A KASP molecular marker primer set for quality improvement of semi-glutinous rice and its application

Abstract

This invention discloses a KASP molecular marker primer set for improving the quality of semi-glutinous rice and its application, belonging to the field of bio-breeding technology. The development method of the KASP molecular marker primer set for improving the quality of semi-glutinous rice disclosed in this invention is as follows: target gene sequencing is performed on donor and recurrent parents; the BEIIb, SSIV-1, SSI, SSIIa, and PUL gene sequences are compared between the donor and recipient parents to screen for SNP mutation sites for KASP molecular marker development; the primer set for KASP molecular markers is synthesized; KASP molecular marker detection is performed on the segregating population; and finally, six new rice lines are obtained. Compared with the recurrent parents, the appearance quality of the rice in the five lines showed significantly reduced chalkiness rate, chalkiness degree, and transparency, and significantly increased amylose content. Compared with the donor parents, the gel consistency increased, the gelatinization temperature decreased, and the protein content remained unchanged.

Description

Technical Field

[0001] This invention relates to a KASP molecular marker primer set for improving the quality of semi-glutinous rice and its application, belonging to the field of bio-breeding technology. Background Technology

[0002] China is a major producer and consumer of rice globally, with over 60% of its population relying on rice as a staple food. Rapid economic development and rising living standards have led to changes in dietary habits, with consumers shifting from simply "eating enough" to "eating well." Rice with superior taste and quality is increasingly valued by the consumer market. Therefore, improving rice quality has become a pressing task. Rice quality typically includes six categories: milling quality, appearance quality, nutritional quality, cooking quality, taste quality, and hygiene quality. Among these, appearance quality is a crucial factor determining the commercial value of rice and is the primary characteristic consumers focus on. Generally, the better the appearance quality of rice, the higher its market price and the stronger the consumer's willingness to purchase it.

[0003] The middle and lower reaches of the Yangtze River have always been a major production area for japonica rice in southern my country, boasting abundant temperature and light resources and high yields. In recent years, with the progress of japonica rice breeding in the middle and lower reaches of the Yangtze River, a number of high-quality, high-yield varieties, represented by Nanjing 46 and Nanjing 9108, have been selected, gaining popularity among consumers and winning first prize and other honors in national and Jiangsu provincial competitions for high-quality japonica rice. However, currently, an important way to improve the eating quality of rice in the middle and lower reaches of the Yangtze River is to breed semi-glutinous japonica rice by reducing amylose content. However, the high-quality soft rice bred through this method generally has poor appearance quality, often exhibiting a cloudy appearance and dark endosperm phenotype. In the breeding process of semi-glutinous japonica rice, phenotypic identification of its appearance quality requires observation and identification of its transparency, chalkiness, and other phenotypes after grain maturity, making it impossible to accurately predict the offspring population. Existing research reports that the level of amylose content determines the transparency of rice. Under the same moisture content, higher amylose content results in better transparency. Currently, more than 20 genes related to starch synthesis have been reported, participating in the synthesis of amylose and amylopectin respectively. To conduct marker-assisted breeding work for improving the appearance quality of semi-glutinous japonica rice, a genome-wide association analysis of amylose content in cultivated japonica rice in my country revealed functional alleles in BEIIb, SSIV-1, SSI, SSIIa, and PUL that are significantly correlated with amylose content.

[0004] Kompetitive allele-specific PCR (KASP) is a one-step genotyping technique that identifies the genotype of a target locus based on fluorescence signals, eliminating the need for cumbersome gel electrophoresis analysis. Due to its time-saving, labor-saving, and low-cost advantages, KASP markers have gradually become a commonly used marker type in marker-assisted breeding. Therefore, developing a KASP molecular marker for improving the quality of semi-glutinous rice is of significant practical importance. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the technical problem this invention aims to solve is to provide a KASP molecular marker primer set for improving the quality of semi-glutinous rice. Another technical problem this invention aims to solve is to provide an application of this KASP molecular marker primer set for improving the quality of semi-glutinous rice, specifically for increasing the amylose content of semi-glutinous japonica rice, thereby improving its appearance quality, especially its transparency, and increasing breeding efficiency.

