A miRNA for killing termites and a method for controlling termites in combination with green muscardine
By injecting or feeding miR-571 agonist in termites and combining the use of lemonella, the environmental pollution and hazards to beneficial organisms in existing termite control methods have been solved, and efficient and safe termite control effects have been achieved.
Patent Information
- Application Number
- CN202410202165.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-02-23
- Publication Date
- 2025-03-18
- Estimated Expiration
- 2044-02-23
AI Technical Summary
The existing termite control methods mainly rely on chemical control methods, which have environmental pollution and harm to beneficial organisms, making it difficult to effectively prevent and control termites.
By using miR-571 or its agonist, the content of miR-571 in the termites is increased and combined with Metarhizium anisopliae is used in combination. After injection or feeding the miR-571 agonist, the mortality rate of termites is increased.
The mortality rate of termites has been significantly improved. Compared with the use of lemonella alone, the combined use of miR-571 agonist and lemonella is more effective, and can effectively prevent and treat termites.
Smart Images
Figure CN118006611B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of termite control, and specifically relates to a miRNA for killing termites and a method for controlling termites by combining the miRNA with green muscardine. Background Art
[0002] Termites are one of the five major pests in the world, and most parts of the world are harmed by termites. According to statistics, the area of damage caused by termites in my country is close to 40% of the total area of the country. There are more than 300 species of trees in my country that are harmed by termites. Every year, the economic losses caused by termites to housing buildings in my country alone are as high as 2.5 billion yuan. At present, chemical control is mainly used to control termites, but this is not only easy to cause environmental pollution, but also easy to harm other beneficial organisms.
[0003] MicroRNA (miRNA) is a type of single-stranded non-coding small RNA with a length of 19 to 24 nt. In insects, miRNA can regulate many aspects of insect growth and development, behavior, and drug resistance. Metarhizium is a type of fungus widely found in nature that can infect insects and is pathogenic to them. Summary of the invention
[0004] The first object of the present invention is to provide the use of miR-571 or its agonist in the preparation of drugs for controlling termites, wherein the nucleotide sequence of the miR-571 is uuucuguuggugauaucugac.
[0005] The second object of the present invention is to provide a drug for controlling termites, which contains miR-571 or its agonist as an active ingredient, and the nucleotide sequence of the miR-571 is uuucuguuggugauaucugac.
[0006] Preferably, it also contains Metarhizium anisopliae.
[0007] Preferably, the concentration of miR-571 or its agonist is 100 nM, and the concentration of Metarhizium anisopliae is 3.0×10 7 CFU / mL.
[0008] The third object of the present invention is to provide a method for controlling termites, which comprises feeding or injecting termites with miR-571 or its agonist to kill them.
[0009] Preferably, termites are fed or injected with miR-571 or its agonist and then sprayed with Metarhizium to kill them.
[0010] Preferably, the concentration of miR-571 or its agonist is 100 nM, and the concentration of Metarhizium anisopliae is 3.0×10 7 CFU / mL.
[0011] Preferably, after injecting 30 nL of 100 nM miR-571 agonist or feeding 10 uL of 300 nM miR-571 agonist to the worker ants for 2 days, the worker ants are sprayed with 3.0×10 7 CFU / mL of Metarhizium anisopliae solution.
[0012] The present invention uses an agonist of miRNA miR-571 to termites by injection and feeding, thereby increasing the content of miR-571 in termites, and then observing the survival rate of termites. In addition, after injecting and feeding termites with the miR-571 agonist, the termites are sprayed with green muscardine to observe the survival rate of the termites. Through these two methods, it is confirmed that the combined use of miR-571 agonist and green muscardine can effectively prevent and control termites.
[0013] The present invention can effectively increase the mortality rate of termites by injecting or feeding miR-571 agonists to termites, or injecting or feeding miR-571 agonists to termites and spraying green muscardine, and the latter causes a higher mortality rate, which can be used as a method for preventing and controlling termites. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Figure 1 is the survival rate of termites after injection of miR-571 agonist;
[0015] Figure 2 is the survival rate of termites after feeding on miR-571 agonist;
[0016] Figure 3 is the survival rate of termites after injection of miR-571 agonist and spraying of Metarhizium;
[0017] Figure 4 is the survival rate of termites after being fed with miR-571 agonist and sprayed with Metarhizium. DETAILED DESCRIPTION
[0018] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.
[0019] Embodiment 1:
[0020] The miR-571 agonist for injection and feeding was synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. based on the sequence of miR-571 (uuucuguuggugauaucugac).
[0021] Injection: Take 40 termite workers of the same size and inject 30nL of 100nM miR-571 agonist at the junction of the second and third segments of the worker thorax using a microinjector. Then put the injected worker ants in a culture dish with a diameter of 3cm, put a circular filter paper with a diameter of 1cm and add 10uL ddH2O for the termites to eat.
