Molecular markers, primer combinations and applications of QTL locus qLINOL.17 related to high oil and high oleic acid traits in peanut

Abstract

The molecular markers, primer combinations and applications of the QTL locus qLINOL.17 related to high oil and high oleic acid traits in peanuts belong to the field of molecular marker-assisted breeding. It is located at linkage group 7 117.5cM-124.5cM of the peanut B genome, and its physical position is between 112,757,318bp and 120,783,196bp of chromosome 17. Combined linkage analysis, transcriptome analysis and gene transcription region variation site analysis identified a QTL locus qLINOL.17 and Arahy.HBE6U5 that regulate the accumulation of high oil and high oleic acid in peanut seeds. The allele with T base at the 211th position of the gene is an excellent genotype for high oil and high oleic acid in peanuts. The molecular marker probe was developed for the SNP locus using the three-primer one-step PCR method, and the two genotypes can be distinguished by one PCR reaction using three primers. The molecular marker can be used to detect and screen peanut lines with high oil and high oleic acid characteristics.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker-assisted breeding of cultivated peanuts (Arachis hypogaea L.), and specifically relates to a molecular marker, a primer combination and application of a QTL site qLINOL.17 related to high oil and high oleic acid traits of peanuts. Background Art

[0002] Peanut is one of the main oil crops, with an oil content of 40%-50%. Peanut oil is mainly composed of 8 kinds of fatty acids, of which oleic acid and linoleic acid account for more than 80% of the total fatty acids. The oleic acid content of natural peanut resources accounts for 28%-42% of the dry matter weight of peanut kernels, and the linoleic acid content accounts for 38%-41%. The oleic acid content of mutant peanuts can reach more than 70%. Unsaturated fatty acids are more beneficial to human health than saturated fatty acids. Their intake can reduce the content of low-density lipoprotein (LDL) cholesterol, thereby preventing cardiovascular diseases. Because peanut oil is rich in unsaturated fatty acids, it is considered an important source of healthy edible oil. Improving the fatty acid composition of peanuts and increasing the oil content are important goals of peanut breeding. The degree of saturation of fatty acids directly affects their stability. The more unsaturated bonds unsaturated fatty acids contain, the easier it is to oxidize and deteriorate. Linoleic acid is the most abundant polyunsaturated fatty acid (PUFA) in peanut oil. The two unsaturated double bonds in its molecular structure make it easier to oxidize and produce unpleasant odor substances. In contrast, oleic acid is a monounsaturated fatty acid (MUFA) that contains an unsaturated double bond and is less susceptible to oxidation than linoleic acid. Therefore, high-oleic peanut oil is more stable than ordinary peanut oil during high-temperature frying or room-temperature storage, can reduce the production of trans fatty acids, and extend the shelf life of the oil. Epidemiological studies have also shown that a higher proportion of monounsaturated fatty acids in the diet helps reduce the risk of coronary heart disease (CHD). Therefore, new high-oleic acid genetic resources are of great significance for achieving high-oleic acid breeding in oil crops.

[0003] The American peanut material "F435" is the first high oleate mutant discovered in the world, with an oleic acid content of 80% and a linoleic acid content of only 2%. Studies have shown that the increase in oleic acid content is caused by mutations and functional loss of the genes AhFAD2A and AhFAD2B encoding fatty acid desaturase 2 (FAD2) (Jung, S., Powell, G., Moore, K., & Abbott, A. (2000). The high oleate trait in the cultivated peanut [Arachis hypogaea L]. II. Molecular basis and genetics of the trait. MolGen Genet, 263 (5), 806-811. https: / / doi.org / 10.1007 / s004380000243), while the total oil content of peanuts has not changed. At present, the reported high-oleic peanut varieties include the American peanut variety "NC2" and the Chinese peanut variety "Huayu 962", and the increase in oleic acid content is caused by mutations in the genes AhFAD2A and AhFAD2B. Few QTL loci related to oleic acid content have been identified through linkage analysis and whole genome association analysis, and few other related genes have been reported except for genes AhFAD2A and AhFAD2B.

