A transcriptome and genome accessibility dual-modality sequencing kit and method

Abstract

The present invention discloses a transcriptome and genome accessibility dual-mode sequencing kit and method, which can simultaneously analyze the chromosome open region genome information and transcriptome information in a cell, and belongs to the field of single cell sequencing technology. The kit includes a transposase and a reverse transcription primer with a cell label 1, a first hybridization primer with a cell label 2, a second hybridization primer and a third hybridization primer with a cell label 3, and a variety of enzyme reagents; the method includes enzyme cutting, reverse transcription, terminal transferase tailing, connection, repair and amplification library and other steps. The present invention is based on a transposase with different cell marker sequences, random primers with different cell labels, connection primers and hybridization primers, to achieve hundreds of millions of molecular markers to mark single cells, and to perform ultra-high throughput transcriptome and genome accessibility sequencing, which has important application and promotion value.

Description

Technical Field

[0001] The present invention relates to the field of single-cell sequencing technology, and specifically, to a transcriptome and genome accessibility dual-modality sequencing kit and method, and more specifically, to a high-throughput sequencing kit and method for simultaneously analyzing genome and transcriptome data in the same cell. Background Art

[0002] Regulation of chromatin structure and gene expression is the basis of key transitions in cell lineages. With the significant development of sequencing technology and the decline in sequencing costs, various omics information of the genome, transcriptome, and epigenome in organisms can be analyzed at single-cell resolution, revealing the uniqueness of gene regulation in each cell, thereby solving problems that cannot be answered by population-level analysis. For example, the existing high-throughput single-cell transcriptome sequencing technology (scRNA-seq) can process millions of single-cell transcriptomes at the same time, greatly reducing costs while improving accuracy and sensitivity. At the same time, cell maps of multiple species have been published, including lower organisms such as nematodes, planarians, and hydras to higher mammals such as mice, rats, and humans. The construction of various maps plays a vital role in analyzing the cellular diversity of various species and lays the foundation for decoding the macroscopic molecular mechanisms of cell fate determination.

[0003] However, scRNA-seq also has certain limitations. Although this technology can discover new cell types and states, it is difficult to distinguish cells with similar transcriptomes but different functions based on transcriptome information alone, as the main source of some cell heterogeneity may not be closely related to the transcriptome. To solve this problem, single-cell multi-omics technology has emerged.

[0004] Multimodal data analysis can achieve more detailed characterization of cell phenotypes than transcriptome sequencing alone. With the advancement of high-throughput single-cell analysis technologies for transcriptome, chromatin accessibility, DNA methylome, and histone modification, people have the ability to decompose cell types from mixed cell populations and analyze the cell type-specific transcriptome and epigenomic states in original tissues. The methods used include joint analysis of gene expression and genomic sequence, joint analysis of transcriptome and DNA methylome, and simultaneous mapping of ribosome occupancy and DNA methylome with transcriptome. Recently, many studies have been devoted to developing methods to jointly measure RNA and chromatin accessibility in single cells, such as SNARE-seq (Chen, S., Lake, BB, and Zhang, K. (2019). High-throughput sequencing of the transcriptome and chromatin accessibility in the same cell. Nat Biotechnol 37, 1452-+.10.1038 / s41587-019-0290-0), split-pool-based SHARE-seq (Ma, S., Zhang, B., LaFave, LM, Earl, AS, Chiang, Z., Hu, Y., Ding, JR, Brack, A., Kartha, VK, Tay, T., et al. (2020). Chromatin Potential Identified by Shared Single-Cell Profiling of RNA and Chromatin. Cell 183,1103-+.10.1016 / j.cell.2020.09.056), Paired-seq (Zhu, CX, Yu, M., Huang, H., Juric, I., Abnousi, A., Hu, R., Lucero, J., Behrens, MM, Hu, M., and Ren, B. (2019). An ultra high-throughputmethod for single-cell joint analysis of open chromatin and transcriptome.NatStruct Mol Biol 26,1063-+.10.1038 / s41594-019-0323-x), SNARE-seq2(Plongthongkum,N.,Diep,D.,Chen,S.,Lake,BB,and Zhang,K.(2021).Scalable dual-omics profiling with single-nucleus chromatin accessibility and mRNA expression sequencing 2(SNARE-seq2).Nat Protoc 16,4992-+.10.1038 / s41596-021-00507-3.) and so on. These combined analysis methods can overcome the inherent limitations of scRNA-seq, further identify active accessible chromatin while obtaining cell transcriptome information, and provide a method to identify a new mechanism of chromatin-mediated lineage initiation at single-cell resolution. Establishing a high-throughput single-cell RNA and ATAC sequencing technology that combines the advantages of low cost, large scale, and high sensitivity is the future development trend. . Summary of the invention

[0005] In order to solve the problems of poor contamination rate and high cost of many existing single-cell multimodal technologies, the present invention aims to provide a single-cell genome sequencing technology based on single-end adapter transposase and ligase, which can obtain genome information and transcriptome information of chromosome open regions of millions of single cells at one time, and has ultra-high sensitivity and ultra-low transcriptome cross-contamination rate between species. To this end, the technical solution adopted by the present invention is as follows:

[0006] The first aspect of the present invention provides a transcriptome and genome accessibility dual-modality sequencing kit, comprising:

[0007] A transposase connected with a special customized sequence is used to connect the special customized sequence to the gene fragment while cutting the genome, the special customized sequence is a double-stranded sequence, which is a first-strand sequence and a second-strand sequence, wherein the first-strand sequence 5'-3' includes a connecting sequence 1 (AD1), a cell label 1 (BC1) sequence A and an embedding sequence in sequence, and the second-strand sequence is a complementary sequence of the embedding sequence;

[0008] A reverse transcription primer, 5'-3' includes a connection sequence 1, a cell label 1 sequence R and a random sequence in sequence, wherein the random sequence is used to hybridize with RNA and extend to obtain a cDNA sequence, wherein the cell label 1 sequence R is different from the cell label 1 sequence A and corresponds to each other one by one;

[0009] The first hybridization primer includes, in 5'-3' order, a sequencing adapter 1 (i7) sequence, a cell label 2 (BC2) sequence, and a connection sequence 2 (AD2),

[0010] A bridging primer, which includes at least a portion of a complementary sequence to the connecting sequence 1 and at least a portion of a complementary sequence to the connecting sequence 2 in sequence from 5' to 3', and is used to connect the connecting sequence 1 and the connecting sequence 2;

[0011] The second hybridization primer includes, in 5'-3' order, a complementary sequence of the embedded sequence, a cell label 3 (BC3) sequence A, a complementary sequence of at least a portion of the connection sequence 1, and a sequencing adapter 2 (P5) sequence;

[0012] The third hybridization primer, 5'-3' includes the linker sequence 3, the cell tag 3 sequence R and the poly T sequence in sequence;

[0013] The first PCR amplification primer combination includes two first PCR amplification upstream primers and one first PCR amplification downstream primer, wherein one first PCR amplification upstream primer is a sequencing adapter 2 sequence, which is used to pre-amplify an open genomic fragment; the other first PCR amplification upstream primer 5'-3' sequentially includes at least a portion of the sequencing adapter 2 sequence and at least a portion of the connection sequence 3, which is used to pre-amplify cDNA; the first PCR amplification downstream primer 5'-3' is a reverse complementary sequence of at least a portion of the sequencing adapter 1 sequence;

[0014] The second PCR amplification primer combination includes a genome second PCR amplification upstream primer, a transcriptome second PCR amplification upstream primer and a second PCR amplification downstream primer, wherein the 5'-3' of the genome second PCR amplification upstream primer is sequentially a sequencing adapter 2 sequence and a base sequence for increasing amplification specificity, the 5'-3' of the transcriptome second PCR amplification upstream primer is sequentially a sequencing adapter 2 sequence and at least a portion of a connection sequence 3, and the second PCR amplification downstream primer is a sequencing adapter sequence including an index sequence.