[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0007] The primer set for KASP molecular markers used to improve the quality of semi-glutinous rice is shown below:

[0008] SSI-F1:GAAGGTGACCAAGTTCATGCTGCCTTGAACAAAAATTTTGCAAACGCT,

[0009] SSI-F2:GAAGGTCGGAGTCAACGGATTCCTTGAACAAAAATTTTGCAAACGCC,

[0010] SSI-R:GTTCTCCGCCAAAGCATGGAATCTT;

[0011] SSIIa-F1:GAAGGTGACCAAGTTCATGCTAAGAGAACTCCTCCTCCTCGG,

[0012] SSIIa-F2:GAAGGTCGGAGTCAACGGATTAAGAGAACTCCTCCTCCTCGC,

[0013] SSIIa-R:CGCGCGGATGATGGGGAGAA;

[0014] SSIV-1-F1:GAAGGTGACCAAGTTCATGCTGGAAAGTGGATGCGACGGATGA,

[0015] SSIV-1-F2:GAAGGTCGGAGTCAACGGATTGAAAGTGGATGCGACGGATGC,

[0016] SSIV-1-R:CCCCATTGTTACACCGTTCAACAA;

[0017] BEIIb-F1:GAAGGTGACCAAGTTCATGCTGTGGCATGCTAGAGTTTGACG,

[0018] BEIIb-F2:GAAGGTCGGAGTCAACGGATTCGTGGCATGCTAGAGTTTGACA,

[0019] BEIIb-R:GCTCATATTTGTGCAACCCCCAGAA;

[0020] SBE4-F1:GAAGGTGACCAAGTTCATGCTGCATCGAACAATTCTGCTTCCAG,

[0021] SBE4-F2:GAAGGTCGGAGTCAACGGATTATGCATCGAACAATTCTGCTTCCAT,

[0022] SBE4-R:AGGGGACAGAGGGAGTAAGTTCTTT.

[0023] The method for developing primer sets for KASP molecular markers used in the quality improvement of semi-glutinous rice includes the following steps:

[0024] 1) Target gene sequencing was performed on the high amylose content donor parent "Sidao 301" and the low amylose content recurrent parent "Nanjing 9108" respectively;

[0025] 2) Compare the BEIIb, SSIV-1, SSI, SSIIa, and PUL gene sequences between the donor and recipient parents to screen for SNP mutation sites;

[0026] 3) KASP molecular markers were developed based on the screened SNP mutation sites, and KASP molecular markers for the quality improvement of semi-glutinous rice were finally developed. Primer sets for KASP molecular markers for the quality improvement of semi-glutinous rice were synthesized.

[0027] The application of KASP molecular marker primer sets in improving the appearance quality of semi-glutinous rice includes the following steps:

[0028] 1) The high amylose content donor parent "Sidao 301" and the low amylose content recurrent parent "Nanjing 9108" were hybridized and backcrossed to obtain segregating populations;

[0029] 2) KASP molecular marker detection was performed on the segregating population using a primer set of KASP molecular markers. The genotypes of the samples clustered near the X-axis (showing blue) were BEIIb(C / C), SSIV-1(T / T), SSI(A / A), SSIIa(A / A), and PUL(G / G) alleles linked to FAM fluorescent tag sequences. The genotypes of the samples clustered near the Y-axis (showing red) were BEIIb(T / T), SSIV-1(C / C), SSI(G / G), SSIIa(G / G), and PUL(A / A) alleles linked to HEX fluorescent tag sequences. The genotypes of the samples in the middle (showing green) were BEIIb(C / T), SSIV-1(T / C), SSI(A / G), SSIIa(A / G), and PUL(G / A) heterozygous.

[0030] 3) Analyze the test results, select the lines containing homozygous target genotypes for quality testing, and obtain new japonica rice lines with improved appearance.

[0031] The PCR reaction system for KASP molecular marker detection consisted of 5 μL of 2×KASP Master mix, 0.14 μL of KASP Primer mix, 1 μL of template DNA, and 3.86 μL of ddH2O.

[0032] The PCR reaction program for KASP molecular marker detection was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s; 61-55℃ annealing and extension for 60 s, 10 cycles, with the temperature decreasing by 0.6℃ per cycle; 94℃ denaturation for 20 s; 55℃ annealing and extension for 60 s, 26 cycles.