[0004] At present, the mutations that have been identified to cause the increase of peanut oleic acid content are mainly SNP mutations, including non-synonymous mutations (Missense mutation) caused by single-base mutations or frameshift mutations (Frameshift mutation) caused by single-base insertion / deletion (InDel). Molecular markers designed using these mutation sites can be used for molecular marker-assisted breeding selection (MAS) to achieve rapid aggregation of excellent genes. Molecular markers designed using SNP sites mainly include amplification retardation mutation system PCR method (ARMS-PCR), restriction fragment length polymorphism polymerase chain reaction (PCR-RFLP) method, molecular beacon method (Molecular beacons), high-resolution melting analysis (High-resolution melting analysis, HRM), competitive allele-specific PCR method (KASP) and TaqMan probe method. Among them, the ARMS-PCR method has a fast identification speed and the lowest requirement for equipment cost. This method requires the use of four PCR primers at the same time, including two inner primers with 3' ends located at the SNP site and extending in opposite directions, and two outer primers located outside the SNP and at different distances from the SNP for polymorphism differentiation. Nawade et al. used ARMS-PCR and PCR-RFLP methods to screen ahfad2 mutants in peanut introgression lines (ILs), and the oleic acid content was as high as 81.42% (Nawade, B., Mishra, GP, Radhakrishnan, T., Sangh, C., Dobariya, JR, & Kundu, R. (2019). Development of high oleic peanut lines through marker-assisted introgression of mutant AhFAD2 alleles and its fatty acid profiles under open-field and controlled conditions. 3Biotech, 9 (6), 243. https: / / doi.org / 10.1007 / s13205-019-1774-9).Qiao Lixian used the KASP method to screen ahfad2 mutants in the F6 generation of peanut population and bred the "Yuhua 61" peanut variety, whose oleic acid content reached 81.30% (Tang, Y., Qiu, X., Hu, C., Li, J., Wu, L., Wang, W., Li, X., Li, X., Zhu, H., Sui, J., Wang, J., & Qiao, L. (2022). Breeding of a new variety of peanut with high-oleic-acid content and high-yield by marker-assisted backcrossing. Mol Breed, 42(7), 42. https: / / doi.org / 10.1007 / s11032-022-01313-9).

[0005] Currently, few high-oil and high-oleic acid functional genes have been identified in peanuts, and there is a lack of diverse genetic resources to improve the oleic acid content of peanuts in order to further increase the oil and oleic acid content of peanuts.

[0006] There is no report on the regulation of oil and oleic acid content in oil crops by gene Arahy.HBE6U5. Summary of the invention

[0007] The present invention aims to solve the deficiencies of the current existing technologies and provides a molecular marker, primer combination and application of a QTL locus qLINOL.17 related to high oil and high oleic acid traits in peanuts. The present invention provides new key resources and means for improving the oil and oleic acid content of peanuts by identifying a new functional gene locus Arahy.HBE6U5 regulating peanut oil and oleic acid and the development of its molecular markers, and provides technical support for further improving the oil and oleic acid content of peanuts. The present invention has important scientific research and breeding value.

[0008] The technical solution adopted by the present invention to solve the technical problem is as follows:

[0009] The invention provides a molecular marker of a QTL locus qLINOL.17 related to high oil and high oleic acid traits of peanuts. The molecular marker is located at linkage group 7 117.5cM-124.5cM of the peanut B genome and is physically located between 112,757,318bp and 120,783,196bp of chromosome 17.

[0010] As a preferred embodiment, the polymorphism at position 211 of the nucleotide sequence of the molecular marker is C or T.

[0011] As a preferred embodiment, the allele of the 211th polymorphism of the nucleotide sequence of the molecular marker is the T base, which is the peanut high oil, high oleic acid excellent genotype Arahy.HBE6U5 (T 211 ).

[0012] The present invention provides a method for detecting a molecular marker of a QTL locus qLINOL.17 related to high oil and high oleic acid traits in peanuts, comprising the following steps:

[0013] The three-primer one-step PCR method is used. Three primers are designed first, and then a PCR reaction is performed to detect SNP mutations;

[0014] The three primers are:

[0015] External forward primer (5′-3′): CTCTTCATCGTGCTTCATCCT;

[0016] External rear primer (5′-3′): CGACAACCAGCCATACAAATAC;

[0017] Post-screening primer (5′-3′): TACGCGTCGCGGCATAC;

[0018] The PCR reaction procedure is:

[0019] Pre-denaturation at 95°C for 3 min, denaturation at 94°C for 25 s, annealing at 59°C for 25 s, extension at 73°C for 9 s, and extension at 72°C for 5 min, for 28 cycles.

[0020] The invention provides an application of a molecular marker of a QTL locus qLINOL.17 related to high oil and high oleic acid traits of peanuts in auxiliary breeding for selecting high oil and high oleic acid superior strains of peanuts.