[0015] In some embodiments of the present invention, the preparation process of the transposase connected with a special customized sequence is as follows:

[0016] (1) preparing or obtaining a first chain primer including the first chain sequence and a second chain primer including the second chain sequence, mixing them in equal proportions and then cooling the temperature from 95° C. to 25° C. to obtain a transposase primer working solution; the first chain primer carries a different cell label 1 sequence A, and the first chain primer and the second chain primer of the same cell label 1 sequence A are mixed respectively to obtain a plurality of different transposase primer working solutions;

[0017] (2) Incubate the transposase with different transposase primer working solutions at 30°C for 30 to 60 minutes.

[0018] In some embodiments of the present invention, the cell tag 1 sequence A, cell tag 1 sequence R, cell tag 2 sequence, cell tag 3 sequence A and cell tag sequence R each include 6 to 15 randomly synthesized bases.

[0019] In some specific embodiments of the present invention, the Hamming distance between different sequences of any one of the cell label 1 sequence A, cell label 1 sequence R, cell label 2 sequence, cell label 3 sequence A and cell label sequence R is greater than or equal to 4, for example, there are at least 4 different bases between different sequences of the cell label 1 sequence A, and there are at least 4 different bases between different sequences of the cell label 2 sequence. In addition, there are at least 4 different bases between the sequences of different cell labels.

[0020] In some preferred embodiments of the present invention, the 3' end of the second hybridization primer sequence carries an invT modification to prevent primer degradation and non-specific extension.

[0021] In some embodiments of the present invention, the random sequence in the reverse transcription primer includes 5 to 10 randomly synthesized base sequences, and the random sequence is used to complement the RNA molecule, thereby providing the binding site required for the reverse transcription reaction. The random sequence can be used to obtain information on the full-length transcriptome, discover more new genes, variable splicing, accurately locate fusion genes, and improve genome annotation.

[0022] Furthermore, the kit also includes a cell nucleus preparation solution, a nuclear lysis solution, an enzyme digestion reaction solution, a reverse transcription buffer, a terminal transferase buffer, a ligation buffer and / or a PCR buffer.

[0023] In some embodiments of the present invention, the cell nucleus preparation solution includes 0.1-0.2% IGEPAL CA-630, 1 mM DTT, 5% BSA, 400 U / mL RNase inhibitor and 1× protease inhibitor.

[0024] In some embodiments of the present invention, the enzyme cleavage reaction solution includes: 20 mM pH 7.5 Tris-HCl, 10 mM MgCl2, 10-20% dimethylformamide and 400 U / mL RNase inhibitor.

[0025] The second aspect of the present invention provides a method for sequencing using the transcriptome and genome accessibility dual-modality sequencing kit according to the first aspect of the present invention, comprising the following steps:

[0026] S1, obtaining cells or cell nuclei of cells to be sequenced and fixing them, and evenly dispensing the fixed cells or cell nuclei into a multi-well plate;

[0027] S2, using the transposase connected with the special customized sequence to cut the gene sequence, the cell label 1 sequence A of the transposase added to each well is different;

[0028] S3, washing off the enzyme cutting system by centrifugation, adding the reverse transcription primer to each well where the cell nucleus is located, wherein the cell label 1 sequence R of the reverse transcription primer added to each well is different and mutually different from and one-to-one corresponds to the cell label 1 sequence A, performing a reverse transcription reaction in a reverse transcription buffer to obtain a cDNA sequence, and collecting and mixing the cells or cell nuclei;

[0029] S4, using terminal transferase to add a poly A sequence to the 3' end of the cDNA sequence, then evenly dispensing the cell nuclei into the multi-well plate again, adding the first hybridization primer to each well, wherein the cell label 2 sequence of the first hybridization primer added to each well is different, and connecting the connection sequence 1 and the connection sequence 2 in the presence of the bridge primer;

[0030] S5, collecting and mixing the cell nuclei, and evenly dispensing them into the multi-well plate again, adding the cell lysate, the second hybridization primer and the third hybridization primer into each well, wherein the cell label 3 sequence A of the second hybridization primer and the cell label 3 sequence R of the third hybridization primer added into each well are different and correspond one to one.

[0031] S6, using DNA ligase and DNA polymerase to complete the cut DNA and cDNA into a complete double-stranded chain;

[0032] S7, using the first PCR amplification primer combination to perform a first round of amplification, and then splitting the product into two, and using the second PCR amplification primer combination to perform a second round of amplification respectively.

[0033] In some embodiments of the present invention, in step S1, the method of fixing comprises:

[0034] (1) Resuspend the cell nuclei in 4 mL of 0.2% PFA and fix at room temperature for 10 min, mixing occasionally;

[0035] (2) Add 30 μL of 2.5 M glycine and place on ice for 10 to 20 min to terminate fixation, mixing occasionally;

[0036] (3) Centrifuge at 300-800 g for 3-10 min at 4°C, wash the precipitate, and filter through a 30-50 μM filter.

[0037] In some embodiments of the present invention, after step S3 and before step S4, a step of exonuclease removal of excess reverse transcription primers is further included.

[0038] In some embodiments of the present invention, in step S4, the first hybridization primer and the bridge primer are first annealed and hybridized and then mixed with the cell nucleus.

[0039] Beneficial Effects of the Invention

[0040] With respect to the prior art, the present invention has the following beneficial effects:

[0041] The kit of the present invention uses a single-end adapter transposase-embedded complex with a cell tag 1 sequence A to perform a transposition reaction on an open genome, and then uses a reverse transcription primer with a different cell tag 1 sequence R to label RNA in the original well, and then uses two rounds of hybridization reactions and one round of PCR reactions to make the cells carry a total of four rounds of molecular labels, which can be labeled at one time and obtain hundreds of millions of single-cell chromatin open information and transcriptome information, and by merging the corresponding cell tag 1 sequence data, the single-cell chromatin open information and transcriptome information of the same cell can be analyzed simultaneously. The sequencing method of the present invention provides a direct method to determine the coordination between gene regulatory layers, and can obtain more detailed cell phenotypic characterizations than existing single-omics methods, thereby restoring the subtle but biologically important differences between chromatin accessibility and gene expression.

[0042] The sequencing method of the present invention has ultra-high sensitivity. Compared with other published multimodal sequencing methods, a single-end enzyme digestion and adapter conversion strategy is used to avoid the problem of enzyme digestion fragment loss caused by the use of Tn5 double-end enzyme in other published multimodal sequencing methods, and improve the efficiency of sequencing library construction. This method uses the design of random primer reverse transcription to obtain full-length transcriptome information, discover more new genes, variable shearing, accurately locate fusion genes, and improve genome annotation.

[0043] The entire process of this method does not require the use of complex instruments and has the advantages of low experimental cost, simple operation, short time consumption, high precision and high throughput. It has high promotion value in the single-cell field. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 A schematic diagram of the process of the high-throughput single-cell multimodal sequencing method disclosed in the present invention is shown.

[0045] Figure 2The cross-species contamination rate of human-mouse mixed cells in Example 2 of the present invention is shown. The left figure shows the proportion of transcripts (UMI) mapped to the human and mouse genomes in the same single cell; the middle figure shows the proportion of cell genome open region capture fragment reads (UM) mapped to the human and mouse genomes in the same single cell; the right figure shows the proportion of UMI and UM mapped to the human and mouse genomes at the same time. In the three figures, cells with more than 80% of reads mapped to the human and mouse genomes are represented by blue dots and red dots, respectively, and the remaining cells (mixed cells) are represented by gray dots.

[0046] Figure 3 Box plots show the UM (left) and gene numbers (right) of HEK293T, HepG2, and NIH / 3T3 cells captured using different sequencing methods. Specifically, the UM or gene numbers per cell captured from the same cell type by sci-CAR40 (GSE117089), sci-ATAC-seq (GSE67446), dscATAC-seq (GSE123581), SPLiT-seq (GSE110823), sci-RNA-seq (GSE98561), Drop-seq (GSE63269), and 10X scRNA-seq (1k_hgmm_v3_nextgem dataset) are shown.

