balsells-Llauradó et al., 2023). Studies have shown limited research on the MA synthesis pathway in plants, but related regulatory genes and metabolites such as isoprene and terpenoids play important roles in plant defense against biotic stress (Zhang et al., 2008; Manzano et al., 2016; Pu et al., 2021; Cho et al., 2022). In cotton, the GaWRKY1 transcription factor can bind to the HMGR gene and regulate downstream cytochrome oxidase CYP706B1 and methyltransferase to promote the synthesis of the phytoprotectant gossypol, thereby improving cotton's disease resistance and yield (Tian et al., 2016). In solanaceous crops, the ethylene-responsive factor GAME9 can directly or synergistically regulate the expression of the HMGR1 gene, thereby promoting the synthesis of steroidal glycoside alkaloids and defending against pests and diseases (Cárdenas et al., 2016). In alfalfa, the E3 ubiquitin ligase gene MKB1 can regulate the activity of the HMGR protein, promoting the increase of defense-related metabolites sterols and triterpenoid saponins (Pollier et al., 2013). However, the function of the CsHMGR1 gene and its resistance to Fusarium wilt in cucumber has not been reported. Summary of the Invention
[0005] The purpose of this invention is to address the above-mentioned problems by providing a cucumber CsHMGR1 gene and its application in resisting Fusarium wilt. This invention provides the cucumber CsHMGR1 gene (sequence shown in SEQ ID NO: 1) and its encoded protein (sequence shown in SEQ ID NO: 2), and the application of CsHMGR1 gene overexpression transgenic materials in increasing the content of mevalonic acid in secretions and resistance to Fusarium wilt.
[0006] A cucumber CsHMGR1 gene, the sequence of which is shown in SEQ ID NO: 1. The protein sequence it encodes is shown in SEQ ID NO: 2.
[0007] The present invention also discloses the application of the cucumber CsHMGR1 gene in constructing CsHMGR1 cucumber overexpression transgenic materials, which can increase the content of mevalonic acid in root exudates and resistance to Fusarium wilt.
[0008] This invention provides the application of the CsHMGR1 gene in improving resistance to cucumber wilt disease.
[0009] This invention provides the CsHMGR1 gene sequence of cucumber and the protein sequence it encodes. It also provides the use of this gene for constructing CsHMGR1 overexpression transgenic material in cucumber, which can increase the content of mevalonic acid in root exudates and enhance resistance to Fusarium wilt. This invention is the first to construct CsHMGR1 overexpression transgenic material in cucumber and conduct functional studies, discovering that this gene plays a regulatory role in resistance to Fusarium wilt.
[0010] Compared with existing technologies, this invention has the following beneficial effects: This invention utilizes transgenic technology to construct cucumber CsHMGR1 overexpression materials and conducts functional studies on the CsHMGR1 gene. Experiments demonstrate that the mevalonic acid content in the root exudates of cucumber CsHMGR1 overexpression materials increases, and resistance to Fusarium wilt is enhanced, indicating that the CsHMGR1 gene plays a positive regulatory role in cucumber resistance to Fusarium wilt. The discovery of this new function of the CsHMGR1 gene in cucumber provides a basis for innovating cucumber germplasm materials with high resistance to Fusarium wilt and has promising application prospects. Attached Figure Description
[0011] Figure 1 Image of cucumber CsHMGR1 gene overexpression vector;
[0012] Figure 2 The cucumber CsHMGR1 gene regulates mevalonic acid content and resistance to Fusarium wilt;
[0013] Figure a shows the difference in CsHMGR1 gene expression levels between cucumber CsHMGR1 overexpression lines (OE) and wild-type (WT); Figure b shows the phenotypic differences between cucumber CsHMGR1-OE and WT lines after inoculation with Fusarium wilt and water for 15 and 20 days; Figure c shows the disease severity index of cucumber CsHMGR1-OE and WT lines after inoculation with Fusarium wilt for 15, 20, 25, and 30 days; Figure d shows the content of mevalonic acid in root exudates of cucumber CsHMGR1-OE and WT lines. Detailed Implementation
[0014] To make the objectives, technical solutions, and advantages of the present invention clearer, the specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.
[0015] The cucumber inbred line superina'SUP11, the germplasm material used in this invention, was published in the journal Molecular Plant Breeding in 2017 with the title "Isolation and Identification of Cucumber Fusarium wilt and Analysis of Variety Resistance Differences" (Dong Jingping et al., 2017). The cucumber inbred line 'CCMC' is a commercial variety of Changchun Mici purchased by the laboratory. After continuous self-pollination and purification, it was published in The Plant Journal in 2023 with the title "A CsEIL3-CsARN6.1 module promotes waterlogging-triggered adventitious root formation in cucumber by activating the expression of CsPrx5" (Xu et al., 2023). The above germplasm resources are preserved in the applicant's laboratory germplasm bank.
[0016] Example 1:
[0017] I. Obtaining the full-length sequence of the cucumber CsHMGR1 gene:
[0018] Using cDNA from the roots of cucumber inbred line 'SUP11' as a template, cloning primers CsHMGR1-F and CsHMGR1-R were designed, and PCR amplification was performed using high-fidelity DNA polymerase.