[0021] The primer combination provided by the present invention for detecting the molecular marker of the QTL locus qLINOL.17 related to the high oil and high oleic acid traits of peanut comprises three primers:

[0022] External forward primer (5′-3′): CTCTTCATCGTGCTTCATCCT;

[0023] External rear primer (5′-3′): CGACAACCAGCCATACAAATAC;

[0024] Post-screening primer (5'-3'): TACGCGTCGCGGCATAC.

[0025] The beneficial effects of the present invention are:

[0026] (1) The present invention combines linkage analysis, transcriptome analysis and gene transcription region variation site analysis to identify a quantitative trait locus (QTL) qLINOL.17 and a functional gene Arahy.HBE6U5 that regulate the accumulation of high oil and high oleic acid in peanut seeds.

[0027] (2) The present invention identified that Arahy.HBE6U5 has a polymorphism at position 211 (C / T) in the coding region of peanut germplasm resources. This difference leads to different tertiary structures of the protein encoded by Arahy.HBE6U5. The allele with T base at position 211 is an excellent genotype of peanut high oil and high oleic acid, that is, Arahy.HBE6U5 (T 211 ).

[0028] (3) The present invention has developed a "three-primer one-step polymerase chain reaction (PCR) method" to develop a molecular marker probe for the single nucleotide polymorphism (SNP) site. This method uses a pair of outside primers (outsider forward primer and outsider reverse primer) and a selective reverse primer to distinguish two genotypes through a single PCR reaction.

[0029] (4) The excellent genotype of the high-oil and high-oleic acid related gene Arahy.HBE6U5 and its molecular marker provided by the present invention can facilitate the detection and screening of peanut strains or varieties with high-oil and high-oleic acid characteristics, thereby accelerating the breeding process of high-quality peanut varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The oleic acid and linoleic acid contents of seeds of the female parent "Huayu 668" and the male parent "Jinonghua No. 7". (A) Mature peanut seeds of the two parental materials. (B) The percentage of oleic acid and linoleic acid content in the total fatty acid content of mature peanut seeds of the two parental materials. (C) Seeds of the two parental materials at four developmental stages. (D) The oleic acid and linoleic acid contents of seeds of the two parental materials at four developmental stages.

[0031] Figure 2 A high-density genetic map of the A genome linkage group chromosomes of the F2 genetic population and the distribution of markers on its 10 chromosomes were constructed for the maternal parent "Huayu 668" and the paternal parent "Jinonghua No. 7". The genetic distance (cM) of the markers is shown on the left side of the linkage group / chromosome, and the SNP marker name is shown on the right side of the linkage group / chromosome.

[0032] Figure 3 A high-density genetic map of the B genome linkage group chromosomes and the distribution of markers on 10 chromosomes of the F2 genetic population was constructed for the maternal parent "Huayu 668" and the paternal parent "Jinonghua No. 7". The genetic distance (cM) of the marker is shown on the left side of the linkage group / chromosome, and the SNP marker name is shown on the right side of the linkage group / chromosome.

[0033] Figure 4 The distribution patterns of SNPs (A) and InDels (B) in the expression sequence comparison between the maternal parent "Huayu 668" and the paternal parent "Jinonghua No. 7". SNPs represent single nucleotide polymorphism sites, and InDels represent insertion and deletion mutation sites. (C) Statistics of SNP mutation types. Ts represents base conversion, i.e., replacement between purine (adenine A and guanine G) or pyrimidine (cytosine C and thymine T). Tv represents base transversion, i.e., replacement between purine and pyrimidine, including replacement between purine (A, G) and pyrimidine (C, T). (D) Frequency statistics of insertion, deletion, and frameshift mutation caused by insertion and deletion in InDels mutations.

[0034] Figure 5 (A) Candidate genes in the qLioleic-2 localization interval and their expression profile characteristics. (B) The genotype difference between the maternal parent "Huayu 668" and the paternal parent "Jinonghua No. 7" Arahy.HBE6U5 causes the difference in the 71st amino acid of the protein sequence. ARG represents arginine, and CYS represents cystine. (C) The genotype difference between the maternal parent "Huayu 668" and the paternal parent "Jinonghua No. 7" Arahy.HBE6U5 leads to the three-dimensional conformational change of the lysophospholipid acyltransferase (LPEAT) protein it encodes. C in brackets 211 and T 211 The 211th base in the coding region (5'-3' direction) is C or T.