[0047] Figure 4 The distribution of UMI and unique fragment number (UQ) of human-mouse mixed cells in Example 2 of the present invention is shown. 3876 cells with nFeature>200 and nFrags>500 are considered to be high-quality cells, with an average gene number of 1137.54, an average UQ of 18850.94, and an average open area at the transcription start site TSS of 11.21.

[0048] Figure 5 Shown are a schematic diagram of UMAP clustering of high-quality single-cell transcriptome data of whole brain tissue of adult C57BL / 6J mice in Example 3 of the present invention (left) and a schematic diagram of single-cell chromatin open region clustering (right). DETAILED DESCRIPTION

[0049] Unless otherwise indicated, implied from the context, or customary in the prior art, all parts and percentages in this application are based on weight, and the tests and characterization methods used are all synchronized with the filing date of this application. Where applicable, the contents of any patent, patent application or disclosure involved in this application are fully incorporated herein by reference, and their equivalent patent families are also introduced as references, especially the definitions of relevant terms in the art disclosed in these documents. If the definition of a specific term disclosed in the prior art is inconsistent with any definition provided in this application, the definition of the term provided in this application shall prevail.

[0050] Based on the shortcomings of the prior art, the inventors have developed a transcriptome and genome accessibility dual-modality sequencing kit and method. The kit includes:

[0051] (1) Transposase with a custom sequence

[0052] Used to connect the special customized sequence to the gene fragment while cutting the genome, the special customized sequence is a double-stranded sequence, which is a first-strand sequence and a second-strand sequence, wherein the first-strand sequence 5'-3' includes a connecting sequence 1, a cell label 1 sequence A and an embedding sequence in sequence, and the second-strand sequence is a complementary sequence of the embedding sequence;

[0053] In some embodiments of the present invention, the preparation process of the transposase connected with a special customized sequence is as follows:

[0054] (1) preparing or obtaining a first chain primer including the first chain sequence and a second chain primer including the second chain sequence, mixing them in equal proportions and then cooling the temperature from 95° C. to 25° C. to obtain a transposase primer working solution; the first chain primer carries a different cell label 1 sequence A, and the first chain primer and the second chain primer of the same cell label 1 sequence A are mixed respectively to obtain a plurality of different transposase primer working solutions;

[0055] (2) Incubate the transposase with different transposase primer working solutions at 30°C for 30 to 60 minutes.

[0056] In some specific embodiments of the present invention,

[0057] The second strand sequence is: 5'-[pho]CTGTCTCTTATACACATCT-3', where [pho] represents phosphorylation modification.

[0058] The first chain sequence including the connecting sequence 1, the cell label 1 sequence and the embedding sequence is:

[0059] 5'-phos-ACACTCTTTCCCTACACGACGjjjjjjjjjjjAGATGTGTATAAGAGACAG-3', 10j is the first cell label of the molecule in the open region of the genome (i.e., cell label 1 sequence A), and the Hamming distance between each group of 10j is greater than or equal to 4, that is, there are at least 4 different bases between any two cell labels. In the present invention, 768 combinations are designed.

[0060] (2) Reverse transcription primer

[0061] The reverse transcription primer 5'-3' sequentially includes a connection sequence 1, a cell label 1 sequence R and a random sequence.

[0062] The linker sequence 1 provides a primer binding site for the subsequent first step of hybridization, so that each successfully reverse-transcribed cDNA can be hybridized with the cell tag 2 sequence;

[0063] The cell label 1 sequence R and the cell label 1 sequence A are different and correspond one to one, and are used to distinguish the ATAC library and the RNA library in the same cell;

[0064] The random sequence is complementary to the RNA molecule, thereby providing the binding site required for the reverse transcription reaction, for hybridizing with the RNA and extending to obtain the cDNA sequence. In some embodiments of the present invention, the random primer sequence is 7 bases synthesized randomly. Compared with the poly-T sequence, the random sequence is conducive to the capture of the intracellular non-poly-A tail transcript, and also improves the capture efficiency of the transcript, greatly improving the sensitivity. The random sequence can also be used as a molecular tag to identify the mRNA corresponding to each sequence in the constructed sequencing library.

[0065] In some specific embodiments of the present invention, the reverse transcription primer sequence is:

[0066] 5'-phos-ACACTCTTTCCCTACACGACGjjjjjjjjjjjNNNNNNN-3', 10j is the first cell label of the RNA molecule (cell label 1 sequence R), the Hamming distance between each group of 10j is greater than or equal to 4, that is, there are at least 4 different bases between any two cell labels, N represents any one of A / T / C / G, and 7N is a randomly synthesized sequence used to hybridize with RNA and extend to obtain a cDNA sequence.

[0067] (3) First hybridization primer

[0068] The first hybridization primer 5'-3' sequentially includes a sequencing adapter 1 sequence, a cell tag 2 sequence and a connection sequence 2, and is used to connect the connection sequence 1 and the connection sequence 2 in the presence of a bridging primer.

[0069] In some embodiments of the present invention, the sequence of the first hybridization primer is:

[0070] 5'-TTGTCTTCCTAAGACCGCTTGGCCTCCGACTTjjjjjjjjjjjGGCAGCGTC-3'; 10j is a cell label 2 sequence, and the Hamming distance between each group of 10j is greater than or equal to 4, that is, there are at least 4 different bases between any two cell labels. In the present invention, 768 cell label 2 combinations are designed.

[0071] (4) Bridging Primer

[0072] The bridging primer 5′-3′ sequentially includes at least a portion of the complementary sequence of the connecting sequence 1 and at least a portion of the complementary sequence of the connecting sequence 2.

[0073] In some specific embodiments of the present invention, the bridging primer consists of a complementary sequence to the connecting sequence 1 and a complementary sequence to the connecting sequence 2.

[0074] In some embodiments of the present invention, the sequence of the bridging primer is:

[0075] 5'-GGAAAGAGTGTGACGCTGCC-3'

[0076] (5) Second hybridization primer

[0077] The second hybridization primer 5'-3' sequentially includes a complementary sequence to the embedded sequence, a cell label 3 sequence A, a complementary sequence to at least a portion of the connection sequence 1, and a sequencing adapter 2 sequence.

[0078] In some specific embodiments of the present invention, the sequence of the second hybridization primer is:

[0079] 5'-phos-CTGTCTCTTATACACATCTjjjjjjjjjjjCGTCGTGTAGGGAAAGAGTGTAAGTCGGATCGTAGCCATGTCGTTCinvT-3'; 10j is the cell label 3 sequence A. The Hamming distance between each group of 10j is greater than or equal to 4, that is, there are at least 4 different bases between any two cell labels.

[0080] In the present invention, 16 cell tag 3 sequence A combinations are designed, and the 3' end of the second hybridization primer is modified with invT to prevent primer degradation and non-specific extension.

[0081] (6) Third hybridization primer

[0082] The third hybridization primer 5'-3' sequentially includes a linker sequence 3, a cell label 3 sequence R and 20 thymines (T).

[0083] In some specific embodiments of the present invention, the sequence of the third hybridization primer is:

[0084] 5'-GACTTGTGGTATCAACGCAGAGTACGjjjjjjjjjjjTTTTTTTTTTTTTTTTTTTT-3'; 10j is the cell label 3 sequence A, and the Hamming distance between each group of 10j is greater than or equal to 4, that is, there are at least 4 different bases between any two cell labels. In the present invention, 16 cell label 3 sequence R combinations are designed.

[0085] (7) First PCR amplification primer combination

[0086] The first PCR amplification primer combination includes two first PCR amplification upstream primers and one first PCR amplification downstream primer, wherein one of the first PCR amplification upstream primers (P5-ATAC) is a sequencing adapter 2 sequence for pre-amplifying an open genomic fragment; the other first PCR amplification upstream primer (P5-RS1.2) 5'-3' sequentially includes at least a portion of the sequencing adapter 2 sequence and at least a portion of the connection sequence 3, for pre-amplifying cDNA; the first PCR amplification downstream primer (P7A) 5'-3' is a reverse complementary sequence of at least a portion of the sequencing adapter 1 sequence.