[0033] The application of KASP molecular marker primer sets in improving the appearance quality of semi-glutinous rice: improving the appearance quality of rice by reducing the transparency, chalkiness rate, and chalkiness of rice grains.

[0034] Application of KASP molecular marker primer set in improving the eating quality of semi-glutinous rice.

[0035] The application of KASP molecular marker primer sets in improving the eating quality of semi-glutinous rice aims to significantly increase the amylose content, gel consistency, and gelatinization temperature of rice.

[0036] The beneficial effects of this invention are:

[0037] 1) The method for developing a primer set for KASP molecular markers for improving the quality of semi-glutinous rice disclosed in this invention includes the following steps: sequencing the target genes of the high amylose content donor parent "Sidao 301" and the low amylose content recurrent parent "Nanjing 9108" respectively; comparing the BEIIb, SSIV-1, SSI, SSIIa and PUL gene sequences between the donor parent and the recipient parent to screen for SNP mutation sites; developing KASP molecular markers based on the screened SNP mutation sites, and finally developing KASP molecular markers for improving the quality of semi-glutinous rice, and synthesizing a primer set for KASP molecular markers for improving the quality of semi-glutinous rice.

[0038] 2) This invention ultimately yielded six new rice lines (Y16, Y75, Y115, Y121, Y143, and Y235) with different gene aggregations through molecular marker-assisted screening. Compared to the recurrent parent "Nanjing 9108," the appearance quality of rice in all five lines (Y16, Y75, Y115, Y143, and Y235) was significantly improved, with a marked decrease in chalkiness rate, chalkiness degree, and transparency. There were also some differences in appearance quality among the lines, with Y235 exhibiting chalkiness rate, chalkiness degree, and transparency similar to the donor parent "Sidao 301." Compared to the recurrent parent "Nanjing 9108," the amylose content in all five lines (Y16, Y75, Y115, Y143, and Y235) was significantly increased. Compared to the donor parent "Sidao 301," the gel consistency was increased, the gelatinization temperature was decreased, and the protein content remained unchanged.

[0039] 3) This invention classifies the KASP molecular markers developed for the target genes BEIIb, SSIV-1, SSI, SSIIa, and PUL based on color. Samples clustered near the X-axis and displaying blue have genotypes of BEIIb(C / C), SSIV-1(T / T), SSI(A / A), SSIIa(A / A), and PUL(G / G) alleles linked to FAM fluorescent tag sequences. Samples clustered near the Y-axis and displaying red have genotypes of BEIIb(T / T), SSIV-1(C / C), SSI(G / G), SSIIa(G / G), and PUL(A / A) alleles linked to HEX fluorescent tag sequences. Samples in the middle displaying green have genotypes of BEIIb(C / T), SSIV-1(T / C), SSI(A / G), SSIIa(A / G), and PUL(G / A) heterozygous. Attached Figure Description

[0040] Figure 1 A gene comparison diagram of the donor parent and the recurrent parent;

[0041] Figure 2A breeding roadmap for improving the appearance quality of semi-glutinous japonica rice using molecular markers;

[0042] Figure 3 A comparison of the appearance of the new rice strain and the parent rice;

[0043] Figure 4 A comparison of the appearance and quality of the new rice strain and the parent rice;

[0044] Figure 5 A comparison chart of starch physicochemical properties between the new strain and its parents;

[0045] Figure 6 The results of KASP molecular marker detection of the obtained backcross segregating population using BEIIb, SSIV-1, SSI, SSIIa, and PUL are shown in the figure. Detailed Implementation

[0046] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described below with reference to specific embodiments. Unless otherwise described in detail, the technical means used in the following embodiments are all conventional means well known to those skilled in the art.

[0047] Example 1

[0048] 1. Parental target gene sequencing

[0049] Using the published gene sequences of Nipponbare BEIIb, SSIV-1, SSI, SSIIa and PUL, specific primers (Table 1) were designed to amplify the full-length gene sequences of Sidao 301 and Nanjing 9108. The gels were then excised and sent to Sangon Biotech for sequencing.