[0035] Figure 6 Schematic diagram of the "three-primer one-step PCR method" genotyping method using Arahy.HBE6U5 as an example. (A) Development of two molecular marker probes for Arahy.HBE6U5 genotypes. The direction of the arrow represents the primer extension direction. The red letters in the Arahy.HBE6U5 gene sequence represent the difference sites between the two materials "Huayu 668" and "Jinonghua No. 7". The red letters in the primer sequence after screening represent the bases that do not match the Arahy.HBE6U5 sequences of the two materials. (B) 1% agarose gel electrophoresis pattern of the two genotypes of Arahy.HBE6U5. C in brackets 211 and T 211 The 211th base in the coding region (5'-3' direction) is C or T.

[0036] Figure 7 The polymorphism of Arahy.HBE6U5, Arahy.42CZAS and Arahy.5913QL in 18 peanut germplasm resources was identified. 211 )、Arahy.42CZAS(A 520 ) and Arahy.5913QL(C 570 T 571 ) is a double-belt type, Arahy.HBE6U5(C 211 )、Arahy.42CZAS(G 520 ) and Arahy.5913QL(C 570 _ 571 ) is a single band type. M stands for Marker. The left side of the Maker is the low oleic acid material, and the right side is the high oleic acid material. The numbers above the agarose gel are the peanut resource material numbers in Table 5.

[0037] Figure 8 Comparison of (A) oleic acid / linoleic acid ratio, (B) oleic acid content, (C) linoleic acid content, and (D) oil content between two genotypes of the natural peanut population Arahy.HBE6U5. 211 and T 211 The 211th base in the coding region (5'-3' direction) is C or T.

[0038] Fig. 9 Effects of different genotype combinations of Arahy.HBE6U5, Arahy.42CZAS and Arahy.5913QL on the (A) oleic acid, (B) oleic acid / linoleic acid and (C) oil content of the hybrid offspring of "Huayu 668 (female parent)" × "Jinonghua 7 (male parent)". (D) High oil and high oleic acid genotypes of Arahy.HBE6U5 (T 211 )-Arahy.42CZAS(A 520 )-Arahy.5913QL(C 570 T 571 ) of some homozygous strains.

[0039] Fig.10 It is the overall flow chart of the present invention. DETAILED DESCRIPTION

[0040] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0041] Example 1 Identification of QTL loci associated with high oleic acid traits in peanut

[0042] 1. Construction of a high-density genetic linkage map of the peanut F2 population

[0043] See also Fig.10 The present invention uses "Huayu 668" (a double mutant variety of ahfad2a and ahfad2b, with an oleic acid content of 81.30%) as the female parent and hybridizes it with "Jinonghua 7" (a non-mutant variety of AhFAD2a and AhFAD2b, a wild type high oleic acid, with an oleic acid content of 50.97%). Figure 1 As shown in A and B in . After hybridization, F1 hybrids were obtained, and after one generation of self-pollination, F2 populations were obtained. Then, the F2 segregating population and its parents were sequenced using peanut 40K liquid phase hybridization capture sequencing technology. The sequencing results were processed using the software QTL Icimapping (version 4.2.53). After removing the non-polymorphic and heterozygous sites between the parents, 6743 valid markers were obtained. These markers were further screened using the software QTL Icimapping: anchor information and missing values ​​were not considered, non-polymorphic and redundant markers with a missing rate greater than 20% and a p-value less than 0.05 were deleted, and Bin processing was performed to finally obtain 2261 Bin markers, with an average of 113.05 Bin markers per linkage group. The recombined Bin markers were used as genetic markers (SNP polymorphism molecular markers), and QTL Icimapping was used to construct a linkage genetic map of the F2 population, as shown in the figure. Figure 2 and Figure 3 As shown, the total length of the map is 6331.32cM, of which the A genome is 2273.93cM and the B genome is 4057.39cM.

[0044] 2. QTL positioning and identification of high oleic acid QTL loci in peanut

[0045] The present invention uses QTL Icimapping software to perform QTL positioning analysis by Inclusive composite interval mapping (ICIM). In the analysis, the step size is set to 1 cM, the PIN value is 0.001, and the LOD value is taken as 2.5 as the threshold to determine whether the QTL exists. The QTL positioning analysis identified a total of 6 QTL sites, which are located at the QTL sites qOLEIC.09 and qLINOL.09 of chromosome 9 of the A genome, the QTL sites qOLEIC.17 and qLINOL.17 of chromosome 17 of the B genome, and the QTL sites qOLEIC.19 and qLINOL.19 of chromosome 19 of the B genome (Table 1).