[0087] The sequence of the first PCR amplification upstream primer P5-ATAC is:

[0088] 5'-[phos]-GAACGACATGGCTACGATCCGAC-3';

[0089] The sequence of the first PCR amplification upstream primer P5-RS1.2 is:

[0090] 5'-CGATCCGACTTGTGGTATCAACGCAGAGTACG-3';

[0091] The sequence of the first PCR amplification downstream primer P7A is:

[0092] 5'-TTGTCTTCTAAGACCGCTTGGC-3';

[0093] (8) Second PCR amplification primer combination

[0094] The second PCR amplification primer combination includes two second PCR amplification upstream primers (a genomic second PCR amplification upstream primer and a transcriptome second PCR amplification upstream primer) and a second PCR amplification downstream primer. The genomic second PCR amplification upstream primer (P5-AL) 5'-3' is a sequencing adapter 2 sequence and a 6-base sequence for increasing amplification specificity; the transcriptome second PCR amplification upstream primer (P5-RNA1.2) 5'-3' is a complete sequencing adapter 2 sequence and at least a portion of the connection sequence 3; the second PCR amplification downstream primer (i7-ATAC) is a sequencing adapter sequence including an index sequence.

[0095] The sequence of the upstream primer P5-AL for the second PCR amplification of the genome is:

[0096] 5'-[phos]-GAACGACATGGCTACGATCCGACTTACAC-3';

[0097] The sequence of the upstream primer P5-RNA1.2 for the second PCR amplification of the transcriptome is:

[0098] 5'-[phos]-GAACGACATGGCTACGATCCGACTTGTGGTATCAACGC-3';

[0099] The sequence of the second PCR amplification downstream primer i7-ATAC is:

[0100] 5'-TGTGAGCCAAGGAGTTGnnnnnnnnnnTTGTCTTCCTAAGACCG-3', where 10n is the index sequence, which is used to distinguish different samples on the same chip.

[0101] (9) Reagents

[0102] Cell nucleus preparation solution: 0.1-0.2% IGEPAL CA-630, 1mM DTT, 5% BSA, 400U / mL RNase inhibitor and 1× protease inhibitor, prepared in PBS, ready for use. Preferably, the cell nucleus preparation solution: 0.1% IGEPAL CA-630, 1mM DTT, 5% BSA, 400U / mL RNase inhibitor, 1× protease inhibitor, prepared in PBS, ready for use.

[0103] Nuclear lysis buffer: prepared with 1% SDS, 0.1 mg / mL proteinase K, and 10 mM Tris-HCl, ready for use.

[0104] 2× enzyme digestion reaction solution: 20 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 10-20% dimethylformamide, ddH2O, stored at 4°C.

[0105] 1× reverse transcription buffer: 8% PEG8000, 0.5% Triton X-100, 0.5 mM dNTP, 100 U MaximaH Minus reverse transcriptase and 20 U RNase inhibitor.

[0106] 1× terminal transferase buffer: 10 mM CoCl2, 200 μM dATP, 400 U terminal transferase.

[0107] The sequencing method of the present invention using the above kit can simultaneously analyze the genome information and transcriptome information of the chromosome open region in a cell nucleus, and has ultra-high sensitivity and ultra-low cross-contamination rate between cell nuclei. Figure 1 , the sequencing method of the present invention is described in detail:

[0108] S1, taking the cell nuclei to be tested for fixation, and evenly dispensing the fixed cell nuclei into a multi-well plate;

[0109] In the present invention, the cell type is not limited, and can be any cell with a nucleus. There is no limitation on the activity state of the cell, and the cell can be a fresh cell, a cultured cell line, or a cell obtained by processing a tissue sample containing cells preserved in various ways. In some embodiments of the present invention, the cell is derived from a cultured cell line, and the cell line is digested into a single cell suspension with trypsin, and preferably, it can be washed with 1×PBS.

[0110] In some embodiments of the present invention, the cell nucleus preparation solution includes 0.1-0.2% IGEPAL CA-630, 1mM DTT, 5% BSA, 400U / mL RNase inhibitor and 1× protease inhibitor; in some specific embodiments of the present invention, the cell nucleus preparation solution includes 0.1% IGEPAL CA-630, 1mM DTT, 5% BSA, 400U / mL RNase inhibitor and 1× protease inhibitor PBS.

[0111] In some specific embodiments of the present invention, the cells are resuspended in the cell nucleus preparation solution, mixed evenly, placed on ice for 3 to 5 minutes, and then diluted with PBST washing solution to terminate the reaction. The PBST washing solution is prepared from PBS, and the concentrations of other components are as follows: 0.05% Triton X-100, 1% BSA.

[0112] S2, using the transposase connected with the special customized sequence to cut the gene sequence, the cell label 1 sequence A of the transposase added to each well is different;

[0113] In the present invention, in this step, the enzyme cleavage system can be added to each well of the multi-well plate in advance, or the enzyme cleavage system can be added after the cells are dispensed, or even the enzyme cleavage system can be mixed with the cell nucleus and then dispensed into the multi-well plate together. In some embodiments of the present invention, the enzyme cleavage system added to each well includes: 1-3 μL of a transposase working solution connected to a special custom sequence, 1× enzyme cleavage reaction solution, 0.01% to 0.05% digitonin, 0.1% Tween-20 and 400U / mL RNase inhibitor. Wherein, the concentration of the transposase working solution connected to the special custom sequence is 1 to 5 μM. The 2× enzyme cleavage reaction solution includes 20mM Tris-HCl (pH7.5), 10mM MgCl2, 10 to 20% dimethylformamide ddH2O configuration, and is stored at 4°C.

[0114] In some embodiments of the present invention, after the enzyme digestion reaction is completed, the step of washing the cell nucleus with PBSTin washing solution is further included. The PBSTin washing solution is 0.05-0.1% Tween-20, 400U / mL RNase inhibitor, prepared in PBS, and used immediately after preparation.

[0115] S3, washing off the enzyme cutting system by centrifugation, adding the reverse transcription primer to each well where the cell nucleus is located, wherein the cell label 1 sequence R of the reverse transcription primer added to each well is different, performing a reverse transcription reaction in the presence of a reverse transcription reagent to obtain a cDNA sequence, and collecting and mixing the cells or cell nuclei;

[0116] In some specific embodiments of the present invention, the reverse transcription system is a 6 μL system, including 1× reverse transcription buffer, 8% PEG8000, 0.5% Triton X-100, 0.5 mM dNTP, 100 U Maxima H Minus reverse transcriptase and 20 U RNase inhibitor. Further, the reverse transcription reaction procedure is as follows:

[0117] 8℃12sec, 15℃30sec, 20℃45sec, 25℃1min, 30℃1min, 42℃2min, 10 cycles in total, 42℃30min after each cycle.

[0118] Furthermore, after the reaction was completed, 10 μL of 40 mM EDTA was added to each well to terminate the reaction and incubated at room temperature for 10 min.

[0119] In some preferred embodiments of the present invention, after step S3, a step of exonuclease removal of excess reverse transcription primers is further included. Specifically:

[0120] (1) Prepare 100 μL of exonuclease system (1×ExoⅠ buffer, ExoⅠ 100U),

[0121] The cell nuclei were resuspended in the system and incubated at 37°C in an oven for 30 min at 10 rpm.

[0122] (2) Add an equal volume of 40 mM EDTA to terminate the reaction, then add PBST to collect the cell nuclei, centrifuge at 4°C, 500 g for 5 min, discard the supernatant, and wash twice with PBST.