[0050] The results are as follows Figure 1 As shown, using DNAMAN software to compare relevant sequences, a C-to-T mutation was found in exon 11 of the BEIIb gene, a T-to-C mutation was found in exon 15 of the SSIV-1 gene, an A-to-G mutation was found in exon 6 of the SSI gene, an A-to-G mutation was found in exon 8 of the SSIIa gene, and a G-to-A mutation was found in exon 18 of the PUL gene. Based on these SNP sites, KASP molecular markers were developed and primers were synthesized.

[0051] Table 1 Primer sequence list for amplifying the BEIIb, SSIV-1, SSI, SSIIa, and PUL genes.

[0052]

[0053]

[0054]

[0055] 2. KASP molecular marker design

[0056] The KASP marker was developed based on the mutation sites at SNPs in the BEIIb, SSIV-1, SSI, SSIIa, and PUL genes. KASP marker primers were designed based on the 100 bp base sequences before and after the complementary strand SNP sites, including two forward-specific primers and one reverse universal primer. The two forward primers correspond to HEX and FAM fluorescence signals, respectively. Specific primer sequence information is shown in Table 2.

[0057] Table 2. Primer sequence information for KASP molecular markers.

[0058]

[0059]

[0060] 3. Extracting DNA from rice leaves

[0061] Rice leaves at the tillering stage were collected, and 100 mg of the leaves were added to liquid nitrogen and ground thoroughly. The ground powder was then used to extract DNA using a plant genomic DNA extraction kit from Tiangen Biotech (Beijing) Co., Ltd. The DNA concentration was determined using a Thermo Fisher Scientific Nanodrop 2000 spectrophotometer, and the concentration was adjusted to 40 ng / μL.

[0062] 4. Implementation of KASP molecular markers

[0063] 1) PCR amplification reaction

[0064] The extracted DNA was added to 96-well plates with full skirts to prepare the reaction system for PCR amplification. PCR reaction system: The total volume of the reaction system was 10 μL, including 5 μL of 2×KASP Master mix, 0.14 μL of KASP Primer mix, 1 μL of template DNA, and 3.86 μL of ddH2O.

[0065] PCR reaction program: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s; 61-55℃ annealing and extension for 60 s, 10 cycles (decreasing by 0.6℃ per cycle); 94℃ denaturation for 20 s; 55℃ annealing and extension for 60 s, 26 cycles.

[0066] 2) Genotyping using KASP molecular markers

[0067] After the reaction, fluorescence signals were scanned using a Roche Light Cycler 480 instrument. Based on the color classification of the three fluorescence types detected, the genotypes of samples clustered near the X-axis (showing blue) were those with alleles BEIIb(C / C), SSIV-1(T / T), SSI(A / A), SSIIa(A / A), and PUL(G / G) linked to the FAM fluorescent tag sequences. The genotypes of samples clustered near the Y-axis (showing red) were those with alleles BEIIb(T / T), SSIV-1(C / C), SSI(G / G), SSIIa(G / G), and PUL(A / A) linked to the HEX fluorescent tag sequences. The genotypes of samples showing green in the middle were heterozygous, representing BEIIb(C / T), SSIV-1(T / C), SSI(A / G), SSIIa(A / G), and PUL(G / A). SNP locus information is shown in Table 3.

[0068] Table 3. Amino acid variations caused by missense SNPs in SSRG genes.

[0069]

[0070]

[0071] Example 2

[0072] 1. Materials

[0073] 1) Donor parents

[0074] "Sidao 301" is a new late-maturing medium-grain japonica rice variety bred by the Suqian Academy of Agricultural Sciences of Jiangsu Academy of Agricultural Sciences. According to tests conducted by the Food Quality Supervision and Testing Center (Wuhan) of the Ministry of Agriculture and Rural Affairs in 2019, it has a milled rice rate of 76.3%, a head rice rate of 74.8%, a chalky grain rate of 16%, a chalkiness of 1.8%, a gel consistency of 70 mm, and an amylose content of 16.7%, meeting the national standard for Grade II high-quality rice. It was grown in paddy fields at the comprehensive experimental base of the Jiangsu Academy of Agricultural Sciences under conventional field water and fertilizer management.

[0075] 2) Reincarnation Parent

[0076] "Nanjing 9108" is a late-maturing medium-grain japonica rice variety bred by the Institute of Food Crops, Jiangsu Academy of Agricultural Sciences. This variety is highly recommended by Jiangsu Province and the Ministry of Agriculture and Rural Affairs due to its high and stable yield and excellent eating quality. It was grown in paddy fields at the comprehensive experimental base of the Jiangsu Academy of Agricultural Sciences, using conventional field water and fertilizer management.