[0046] Table 1 Mapping sites of high oleic acid QTL in peanut

[0047]

[0048] According to Table 1, the positioning intervals of QTL sites qOLEIC.09 (LOD confidence interval 320.5cM-324cM) and qLINOL.09 (LOD confidence interval 319.5cM-324cM), and QTL sites qOLEIC.19 (LOD confidence interval 38.5cM-49.5cM) and qLINOL.19 (LOD confidence interval 37.5cM-47.5cM) overlap, which indicates that the same functional genes may exist in the positioning intervals on the same chromosome.

[0049] The phenotypic variation explained by qOLEIC.19 / qLINOL.19 was the highest, with an explanation rate of 45.76% for oleic acid and 38.81% for linoleic acid. The phenotypic variation explained by qOLEIC.09 / qLINOL.09 was 21.23% for oleic acid and 23.31% for linoleic acid. The phenotypic variation explained by qOLEIC.17 was 9.92% for oleic acid and 10.03% for linoleic acid. Studies have found that there is a very significant negative correlation between the oleic acid and linoleic acid content of plant seeds. The additive effect values ​​of the three groups of QTL loci qOLEIC.09 and qLINOL.09 are 6.07 and -5.63, respectively, the additive effect values ​​of qOLEIC.17 and qLINOL.17 are -3.82 and 2.77, respectively, and the additive effect values ​​of qOLEIC.19 and qLINOL.19 are 9.96 and -7.86, respectively. When the additive effect value is "+", it means that the additive effect of the QTL locus is provided by the alleles of the parent "Huayu 668", and when the additive effect value is "-", it means that the additive effect of the QTL locus is provided by the alleles of the parent "Jinonghua 7". Therefore, the oleic acid enhancing alleles of qOLEIC.09 / qLINOL.09 and qOLEIC.19 / qLINOL.19 came from “Huayu 668”, and the oleic acid enhancing alleles of qOLEIC.17 and qLINOL.17 came from “Jinonghua 7” (Table 1).

[0050] Example 2 Determination of fatty acid content and transcriptomic analysis of peanut seeds at different developmental stages

[0051] 1. Determination of oleic acid and linoleic acid content in peanut seeds at different developmental stages

[0052] The present invention selected seeds of four different developmental stages of parent materials "Huayu 668" and "Jinonghua No. 7" (S1: ~2.5mm, S2: ~6mm, S3: ~10mm, S4: ~14mm) for fatty acid content determination. The results are as follows Figure 1 As shown in C. During seed development, the oleic acid content of "Jinonghua No. 7" and "Huayu 668" showed an increasing trend, but in the S2 period, the oleic acid accumulation rate of the two parents showed significant differences. Compared with the S1 period, the oleic acid content of "Huayu 668" in the S2 period increased by 1639.53%, while that of "Jinonghua No. 7" only increased by 126.38% (Table 2). In the S2 period, the "oleic acid / linoleic acid" ratio (Oleic / Linoleic, O / L) of the two parents also began to differ. In the S4 period, the difference in the O / L ratio of the two parents reached the maximum. The O / L ratio of Huayu 668 is 6.53 times that of Jinonghua No. 7. Figure 1As shown in D. Although the increase of "Jinonghua No. 7" has increased since S3, the absolute content of oleic acid is still much lower than that of "Huayu 668". In S4, when it is close to maturity, its oleic acid content is only 44% of that of "Huayu 668". In S4, the linoleic acid content of the two parental materials also showed significant differences, among which "Jinonghua No. 7" increased by 140.37%, while "Huayu 668" decreased by 18.22%.

[0053] Table 2 Oleic acid and linoleic acid contents in four developmental stages of the two parental materials of peanut

[0054]

[0055] The increase in fatty acid content (%) = (fatty acid content in the current development period - fatty acid content in the previous development period) / fatty acid content in the previous development period × 100.

[0056] 2. Analysis of differentially expressed genes between “Huayu 668” and “Jinonghua 7” peanuts at different developmental stages

[0057] The present invention conducted transcriptome sequencing analysis on seeds of parent materials "Huayu 668" and "Jinonghua No. 7" at four different developmental stages, with three biological replicates for each stage. The results are as follows Figure 1 As shown in C. The raw data was filtered to remove reads containing adapters and low-quality reads (Reads with an N ratio greater than 10% and a quality value of Q≤10 that accounted for more than 50% of the entire Read). After processing, a total of 148.33Gb of Clean Data was obtained, of which the percentage of Q30 bases was above 93.17%. The Clean Reads were aligned with the reference genome using HISAT2 (version: 2.2.1) software (reference genome version: Arachis_hypogaea.Tifrunner.gnm2.ann1.4K0L), with an alignment efficiency of 93.27%-97.63%. StringTie software (version: 2.2.1) was used to normalize gene expression levels using the maximum flow algorithm to read fragments per kilobase of transcript per million mapped reads (Fragments per kilobase of transcript per million fragments mapped, FPKM).