[0123] S4, using terminal transferase to add a poly A sequence to the 3' end of the cDNA sequence, then evenly dispensing the cell nuclei into the multi-well plate again, adding the first hybridization primer to each well, wherein the cell label 2 sequence of the first hybridization primer added to each well is different, and connecting the connection sequence 1 and the connection sequence 2 in the presence of the bridging primer.

[0124] In some embodiments of the present invention, a poly A sequence is added to the 3' end of the cDNA sequence by terminal transferase, specifically:

[0125] (1) Prepare 100 μL of terminal transferase system (1× terminal transferase buffer, 10 mM CoCl2, 200 μM dATP, 400 U terminal transferase), resuspend the cell nuclei in the system, and incubate in a 37°C oven for 15 min at 10 rpm.

[0126] (2) Add an equal volume of 40 mM EDTA to terminate the reaction, then add PBST to collect the cell nuclei, centrifuge at 4°C, 500 g for 5 min, discard the supernatant, and wash twice with PBST.

[0127] In some embodiments of the present invention, the first hybridization primer is first annealed and hybridized with the bridge primer and then mixed with the cell nucleus. In some specific embodiments of the present invention, 30 μM of the first hybridization primer and 10 μM of the bridge primer are first mixed in a 1:1 ratio, and then the temperature is slowly reduced from 95°C to 25°C, so that the complementary sequence of the connection sequence 2 on the bridge primer hybridizes with the connection sequence 2 on the first hybridization primer to obtain a first hybridization primer-bridge primer hybrid double strand. The complementary sequence of the connection sequence 1 on the first hybridization primer-bridge primer hybrid double strand is then hybridized with the connection sequence 1, so that the connection sequence 1 and the connection sequence 2 are connected, thereby realizing the introduction of the cell label 2 sequence into the DNA and cDNA sequences.

[0128] S5, collecting and mixing the cell nuclei, and evenly dispensing them into the multi-well plate again, and adding the second hybridization primer and the third hybridization primer into each well. The cell label 3 sequence A of the second hybridization primer and the cell label 3 sequence R of the third hybridization primer added into each well are different, so that the complementary sequence of the embedded sequence is hybridized with the embedded sequence, the complementary sequence of the connecting sequence 1 is hybridized with the connecting sequence 1, and the poly T sequence of the third hybridization primer is hybridized with the poly A sequence of the cDNA, thereby connecting the cell label 3 sequence and at least a portion of the sequencing adapter 2 sequence to the gene fragment and the cDNA fragment.

[0129] In the present invention, after adding the second hybridization primer, in addition to the complementary sequence of the embedded sequence being able to hybridize with the embedded sequence, the complementary sequence of the connecting sequence 1 can also hybridize with the connecting sequence 1. That is to say, the second hybridization primer has two sequences that respectively bind to the embedded sequence and the connecting sequence 1 on the genomic fragment, thereby achieving the effect of adapter conversion. Compared with single-end binding, the product concentration obtained by this double-end binding method can be increased by 3 to 5 times, so the method has higher sensitivity. The hybridization between the third hybridization primer and cDNA is a more efficient T / A hybridization, so that the cell label 3 sequence R can be easily introduced into the cDNA sequence.

[0130] This round of hybridization reaction of the present invention belongs to extracellular hybridization reaction, which can greatly increase hybridization efficiency and improve sequencing sensitivity. In addition, compared with the common sequencing based on oligonucleotide chain hybridization marker chromosome accessibility, the second round of hybridization reaction does not require the addition of an additional blocking oligonucleotide sequence for the blocking step, and can control the intercellular contamination rate at an extremely low level, so the overall operation process is simpler and faster.

[0131] In some specific embodiments of the present invention, the reaction procedure is as follows: 55°C for 10 min, 65°C for 5 min, 50°C for 10 min (slow cooling from 65°C to 50°C at 0.1°C / s), 37°C for 5 min (slow cooling from 50°C to 37°C at 0.1°C / s), 25°C for 5 min (slow cooling from 37°C to 25°C at 0.1°C / s), and hold at 10 degrees.

[0132] The set temperature causes the original embedded fixed sequence to dissociate first, the complementary sequence of the embedded sequence of the second hybridization primer hybridizes with the embedded sequence, the complementary sequence of the connecting sequence 1 hybridizes with the connecting sequence 1, and finally the third hybridization primer hybridizes with the poly A sequence of the cDNA, and the two reactions do not interfere with each other.

[0133] Furthermore, the second round of hybridization reaction of the present invention is to control the annealing temperature so that the complementary sequence of the embedded sequence and the bridging primer are released from the product of the previous step, and the second hybridization primer is combined with the 3' end.

[0134] S6, using DNA ligase and DNA polymerase to complete the cut DNA and hybridized cDNA into a complete double strand;

[0135] S7, using the first PCR amplification primer combination to perform a first round of amplification, then splitting the product into two, and using the second PCR amplification primer combination to perform a second round of amplification respectively, to complete the construction of the sequencing library.

[0136] Using the above method, the structure of the final genomic library (ATAC library) from 5' to 3' ends is: sequencing adapter 1, cell tag 2 sequence, connection sequence 2, connection sequence 1, cell tag 1 sequence A, embedding fixed sequence, genome open fragment, embedding fixed sequence, cell tag 3 sequence A, connection sequence 1 and sequencing adapter 2; the structure of the transcriptome library (RNA library) from 5' to 3' ends is: sequencing adapter 1, cell tag 2 sequence, connection sequence 2, connection sequence 1, cell tag 1 sequence R, cDNA, PolyA, cell tag 3 sequence R and sequencing adapter 2. In some embodiments of the present invention, it further includes circularizing the obtained sequencing library, making DNB and sequencing.

[0137] In order to make the technical problems, technical solutions and beneficial effects solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments.

[0138] Example

[0139] The following examples are used to demonstrate preferred embodiments of the present invention. It will be appreciated by those skilled in the art that the techniques disclosed in the following examples represent techniques discovered by the inventors that can be used to implement the present invention and therefore can be considered as preferred embodiments of the present invention. However, it will be appreciated by those skilled in the art based on this specification that many modifications may be made to the specific embodiments disclosed herein and still achieve the same or similar results without departing from the spirit or scope of the present invention.

[0140] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, and the disclosure and materials cited therein are hereby incorporated by reference.

[0141] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many technical equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the claims.

[0142] The experimental methods in the following examples are conventional methods unless otherwise specified. The instruments and equipment used in the following examples are conventional laboratory instruments and equipment unless otherwise specified; the experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0143] Example 1 Preparation of transposase with oligonucleotide cell tag sequence

[0144] (1) Transposase embedding adapter sequence storage solution: Prepare a 5 μM Tn5 primer working solution and store it in a -80°C refrigerator. The sequence and preparation method are as follows:

[0145] Tn5 primerA (second chain sequence):

[0146] 5'-[pho]CTGTCTCTTATACACATCT-3',

[0147] [pho] represents phosphorylation modification, and this sequence is a fixed sequence for transposase embedding recognition.

[0148] Tn5 primerB (first strand sequence):

[0149] 5'-phos-ACACTCTTTCCCTACACGACGjjjjjjjjjjAGATGTGTATAAGAGACAG-3',

[0150] 10j is the cell label 1 sequence A, and the Hamming distance between each group of 10j is greater than or equal to 4, that is, there are at least 4 different bases between any two cell labels, and there are 1 to 768 cell label combinations.

[0151] Tn5 primerA (100 μM) and Tn5 primerB (100 μM) were mixed in equal volumes, and the temperature was slowly reduced from 95°C to 25°C in a PCR instrument to obtain Tn5 primer working solution.

[0152] (2) Incubate Tn5 naked enzyme and Tn5 primer working solution at 30°C for 30-60 min and store in a -20°C refrigerator.

[0153] Example 2 Species Mixed (Human 293T Cell Line and Mouse 3T3 Cell Line) Cell Experiment

[0154] 1. Reagent Preparation

[0155] 10% BSA: Prepared in DPBS and stored at 4°C.