[0019] The primer sequences are:
[0020] CsHMGR1-F: 5'-ATGGACGCCCGCCGCCGC-3' (SEQ ID NO: 3)
[0021] CsHMGR1-R: 5'-TGAGGAAGAAGCTTTAGTGATATCTCTAC-3' (SEQ ID NO: 4)
[0022] The PCR system consisted of 50 μL of the following components: 25 μL of 2×Phanta Flash Master Mix, 2 μL of template, 2 μL each of forward and reverse primers, and 19 μL of ddH2O. The PCR reaction program was as follows: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 60℃ annealing for 5 seconds, and 72℃ extension for 2 minutes, for a total of 35 cycles; and a final extension at 72℃ for 1 minute. The obtained PCR products were identified by 1% agarose gel electrophoresis. The target band was then purified using a Takara gel extraction kit. The product was ligated into the PMD19-T vector (Takara), and the recombinant plasmid was sent for assay.
[0023] The nucleotide sequence of the CsHMGR1 gene is shown in SEQ ID No. 1; the amino acid sequence encoded by this gene is shown in SEQ ID No. 2.
[0024] II. Construction and Detection of Cucumber CsHMGR1 Gene Overexpression Material:
[0025] Using the overexpression vector pCAMBIA1305.4 (purchased from Weimi Biotechnology (Jiangsu) Co., Ltd.), homologous recombination primers were designed based on the sequence of the CsHMGR1 gene (SEQ ID No. 1). The sequences were pCAMBIA1305.4-CsHMGR1-F:5'-GAGAACACGGGGGACTCTAGAATGGACGCCCGCCGCCGC (SEQ ID No. 5); pCAMBIA1305.4-CsHMGR1-R:GGGAAATTCGAGCTCACTAGTTGAGGAAGAAGCTTTAGTGATATCTCTAC (SEQ ID No. 6). The CsHMGR1 gene was amplified, and the amplified gene was subjected to agarose gel electrophoresis and recovered for later use. The vector pCAMBIA1305.4 was linearized using restriction endonucleases XbaⅠ and SpeⅠ. The vector was constructed using the ClonExpress Ultra One Step Cloning Kit, and the recombinant product was transformed into *E. coli* DH5α competent cells. The recombinant product was then processed using Kansas. + Resistant bacteria were screened using culture media, and positive clones were screened by colony PCR. The identification primers were pCAMBIA1305.4-CsHMGR1-F / R (SEQ ID No. 5 and 6), and the positive clones were sequenced and verified by a bio-sequencing company. After successful sequencing, the plasmid was extracted and named pCAMBIA1305.4-CsHMGR1 (…). Figure 1 ).
[0026] The successfully constructed pCAMBIA1305.4-CsHMGR1 vector was transformed into Agrobacterium LBA4404 strain. After PCR identification, it was used to infect the cotyledonary nodes of cucumber inbred line 'CCMC'. Tissue culture seedlings were obtained through callus induction, resistance induction differentiation, and rooting culture. The obtained regenerated plants were identified using primers for the vector antibiotic gene AADA: AADA_F: TCCGACATCGATCTCCTGGT (SEQ ID No. 7); AADA_R: CAGGGTGAGGACCACATTCC (SEQ ID No. 8); and specific primers designed based on the CsHMGR1 gene and vector CaMV 35S promoter sequence: CsHMGR1_T_F: TTGTGAAGATAGTGGAAAAGG (SEQ ID No. 9); CsHMGR1_T_R: TAAATGAAGGAAGCAATGAAG (SEQ ID No. 10). Five transgenic positive plants were obtained in the end. After single-plant self-pollination, T3 generation plants were obtained for subsequent experimental analysis.
[0027] III. Study on the regulation of mevalonic acid content and resistance to Fusarium wilt in cucumber CsHMGR1 gene overexpression materials:
[0028] RNA was extracted from the CsHMGR1 overexpressing plants and WT (TaKaRa MiniBEST Universal RNA Extraction Kit), and the expression level of the CsHMGR1 gene was verified using real-time quantitative PCR (qRT-PCR). qRT-PCR primers were designed based on the CsHMGR1 gene sequence: CsHMGR1_qPCR_F: CCTTCATTGCTTCCTTCATT (SEQ ID No. 11); CsHMGR1_qPCR_R: TACGACCTCATCATCTTCAG (SEQ ID No. 12). The results are as follows: Figure 2 As shown in a, the expression level of the CsHMGR1 gene in the four transgenic lines (OE_1,2,3,5) was significantly higher than that in the WT plants. Figure 2 a).
[0029] To further analyze the relationship between CsHMGR1 and resistance to Fusarium wilt, we selected OE_2 and WT plants with the highest CsHMGR1 gene expression levels for sowing. Seedlings were inoculated with Fusarium wilt pathogens at the two true leaf stage. Each seedling was inoculated with a spore suspension (concentration 10). 65 ml of spores (per ml) was inoculated, with an equal volume of sterile water as a control. Phenotypic observation and disease severity index statistics showed that 15 days after inoculation, almost all WT plants withered and died, while OE_2 plants could still grow normally; 25 days after inoculation, OE_2 plants could still flower and bear fruit normally, without the wilt phenotype, indicating that overexpression of cucumber CsHMGR1 can significantly enhance resistance to wilt disease. Figure 2 (b and c). To further clarify the function of the CsHMGR1 gene, we collected root exudates from OE_2 and WT plants and measured the mevalonic acid content. The results showed that the mevalonic acid content in the root exudates of CsHMGR1 gene-overexpressing transgenic plants was significantly increased, and their resistance to Fusarium wilt was enhanced.
Claims
1. Cucumber CsHMGR1 Application of genes in increasing mevalonic acid content in root exudates and improving resistance to cucumber wilt, wherein the cucumber CsHMGR1 The gene sequence is shown in SEQ ID NO: 1.
Citation Information
Patent Citations
Application of mevalonic acid in prevention and treatment of cucumber fusarium wilt
CN118435948A