[0058] Table 3 Statistics of differentially expressed genes in four developmental stages of the two peanut parental materials

[0059]

[0060]

[0061] Among them, the lipid metabolism pathway is the gene with the functional annotation of Lipidmetabolic process (GO:0006629) in Gene Ontology (GO), and the fatty acid metabolism pathway is the gene with the annotation of Fatty acid metabolism (ko01212) in Kyoto Encyclopedia of Genes and Genomes (KEGG).

[0062] In order to compare the changes in transcriptome expression levels between the two parents during seed development, differential analysis was performed using DESeq2 (version: 3.18) software, setting the difference fold log2|Fold Change|≥1 and false discovery rate (FDR) ≤0.01 as screening criteria.

[0063] On the basis of phenotypic data (see Tables 2 and Figure 1 D), 13 comparison groups were set (see Table 3). In the S2 period, the oleic acid accumulation rates of the two parents began to differ significantly (see Table 2). Similarly, for the comparison of S2 relative to S1, the number of differentially upregulated genes in the lipid metabolism pathway (GO:0006629) and fatty acid metabolism pathway (ko01212) of "Huayu 668" was greater than that of "Jinonghua 7". At the same developmental period (S2-S4), the comparison of the two parents showed that in both annotations, the number of upregulated genes in "Huayu 668" was greater than that in "Jinonghua 7".

[0064] 3. Analysis of transcriptome expression differences between “Huayu 668” and “Jinonghua 7”

[0065] The present invention uses STAR software (version: 2.7.11a) and GATK software (version: 4.5.0.0) to perform differential analysis of expression sequences on the transcriptome data of peanut parents "Huayu 668" and "Jinonghua 7", and obtain the variable sites between the two parents. The specific steps are as follows: using the 2-pass mode of STAR software to align Clean reads to the peanut reference genome to generate a BAM file; using GATK software to perform deduplication and reads splitting processing on the BAM file; using the HaplotypeCaller module of GATK software to identify SNPs for each parent and generate a gVCF file; using the GenotypeGVCFs module of GATK software to merge the gVCF files of each parent to obtain the original variable sites between the parents; using the VariantFiltration module of GATK software to screen and filter the original variable sites, retaining the variable sites with QUAL>20, FS>30 and QD<2.0.

[0066] The present invention identified a total of 20,018 SNP sites between the two parents. Figure 4 As shown in A, there are 12435 base conversions and 7583 base transversions. Figure 4 As shown in B. Compared with "Jinonghua 7", "Huayu 668" has 2775 insertion and deletion (InDel) sites, such as Figure 4 As shown in C, 54% of them are deletion mutations, 46% are insertion mutations, 3% of deletion mutations and 4% of insertion mutations are located in the gene coding region and will cause frameshift mutations.

[0067] Example 3 Combined QTL mapping and transcriptomic analysis to identify the functional gene Arahy.HBE6U5 regulating oleic acid accumulation

[0068] The new QTL locus qLINOL.17 and the functional gene Arahy.HBE6U5 identified by the present invention are located at linkage group 7 117.5cM-124.5cM of peanut B genome, and the physical position is between 112,757,318bp and 120,783,196bp of chromosome 17. In this interval, there are 231 genes, of which 9 genes have non-synonymous mutations in the coding region DNA sequences of the parental materials "Huayu 668" and "Jinonghua 7", such as Figure 5As shown in A. Among these 9 genes, the only gene related to lipid synthesis is Arahy.HBE6U5. This gene encodes lysophosphatidyltransferase, which is responsible for catalyzing the conversion of lysophosphatidylethanolamine (LPE) to phosphatidylethanolamine (PE).

[0069] Among these 9 genes, the gene Arahy.HBE6U5 had the highest expression level in each period. Although there was no significant difference in its expression level between the two materials, its expression level gradually decreased as the seeds matured. In addition, the gene Arahy.HBE6U5 was expressed in various tissues. In addition to being expressed in seeds, its expression level in pericarp, roots and nodules was also relatively high.

[0070] The mutation site of gene Arahy.HBE6U5 is located at the 211th base position of the first exon of the coding region. This mutation causes the 71st amino acid of "Huayu 668" to be arginine, while the 71st amino acid of "Jinonghua 7" is cystine. Figure 5 As shown in B. This amino acid change causes the three-dimensional conformation of the encoded protein to change, as shown in Figure 5 As shown in C, this affects the catalytic activity of the enzyme.