[0156] Prepared with 10% Tween-20:ddH2O and stored at 4℃.

[0157] 40% / 50% PEG8000: prepared in ddH2O and stored at 4℃.

[0158] 10% IGEPAL CA-630: Prepared in ddH2O and stored at 4°C.

[0159] 1% digitonin stock solution (Promega G9441): prepared in DMSO and stored at -20°C.

[0160] 0.2% PFA diluent: prepared in PBS, ready for use.

[0161] Prepared in 40 mM EDTA: 10 mM Tris-HCl (pH 8.0) and stored at 4°C.

[0162] 100× protease inhibitor stock solution (Roche, 04693132001): prepared in ddH2O, stored at -20°C for 12 weeks and at 4°C for 2 weeks.

[0163] 2× enzyme digestion reaction solution: 20 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 20% dimethylformamide, ddH2O, stored at 4°C.

[0164] WBin washing solution: 1% BSA, 0.05% Triton X-100, 400U / mL RNase inhibitor, prepared in PBS, ready for use.

[0165] PBSTin washing solution: 0.05% Tween-20, 400U / mL RNase inhibitor, prepared in PBS, ready for use.

[0166] PBST washing solution: 0.05% Tween-20, prepared in PBS, ready for use.

[0167] Cell nucleus preparation solution: 0.1% IGEPAL CA-630, 1mM DTT, 5% BSA, 400U / mL RNase inhibitor, 1× protease inhibitor, prepared in PBS, ready for use.

[0168] Nuclear lysis buffer: prepared with 1% SDS, 0.1 mg / mL proteinase K, and 10 mM Tris-HCl, ready for use.

[0169] 2. Cell Nucleus Preparation

[0170] Mouse embryonic fibroblasts 3T3 and human embryonic kidney cells (293T) were resuspended in the cell nucleus preparation solution and mixed evenly, and placed on ice for 5 minutes. During this period, the cells were blown twice and then diluted with WBin washing solution to terminate the reaction.

[0171] 3. Fixation

[0172] Take human 293T cell nuclei and mouse 3T3 cell nuclei and mix them in a ratio of 1:1 to a total of 4 million cells. Resuspend the cells with 4 mL of 0.2% PFA diluent and place them at room temperature for 10 minutes. During this period, shake the centrifuge tube continuously to prevent the cell nuclei from sticking together. Add 30 μL of 2.5 M glycine to terminate the fixation. Place them on ice for 10 minutes, fill the cell nuclei with WBin wash solution, and centrifuge at 650g at 4°C for 5 minutes. Wash once with 1 mL of WBin wash solution and filter through a 40 μM filter.

[0173] 4. Tn5 digestion reaction

[0174] Human 293T cell nuclei were mixed with mouse 3T3 cell nuclei in a 1:1 ratio, and 80,000 cells per well were added to a multi-well plate pre-added with an enzyme digestion system, and reacted at 55°C for 30 minutes.

[0175] 5. Nuclei Cleaning

[0176] Add 150 μL PBSTin wash solution to each well, centrifuge at 650g for 5 min at 4°C, and carefully discard the supernatant.

[0177] 6. Random Primer Reverse Transcription

[0178] (1) Take 2 μL of 10 μM reverse transcription primer into a 96-well plate, place it in a PCR instrument for high temperature single-stranding for 3 min, and then immediately place it on ice for later use.

[0179] The nucleotide sequence of the reverse transcription primer is:

[0180] 5'-phos-ACACTCTTTCCCTACACGACGjjjjjjjjjjjNNNNNNN-3', 10j is the first cell label of the RNA molecule (cell label 1 sequence R), the Hamming distance between each group of 10j is greater than or equal to 4, that is, there are at least 4 different bases between any two cell labels, N represents any one of A / T / C / G, and 7N is a randomly synthesized seven-base sequence (random sequence) that provides the binding site required for the reverse transcription reaction.

[0181] (2) Prepare 6 μL of other components of the reverse transcription system (1× reverse transcription buffer, 8% PEG8000, 0.5% Triton-100, 0.5 mM dNTP, 100 U Maxima H Minus reverse transcriptase, 20 U RNase inhibitor), use a dispenser to distribute the system into a 96-well plate containing primers, and then resuspend the cell nuclei with 8 μL of the reverse transcription system containing primers. Then place the cells in a PCR instrument for reverse transcription reaction, the procedure is as follows:

[0182] 8℃12sec, 15℃30sec, 20℃45sec, 25℃1min, 30℃1min, 42℃2min, 10 cycles in total, 42℃30min after each cycle.

[0183] (3) After the reaction, add 10 μL 40 mM EDTA to terminate the reaction and incubate at room temperature for 10 min;

[0184] (4) All cells in the 96-well plate were then collected into a centrifuge tube, centrifuged at 4°C, 600 g for 5 min, and washed twice with PBST.

[0185] 7. External cutting

[0186] (1) Prepare 200 μL of exonuclease system (1×ExoⅠ buffer, ExoⅠ 200 U), resuspend the cell nuclei in the system, and incubate in a 37°C oven for 30 min at 10 rpm.

[0187] (2) Add an equal volume of 40 mM EDTA to terminate the reaction, then add PBST to collect the cell nuclei, centrifuge at 600 g for 5 min at 4°C, discard the supernatant, and wash twice with PBST.

[0188] 8. Terminal transferase tailing

[0189] (1) Prepare 100 μL of terminal transferase system (1× terminal transferase buffer, 5 mM CoCl2, 100 μM dATP, 400 U terminal transferase), resuspend the cell nuclei in the system, and incubate in a 37°C oven for 15 min at 10 rpm.

[0190] (2) Add an equal volume of 40 mM EDTA to terminate the reaction, then add PBST to collect the cell nuclei, centrifuge at 600 g for 5 min at 4°C, discard the supernatant, and wash twice with PBST.

[0191] 9. Hybridization-ligation reaction

[0192] After 768 30 μM first hybridization primers and 10 μM bridge primers were mixed in a ratio of 1:1, the temperature was slowly lowered from 95°C to 25°C, so that the bridge primer and the first hybridization primer formed a double strand, and a first hybridization primer-bridge primer hybrid double strand was obtained. The hybridization-ligation system was prepared: 2 μM first hybridization primer-bridge primer hybrid double strand, 1×E.coli buffer, 10% PEG, 1UE.coli ligase.

[0193] The cells were resuspended using a hybridization-ligation system and 2,000 nuclei were aliquoted into a multi-well plate for ligation at 16°C for 120 min.

[0194] The sequence of the first hybridization primer is:

[0195] 5'-TTGTCTTCCTAAGACCGCTTGGCCTCCGACTTjjjjjjjjjjjGGCAGCGTC-3', 10j is the cell label 2 sequence, and the Hamming distance between each group of 10j is greater than or equal to 4, that is, there are at least 4 different bases between any two cell labels.

[0196] The sequence of the bridging primer is:

[0197] 5′-GGAAAGAGTGTGACGCTGCC-3′.

[0198] After the reaction was completed, an equal volume of 40 mM EDTA was added to each well for 5 min at room temperature. After each well system was diluted with PBST, all cell nuclei were collected in a centrifuge tube and then washed twice with PBST.

[0199] 10. Hybridization-cleavage reaction

[0200] 200 cell nuclei per well were distributed into a multi-well plate prepared with 3 μL of hybridization-lysis system per well and placed in a PCR instrument for reaction.

[0201] The hybridization-lysis system is: 1 μL of cell nuclear lysis solution, 1 μL of 10 μM second hybridization primer, and 1 μL of 2.5 μM third hybridization primer.

[0202] The second hybridization primer sequence is:

[0203] 5'-phos-CTGTCTCTTATACACATCTjjjjjjjjjjjCGTCGTGTAGGGAAAGAGTGTAAGTCGGATCGTAGCCATGTCGTTCinvT-3'; 10j is the cell tag 3 sequence A, and the Hamming distance between each group of 10j is greater than or equal to 4, that is, there are at least 4 different bases between any two cell tags. In this embodiment, 16 combinations of cell tag 3 sequence A are designed. The 3' end is modified with invT to prevent primer degradation and nonspecific extension.