[0022] Feeding: 40 worker ants of the same size were placed in a culture dish with a diameter of 3 cm, and a circular filter paper with a diameter of 1 cm was placed in it for termites to feed on. 10uL miR-571 agonist was dripped on the filter paper as the experimental group, and the dosage of miR-571 agonist was 100nM, 200nM, 300nM and 400nM respectively, while the control group was dripped with an equal volume of ddH2O.
[0023] After injection and feeding, the mortality of termites was observed for ten consecutive days. The experimental group and the control group were designed with 3 replicates each.
[0024] In addition, after the worker ants were injected with 30 nL of 100 nM miR-571 agonist and fed with 10 uL of 300 nM miR-571 agonist for 2 days, the worker ants were sprayed with 3.0 × 10 7 The experimental group and the control group were sprayed with ddH2O, and the mortality of termites was observed for ten consecutive days. Three replicates were designed for each of the experimental group and the control group.
[0025] Implementation results:
[0026] Statistical analysis of the mortality data of termites after injection of miR-571 agonist showed that about 6% of the workers in the control group (injected with water) died ten days after treatment, while about 32% of the workers in the treatment group (injected with miR-571 agonist) died, which was significantly higher than the mortality rate of the control group ( Figure 1 ).
[0027] Statistical analysis of the mortality data of termites fed with miR-571 agonists revealed that after ten days of treatment, about 5% of the workers in the control group (fed with water) died, while when fed with 300nM and 400nM miR-571 agonists, about 22% and 29% of the workers died, respectively, which were significantly higher than the mortality rate of the control group ( Figure 2 ).
[0028] The above results indicate that the injection and feeding of termite miR-571 agonist has a significant effect on the survival rate of termites and can significantly increase the mortality rate of termites.
[0029] Statistical analysis of the mortality data after termites were injected with miR-571 agonists and sprayed with Metarhizium revealed that, ten days after treatment, about 5% of the workers in the control group (injected with water) died, about 50% of the workers died after termites were sprayed with Metarhizium, and about 70% of the workers died after injection of miR-571 agonists and spraying with Metarhizium, which was significantly higher than the mortality rates of the control group and the group sprayed with Metarhizium only ( Figure 3 ).
[0030] Statistical analysis of the mortality data of termites fed with miR-571 agonists and sprayed with Metarhizium revealed that after ten days of treatment, about 5% of the worker ants died in the control group (fed with water), about 50% of the worker ants died after the termites were sprayed with Metarhizium, and about 65% of the worker ants died after the termites were fed with miR-571 agonists and sprayed with Metarhizium, which was significantly higher than the mortality rates of the control group and the group sprayed with Metarhizium only ( Figure 4 ).
[0031] The above results indicate that compared with spraying Metarhizium alone, injecting and feeding termites with miR-571 agonist and then spraying Metarhizium can enhance the toxicity of Metarhizium to termites, resulting in a higher mortality rate of termites.
[0032] in conclusion:
[0033] The above implementation results show that by injecting and feeding termites with miR-571 agonists to increase the content of miR-571 in termites, the mortality rate of termites can be significantly increased, and spraying termites with green muscardine while injecting or feeding termites with miR-571 agonists can achieve a higher mortality rate of termites. Therefore, this method can be used to control termites by combining miR-571 agonists and green muscardine.
Claims
1. Application of miR-571 in the preparation of drugs for controlling termites, wherein the nucleotide sequence of miR-571 is uuucuguuggugauaucugac.
2. The use according to claim 1, characterized in that: Application of miR-571 combined with Metarhizium anisopliae in the preparation of drugs for controlling termites.
3. A drug for controlling termites, characterized in that: The invention contains miR-571 as an active ingredient, and the nucleotide sequence of miR-571 is uuucuguuggugauaucugac.
4. The drug for controlling termites according to claim 3, characterized in that: It also contains Metarhizium anisopliae.
5. The drug for controlling termites according to claim 4, characterized in that: The concentration of miR-571 is 100 nM, and the concentration of Metarhizium anisopliae is 3.0×10 7 CFU / mL.
6. A method for preventing and controlling termites, characterized in that: The method comprises feeding or injecting termites with miR-571 to kill them. The nucleotide sequence of the miR-571 is uuucuguuggugauaucugac.
7. The method according to claim 6, characterized in that Termites are fed or injected with miR-571 and then sprayed with green muscardine to kill them.
8. The method according to claim 7, characterized in that The concentration of miR-571 is 100 nM, and the concentration of Metarhizium anisopliae is 3.0×10 7 CFU / mL.
9. The method according to claim 8, characterized in that After the worker ants were injected with 30 nL of 100 nM miR-571 or fed with 10 uL of 300 nM miR-571 for 2 days, the worker ants were sprayed with 3.0×10 7 CFU / mL of Metarhizium solution Metarhizium anisopliae .