[0071] The same method was used to identify the functional genes Arahy.42CZAS (AhFAD2A) and Arahy.5913QL (AhFAD2B) in the localization intervals of qOLEIC.09 / qLINOL.09 and qOLEIC.19 / qLINOL.19, respectively. These two genes are responsible for encoding fatty acid desaturase 2 (FAD2). The excellent genotypes of these two genes are both from the high oleic parent "Huayu 668". Compared with "Jinonghua No. 7", the single base substitution (G to A) at the 520bp position of the Arahy.42CZAS gene in "Huayu 668" caused a significant decrease in the FAD2A enzyme activity. The insertion of a single base T between 570-571bp of the Arahy.5913QL gene caused a frameshift mutation, resulting in the loss of FAD2B protein function.

[0072] Example 4 Development of high oil and high oleic acid molecular markers for peanut based on the “three-primer one-step PCR method”

[0073] The present invention combines the "Single-Tube Tri-Primer ARMS-PCR" method and the "Small Insertion / Deletion Mutation and Single-Tube Genotyping Method" and further optimizes them to develop a "Three-Primer One-Step PCR Method". This method requires the design of three primers and can detect SNP mutations through one PCR reaction: (1) the functional genes (Arahy.HBE6U5, Arahy.42CZAS and Arahy.5913QL) are homologously aligned with the whole genome sequence to find the target gene specific sequence segment (Arahy.HBE6U5 (T 211 ) See SEQ ID NO: 1 in the sequence listing, Arahy.HBE6U5 (C 211 ) See SEQ ID NO: 2 in the sequence listing, Arahy.42CZAS (A 520 ) See SEQ ID NO:3 in the sequence listing, Arahy.42CZAS (G 520 ) See SEQ ID NO: 4 in the sequence listing, Arahy.5913QL (C 570 T 571 ) See SEQ ID NO: 5 in the sequence listing, Arahy.5913QL (C 570 _ 571 ) See SEQ ID NO:6 in the sequence listing). A pair of outside primers (Outsider forward primer and Outsider reverse primer) were designed using the PrimerQuest online tool of Integrated DNA Technologies (https: / / www.idtdna.com / ). The default primer standards were set as primer Tm range of 59-65°C, optimal Tm of 62°C, primer GC content range of 35-65%, optimal GC content of 50%, primer size range of 17-30nt, and optimal size of 22nt. The two outside primers were located on both sides of the mutation site, the length of the amplified sequence did not exceed 1kb, and the optimal distance between the mutation site and Outsider_gene_R was 500-600bp; (2) the third base at the 3' end of one of the selected primers was at the mutation site, and the base was consistent with the variant base of one of the gene haplotypes, and the second base at the 3' end of the selected primer was different from the bases of both gene haplotypes, as shown in Table 4 and Figure 6 shown.

[0074] PCR used a 10ul reaction system: 1ul of DNA template at a concentration of 100ng / ul, 0.5ul of each of the three primers at a concentration of 10uM, 5ul of 2X M5 HiPerplus TaqHiFi PCRmix (Beijing Polymer Biotechnology Co., Ltd., catalog number MF002-plus-10) and 2.5ul of sterile ddH2O. PCR reaction program: 95℃ pre-denaturation for 3min, 94℃ denaturation for 25s, (55℃ or 59℃) annealing for 25s, 73℃ extension (9s), 72℃ extension for 5min, 28 cycles (Table 4). PCR products were electrophoresed with 1% agarose gel and imaged on a gel imaging system (Beijing Junyi, JY04S-3C). Among them, Arahy.HBE6U5 (T 211 ) amplified fragments are shown in the sequence list as SEQ ID NO.7 and SEQ ID NO.8, Arahy.HBE6U5 (C 211 )The amplified fragment is shown in SEQ ID NO.9 in the sequence listing.