[0204] The sequence of the third hybridization primer is:

[0205] 5'-GACTTGTGGTATCAACGCAGAGTACGjjjjjjjjjjjTTTTTTTTTTTTTTTTTTTT-3'; 10j is the cell label 3 sequence A, and the Hamming distance between each group of 10j is greater than or equal to 4, that is, there are at least 4 different bases between any two cell labels. In this embodiment, 16 cell label 3 sequence R combinations are designed.

[0206] The PCR instrument program is as follows: 55°C for 10 min, 65°C for 5 min, 50°C for 10 min (slow cooling from 65°C to 50°C at 0.1°C / s), 37°C for 5 min (slow cooling from 50°C to 37°C at 0.1°C / s), 25°C for 5 min (slow cooling from 37°C to 25°C at 0.1°C / s), and hold at 10 degrees.

[0207] 11. Extension-ligation reaction

[0208] In the system where the hybridization-cleavage reaction is completed, an equal volume of 10% Tween-20 is added to each well, and after centrifugation and mixing, 3 μL of the extension-ligation system is added and placed in a PCR instrument: 25°C for 10 min, 37°C for 30 min.

[0209] The extension-ligation system is: 1× DNA polymerase buffer, 2.5 U DNA ligase, 1 U DNA polymerase and 0.5 mM dNTP.

[0210] After the reaction, 1 μL 40 mM EDTA was added to each well to terminate the reaction, and the reaction solutions of the three hybridization primer wells with different cell labels were collected. 1.2×VAHTS DNA Clean Beads (Novozyme) purification magnetic beads were added for purification. The specific purification steps are detailed in the instruction manual.

[0211] 12. Sequencing Library Amplification

[0212] The purified product was added with a PCR system for amplification reaction. The amplification reaction was divided into two rounds. The first round of PCR system was: 1×KAPA HiFi HotStart ReadyMix, 0.2 μM P5-ATAC, 0.2 μM P5-RS1.2, 0.4 μM P7A.

[0213] The sequence of P5-ATAC is:

[0214] 5'-[phos]-GAACGACATGGCTACGATCCGAC-3';

[0215] The sequence of P5-RS1.2 is:

[0216] 5'-CGATCCGACTTGTGGTATCAACGCAGAGTACG-3';

[0217] The sequence of P7A is:

[0218] 5'-TTGTCTTCTAAGACCGCTTGGC-3';

[0219] The PCR program is as follows:

[0220] 95℃5min; 98℃, 20s; 65℃, 120s; 72℃, 60s, 2 cycles; 98℃, 20s; 65℃, 30s; 72℃, 30s, 4 cycles; 72℃, 5min; 10℃∞. After the reaction, 1.3× magnetic beads were added to each well to purify the library fragments. The products were evenly divided into two parts during elution, and the second round of PCR amplification was performed separately.

[0221] The second-round PCR amplification systems were: 1×KAPA HiFi HotStart ReadyMix, 0.2μM P5-AL, 0.2μM i7-ATAC and 1×KAPA HiFi HotStart ReadyMix, 0.2μM P5-RNA1.2, 0.2μM i7-ATAC.

[0222] The PCR program is as follows:

[0223] 95℃ for 5 min; 98℃ for 20 s; 65℃ for 120 s; 72℃ for 60 s, 4 cycles; 98℃ for 20 s; 65℃ for 30 s; 72℃ for 30 s, 8 cycles; 72℃ for 5 min; 10℃∞.

[0224] The sequence of P5-AL is:

[0225] 5'-[phos]-GAACGACATGGCTACGATCCGACTTACAC-3';

[0226] The sequence of P5-RNA1.2 is:

[0227] 5'-[phos]-GAACGACATGGCTACGATCCGACTTGTGGTATCAACGC-3';

[0228] i7-ATAC sequence is:

[0229] 5'-TGTGAGCCAAGGAGTTGnnnnnnnnnnTTGTCTTCCTAAGACCG-3', where 10n is the index sequence, which is used to distinguish different samples on the same chip.

[0230] After the reaction, two rounds of magnetic bead sorting were added to purify the 250-500 bp library fragments.

[0231] 13. Circularization Sequencing Library

[0232] The library was circulated using the VAHTS Circularization Kit for MGI from Novozymes according to the instructions, and the circulated product was stored at -20°C. The library concentration was determined using the Qubit 3.0 fluorescent reagent, and 1 μL of the library was used for length distribution detection using the Agilent 2100 Bioanalyzer. The remaining library was used to produce DNBs using the DNBSEQ-T7 sequencing platform.

[0233] 14. Sequencing and data analysis

[0234] The sequencing library was sequenced using the DNBSEQ-T7 sequencing platform in PE150 mode, and the original fastq data was returned.

[0235] For RNA, we used the drop-seq toolkit to pre-process the microplate sequencing results. For detailed operation procedures, see the Drop-seq tutorial (https: / / github.com / broadinstitute / Drop-seq / releases).

[0236] (1) Use sccpipe to split the sequencing data according to the sequencing index to obtain single col data.

[0237] (2) Use Java's picard software to merge the fastq files of reads1 and reads2 into a bam file.

[0238] (3) Using Drop-seq tools for processing mainly includes four steps. The first step is pre-alignment. The barcodes and umi sequences of each pair of reads are extracted from the bam file and labeled, and then a round of filtering is performed based on the base quality. The second step is alignment. The STAR alignment tool is used to align the sequences larger than 20bp in Read 2 to the reference genomes of humans (hg19) and mice (mm10). The alignment results aligned to multiple sites are removed, and the unique alignment reads are retained. The third step is to sort the alignment results. The fourth step is to integrate the alignment results, merge the alignment results with the same unique molecular markers and the same cell barcodes, and label the reads with the gene labels obtained by the alignment. The fifth step, which is also the last step, is to generate a gene digital expression matrix (DigitalExpression). Generally, cells with less than 500 unique molecular labels are regarded as "empty cells" as the transcriptional background, and cells with more than 500 unique molecular labels are regarded as real cells. They are written into the final expression matrix results and a cell expression summary file is generated.

[0239] For ATAC data, cutadapt is required to delete the embedded fixed sequence at the end of the sequence, and then the trimmed sequence is aligned with the reference genome using the bwa alignment tool. The alignment results are processed by snaptools and output as ATAC-snap format files. Finally, with the help of dedicated Python tools, the fragment information in these ATAC-snap files is extracted and sorted for subsequent in-depth analysis.

[0240] If the number of fragments of a cell that uniquely maps to the human or mouse reference genome is less than 90%, it is considered a cross-contaminated cell. Figure 2The contamination rate between species is shown to be less than 0.22% whether from the open genome sequence or the transcriptome sequence, which is at an extremely low level compared with other library construction platforms.

[0241] In addition, a comprehensive comparison of several published single-omics and multi-omics methodological platforms, including Paired-se and sci-CARF multi-omics platforms; single-cell ATAC sequencing technologies such as sci-ATAC-seq and dscATAC-seq; and single-cell transcriptome sequencing technologies such as SPLiT-seq, Drop-seq, sci-RNA-seq, and 10×scRNA-seq, showed that Figure 3 The left picture shows the UM measured by each single-cell ATAC-seq platform for each nucleus, and the right picture shows the number of genes measured by each single-cell RNA-seq platform for each nucleus.

[0242] The results show that the sequencing method of the present invention (red column) has much higher sensitivity in detecting genes in HEK293T and NIH / 3T3 cells than other ATAC-seq platforms. In comparison with various RNA-seq platforms, the sequencing method of the present invention has significantly higher sensitivity in detecting transcriptomes of HEK293T and NIH / 3T3 cells than other multi-omics platforms, and even higher than some single-omics platforms, thus proving that the sequencing kit and method of the present invention have ultra-high sensitivity.