[0077] 3) Homozygous genotype lines of BC3F5 progeny

[0078] Six homozygous genotype lines of BC3F5 progeny, constructed using the donor parent "Sidao 301" and the recurrent parent "Nanjing 9108," were grown in paddy fields at the Jiangsu Academy of Agricultural Sciences headquarters under conventional field water and fertilizer management.

[0079] 2. Improve the appearance and quality of rice

[0080] Over a three-year period (2020-2023), the molecular design process for improving the appearance quality of the semi-glutinous japonica rice variety Nanjing 9108 was completed. KASP-SNP markers were used to screen for five genes: BEIIb, SSIV-1, SSI, SSIIa, and PUL, in both backcross and self-crossing segregating populations. The specific breeding process (…) Figure 2 )as follows:

[0081] 1) In the summer of 2019, in Nanjing, the recurrent parent "Nanjing 9108" and the donor parent "Sidao 301" were crossbred to obtain F1 seeds.

[0082] 2) In the spring of 2020, F1 plants were backcrossed with the recurrent parent “Nanjing 9108” in Sanya to obtain BC1F1 seeds; in the summer of 2020, a segregating population of 236 BC1F1 plants was constructed in Nanjing, and four BC1F1 lines containing five target genes were screened out.

[0083] 3) Using four BC1F1 lines containing five target genes, backcrossing was performed with the recurrent parent “Nanjing 9108” to obtain BC2F1 seeds; in the spring of 2021, a segregating population of 301 BC2F1 plants was constructed in Sanya, and six superior haplotype BC2F1 plants containing five target genes were screened before heading.

[0084] 4) Backcrossing was carried out using the six superior haplotype BC2F1 plants containing five target genes and the recurrent parent “Nanjing 9108”. In the summer of 2021, a segregating population of 561 BC3F1 plants was constructed in Nanjing, and 27 BC3F1 plants with five genes were screened before heading.

[0085] 5) In the spring of 2022, a segregating population of 758 BC3F2 strains was constructed in Sanya using 27 BC3F1 strains that aggregated 5 genes, and 18 homozygous BC3F2 strains were screened out.

[0086] 6) In the summer of 2022, 18 homozygous BC3F2 single plants were planted in Nanjing and 11 homozygous BC3F3 lines were obtained through preliminary screening of agronomic traits.

[0087] 7) In the spring of 2023, 11 homozygous improved strains BC3F4 were screened and their agronomic traits were initially evaluated in Sanya. In the summer of 2023, 6 single plants of the appearance quality improved strain BC3F5 were officially confirmed in Nanjing.

[0088] 8) In the same year, rice quality and yield traits were evaluated on six individual plants of the appearance quality improvement line BC3F5.

[0089] The results are as follows Figure 3 and Figure 4 As shown, molecular marker-assisted screening ultimately yielded six new rice lines (Y16, Y75, Y115, Y121, Y143, and Y235) with different gene aggregations. Compared with the recurrent parent "Nanjing 9108", the appearance quality of rice in the five lines (Y16, Y75, Y115, Y143, and Y235) was significantly improved, with a marked decrease in chalkiness rate, chalkiness degree, and transparency. There were also some differences in rice appearance quality among the lines, with the chalkiness rate, chalkiness degree, and transparency of Y235 being close to those of the donor parent "Sidao 301".

[0090] The results are as follows Figure 5 As shown, compared with the recurrent parent "Nanjing 9108", the amylose content of the five lines (Y16, Y75, Y115, Y143 and Y235) was significantly increased. Compared with the donor parent "Sidao 301", the gel consistency was increased, the gelatinization temperature was decreased, and the protein content remained unchanged.

[0091] Example 3

[0092] KASP molecular markers were detected in the segregating population.

[0093] The total reaction volume was 10 μL, including 5 μL of 2×KASP Master mix, 0.14 μL of KASP Primer mix, 1 μL of template DNA, and 3.86 μL of ddH2O. The instrument used was a real-time quantitative PCR system, model: CFX96.