[0075] Table 4 Peanut high oleic acid molecular markers developed by “three-primer one-step PCR method”

[0076]

[0077] Example 5 Verification of the effectiveness of the developed peanut high oleic acid molecular marker and its assisted breeding selection (MAS) of peanut high oleic acid superior lines

[0078] Nine high-oleic and low-oleic peanut germplasm resources were selected. The oleic acid content of high-oleic peanuts ranged from 64.52% to 81.08%, and the oleic acid content of low-oleic peanuts ranged from 32.23% to 43.51% (Table 5). The developed high-oleic peanut molecular markers were verified. For the high-oleic genotypes of Arahy.HBE6U5, Arahy.42CZAS and Arahy.5913QL genes, the agarose gel electrophoresis results were all double-banded (Table 4), while the non-excellent genotypes were single-banded. Among the high-oleic peanut resources (Table 5, No. 1-9), AhFAD2A (A 520 ) and AhFAD2B(C 570 T 571 ) excellent genotype ("Huayu 668" type, double-band type) accounted for 100%, while Arahy.HBE6U5 (T 211 ) excellent genotype ("Jinonghua No. 7" type, double-band type) ratio is 0%. Most of the peanut high oleic acid materials introduced by the present invention are introduced from Shandong Province, China. It may be because the original peanut high oleic acid materials do not carry Arahy.HBE6U5 (T 211) has an excellent genotype, which leads to the loss of this genotype in high oleic acid materials. Most of the low oleic acid materials come from Jilin Province, China, Arahy.HBE6U5 (T 211 ) excellent genotype ratio is 55.56%, while the ratio of AhFAD2A and AhFAD2B excellent genotype ratio is 0%, such as Figure 7 shown.

[0079] In the AhFAD2A and AhFAD2B non-mutant resources, Arahy.HBE6U5 (T 211 ) genotype individuals were higher in oleic acid / linoleic acid ratio, oleic acid content and oil content than those in Arahy.HBE6U5(C 211 ) genotype, while linoleic acid is just the opposite, e.g. Figure 8 As shown. It is inferred that Arahy.HBE6U5(T 211 ) has multiple effects at once, and can increase the oil content while increasing the oleic acid content.

[0080] Table 5 Oleic acid, linoleic acid and oil content of 18 high and low oleic acid peanut germplasm resources

[0081]

[0082]

[0083] The present invention screened the offspring of "Huayu 668" and "Jinonghua 7" based on the developed peanut high oleic acid molecular marker (Table 4), and compared the differences in fatty acid and oil content of different gene combinations to further verify the gene function of Arahy.HBE6U5. 211 )-Arahy.42CZAS(A 520 )-Arahy.5913QL(C 570 T 571 The oleic acid, oleic acid / linoleic acid ratio and total oil content of the combined individuals of ) were higher than those of the mother parent "Huayu 668". Fig. 9 As shown in AC, it is confirmed that Arahy.HBE6U5 (T 211 ) is a high oil and high oleic acid genotype. At the same time, more than 30 new peanut high oleic acid lines have been bred based on the developed peanut high oleic acid molecular markers, such as Fig. 9 As shown in D.

[0084] The present invention discloses a molecular marker, primer combination and application of a QTL locus qLINOL.17 related to high oleic acid traits in peanuts. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters for implementation. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The product of the present invention has been described through a preferred embodiment, and relevant personnel can obviously modify or appropriately change and combine the product described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

Claims

1. A method for detecting molecular markers of the QTL locus qLINOL.17 related to high oil and high oleic acid traits in peanut, characterized in that: The molecular marker is located at linkage group 7 of peanut B genome 117.5cM-124.5cM, and its physical position is between 112,757,318bp and 120,783,196bp of chromosome 17; the allele of the 211th polymorphism of the nucleotide sequence of the molecular marker is T base, which is the excellent genotype Arahy.HBE6U5 (T 211 ), whose nucleotide sequence is SEQ ID NO: 1; The detection method comprises the following steps: The three-primer one-step PCR method is used. Three primers are designed first, and then a PCR reaction is performed to detect SNP mutations; The three primers are: External forward primer (5′-3′): CTCTTCATCGTGCTTCATCCT; External rear primer (5′-3′): CGACAACCAGCCATACAAATAC; Post-screening primer (5′-3′): TACGCGTCGCGGCATAC; The PCR reaction procedure is: Pre-denaturation at 95°C for 3 min, denaturation at 94°C for 25 s, annealing at 59°C for 25 s, extension at 73°C for 9 s, and extension at 72°C for 5 min, for 28 cycles.

2. Application of molecular markers of QTL locus qLINOL.17 related to high oil and high oleic acid traits in peanut breeding to select high oil and high oleic acid superior lines, characterized in that: The molecular marker is located at linkage group 7 of peanut B genome 117.5cM-124.5cM, and its physical position is between 112,757,318bp and 120,783,196bp of chromosome 17; the allele of the 211th polymorphism of the nucleotide sequence of the molecular marker is T base, which is the excellent genotype Arahy.HBE6U5 (T 211 ), whose nucleotide sequence is SEQ ID NO:1.

Images