[0094] KASP-SNPPCR program: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s; 61-55℃ annealing and extension for 60 s, 10 cycles (decreasing by 0.6℃ per cycle); 94℃ denaturation for 20 s; 55℃ annealing and extension for 60 s, 26 cycles.

[0095] The results are as follows Figure 4As shown in Tables 4-6, KASP molecular markers developed for the target genes BEIIb, SSIV-1, SSI, SSIIa, and PUL were classified according to color. Samples clustered near the X-axis (showing blue) have genotypes of BEIIb(C / C), SSIV-1(T / T), SSI(A / A), SSIIa(A / A), and PUL(G / G) alleles linked to FAM fluorescent tag sequences. Samples clustered near the Y-axis (showing red) have genotypes of BEIIb(T / T), SSIV-1(C / C), SSI(G / G), SSIIa(G / G), and PUL(A / A) alleles linked to HEX fluorescent tag sequences. Samples in the center (showing green) have genotypes of BEIIb(C / T), SSIV-1(T / C), SSI(A / G), SSIIa(A / G), and PUL(G / A) heterozygous. Samples in the lower left corner (showing black) are blank controls.

[0096] Table 4. Primer sequence information for KASP molecular markers.

[0097]

[0098] Table 5. Primer sequence information for KASP molecular markers.

[0099]

[0100]

[0101] Table 6. Primer sequence information for KASP molecular markers.

[0102] SSI chr6 GTTCTCCGCCAAAGCATGGAATCTT SSIIa chr6 CGCGCGGATGATGGGGAGAA SSIV-1 Chr1 CCCCCATTGTTACACCGTTCAACAA BEIIb Chr2 GCTCATATTTGTGCAACCCCCAGAA PUL Chr4 AGGGGACAGAGGGAGTAAGTTCTTT

[0103] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A primer set of KASP molecular markers for improving the quality of semi-glutinous rice, characterized in that, The primer sequences are shown below: SSI-F1: GAAGGTGACCAAGTTCATGCTGCCTTGAACAAAAATTTTGCAAACGCT, SSI-F2: GAAGGTCGGAGTCAACGGATTCCTTGAACAAAAATTTTGCAAACGCC, SSI-R: GTTCTCCGCCAAAGCATGGAATCTT; SSIIa-F1: GAAGGTGACCAAGTTCATGCTAAGAGAACTCCTCCTCCTCGG, SSIIa-F2: GAAGGTCGGAGTCAACGGATTAAGAGAACTCCTCCTCCTCGC, SSIIa-R: CGCGCGGATGATGGGGAGAA; SSIV-1-F1:GAAGGTGACCAAGTTCATGCTGGAAAGTGGATGCGACGGATGA, SSIV-1-F2:GAAGGTCGGAGTCAACGGATTGAAAGTGGATGCGACGGATGC, SSIV-1-R:CCCCATTGTTACACCGTTCAACAA; BEIIb-F1: GAAGGTGACCAAGTTCATGCTGTGGCATGCTAGAGTTTGACG, BEIIb-F2: GAAGGTCGGAGTCAACGGATTCGTGGCATGCTAGAGTTTGACA, BEIIb-R: GCTCATATTTGTGCAACCCCCAGAA; SBE4-F1:GAAGGTGACCAAGTTCATGCTGCATCGAACAATTCTGCTTCCAG, SBE4-F2:GAAGGTCGGAGTCAACGGATTATGCATCGAACAATTCTGCTTCCAT, SBE4-R:AGGGGACAGAGGGAGTAAGTTCTTT.

2. The method for developing primer sets of KASP molecular markers for quality improvement of semi-glutinous rice as described in claim 1, characterized in that the steps are as follows: include: 1) Target gene sequencing was performed on the high amylose content donor parent "Sidao 301" and the low amylose content recurrent parent "Nanjing 9108" respectively; 2) Compare the BEIIb, SSIV-1, SSI, SSIIa, and PUL gene sequences between the donor and recipient parents to screen for SNP mutation sites; 3) KASP molecular markers were developed based on the screened SNP mutation sites, and KASP molecular markers for the quality improvement of semi-glutinous rice were finally developed. Primer sets for KASP molecular markers for the quality improvement of semi-glutinous rice were synthesized.

Images