[0243] Example 3 Single-cell sequencing of whole brain tissue of adult C57BL / 6J mice

[0244] Take the whole brain tissue of wild-type C57BL / 6J, dry the water and place the brain tissue in a mortar, quickly pour liquid nitrogen, grind the tissue into powder, use tweezers to clamp part of the tissue in the cell nucleus preparation solution to obtain a single cell nucleus suspension, and the remaining steps are the same as Example 2, and take about 15,000 cells for hybridization-lysis reaction for library construction. The library was sent to the DNBSEQ-T7 sequencing platform for quality detection and sequencing, using the PE150 sequencing strategy, and the original data was returned for screening and comparison to obtain the genome open region enrichment map and gene expression spectrum. According to the actual sequencing depth, high-quality data cells (nFeature>200, nFrags>500) were filtered, and a total of 3,876 single-cell multi-omics data were obtained, such as Figure 4 As shown in the figure, the average number of genes is 1137.54, the average number of fragments is 18850.94, and the average TSS is 11.21. Then R was used to analyze gene expression. The specific steps are as follows:

[0245] 1. Use the ScaleData function (Seurat package) to center the gene expression in the integrated Seurat object, use RunPCA (Seurat package) to perform principal component analysis (PCA) on the highly variable genes, and refer to the inflection point of the ElbowPlot curve to select the PCA dimension used subsequently.

[0246] 2. In the RunUMAP (Seurat package) function, use fit-tsne to reduce the dimension using the selected PCA dimensions. In this function, set dims to the selected PCA number.

[0247] 3. Use the FindNeighbors and FindClusters functions (Seurat package) to cluster cells based on the distance between them. Set k.param to 10 and the dimension (dims) to the selected PCA dimension in FindNeighbors; set the number of iterations to 50 and the resolution to 1 in FindClusters.

[0248] 4. Use the DimPlot function (Seurat package) to visualize the clustering of each tissue. In this function, set reduction to "UMAP".

[0249] 5. The characteristic highly expressed genes (markers) of each cell subpopulation were calculated using the FindAllMarkers function (Seurat package) and the Wilcoxon rank sum test.

[0250] 6. Use dscblast (Fuyt27 / dscBLAST) method to compare and annotate the data, visualize UMAP, and cluster at single cell level. Figure 5 As shown, the transcriptome data (left figure) and ATAC data (right figure) obtained 18 and 12 cell populations, respectively, including various neurons in different brain regions and various glial cell subtypes, etc., indicating that the sequencing kit and sequencing method of the present invention have high sensitivity and high resolution of cell subtypes for large-scale high-throughput single-cell transcriptome.

[0251] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A transcriptome and genome accessibility dual-modality sequencing kit, characterized in that: include: A transposase connected with a special customized sequence is used to connect the special customized sequence to the gene fragment while cutting the genome, wherein the special customized sequence is a double-stranded sequence, which is a first-strand sequence and a second-strand sequence, wherein the first-strand sequence 5'-3' includes a connection sequence 1, a cell label 1 sequence A and an embedding sequence in sequence, wherein the second-strand sequence is a complementary sequence of the embedding sequence; A reverse transcription primer, 5'-3' includes a connection sequence 1, a cell label 1 sequence R and a random sequence in sequence, wherein the random sequence is used to hybridize with RNA and extend to obtain a cDNA sequence, wherein the cell label 1 sequence R is different from the cell label 1 sequence A and corresponds to each other one by one; The first hybridization primer includes, in 5'-3' order, a sequencing adapter 1 sequence, a cell tag 2 sequence, and a connection sequence 2, A bridging primer, which includes at least a portion of a complementary sequence to the connecting sequence 1 and at least a portion of a complementary sequence to the connecting sequence 2 in sequence from 5' to 3', and is used to connect the connecting sequence 1 and the connecting sequence 2; The second hybridization primer, 5'-3' sequentially includes the complementary sequence of the embedded sequence, the cell label 3 sequence A, at least a part of the complementary sequence of the connection sequence 1 and the sequencing adapter 2 sequence; The third hybridization primer, 5'-3' includes the linker sequence 3, the cell tag 3 sequence R and the poly T sequence in sequence; The first PCR amplification primer combination includes two first PCR amplification upstream primers and one first PCR amplification downstream primer, wherein one first PCR amplification upstream primer is a sequencing adapter 2 sequence, which is used to pre-amplify an open genomic fragment; the other first PCR amplification upstream primer 5'-3' sequentially includes at least a portion of the sequencing adapter 2 sequence and at least a portion of the connection sequence 3, which is used to pre-amplify cDNA; the first PCR amplification downstream primer 5'-3' is a reverse complementary sequence of at least a portion of the sequencing adapter 1 sequence; The second PCR amplification primer combination includes a genome second PCR amplification upstream primer, a transcriptome second PCR amplification upstream primer and a second PCR amplification downstream primer, wherein the 5'-3' of the genome second PCR amplification upstream primer is sequentially a sequencing adapter 2 sequence and a base sequence for increasing amplification specificity, the 5'-3' of the transcriptome second PCR amplification upstream primer is sequentially a sequencing adapter 2 sequence and at least a portion of a connection sequence 3, and the second PCR amplification downstream primer is a sequencing adapter sequence including an index sequence.

2. A transcriptome and genome accessibility dual-modality sequencing kit according to claim 1, characterized in that: The preparation process of the transposase connected with a special customized sequence is as follows: (1) preparing or obtaining a first strand primer including the first strand sequence and a second strand primer including the second strand sequence, mixing them in equal proportions and then cooling the mixture from 95° C. to 25° C. to obtain a transposase primer working solution; The first strand primers carry different cell label 1 sequences A, and the first strand primers and second strand primers of the same cell label 1 sequence A are mixed respectively to obtain a plurality of different transposase primer working solutions; (2) Incubate the transposase with different transposase primer working solutions at 30°C for 30-60 min.

3. A transcriptome and genome accessibility dual-modality sequencing kit according to claim 1, characterized in that: The cell label 1 sequence A, cell label 1 sequence R, cell label 2 sequence, cell label 3 sequence A and cell label 3 sequence R respectively include 6 to 15 bases.

4. A transcriptome and genome accessibility dual-modality sequencing kit according to claim 3, characterized in that: The Hamming distance between different sequences of any one of the cell label 1 sequence A, cell label 1 sequence R, cell label 2 sequence, cell label 3 sequence A and cell label 3 sequence R is greater than or equal to 4.

5. A transcriptome and genome accessibility dual-modality sequencing kit according to claim 4, characterized in that: The 3' end of the second hybridization primer is modified with invT.

6. A transcriptome and genome accessibility dual-modality sequencing kit according to any one of claims 1 to 5, characterized in that: It also includes cell nucleus preparation solution, nuclear lysis solution, enzyme digestion reaction solution, reverse transcription buffer, terminal transferase buffer, connection buffer, and PCR buffer.

7. The transcriptome and genome accessibility dual-modality sequencing kit according to claim 6, characterized in that: The cell nucleus preparation solution includes 0.1-0.2% IGEPAL CA-630, 1 mM DTT, 5% BSA, 400 U / mL RNase inhibitor and 1× protease inhibitor.

8. The transcriptome and genome accessibility dual-modality sequencing kit according to claim 6, characterized in that: The enzyme digestion reaction solution includes: 20mM pH7.5 Tris-HCl, 10mM MgCl2, 10-20% dimethylformamide and 400U / mL RNase inhibitor.

9. A method for sequencing using the transcriptome and genome accessibility dual-modality sequencing kit according to claim 1, characterized in that: The following steps are involved: S1, obtaining the cell nuclei of the cells to be sequenced and fixing them, and evenly dispensing the fixed cell nuclei into a multi-well plate; S2, using the transposase connected with the special customized sequence to cut the gene sequence, the cell label 1 sequence A of the transposase added to each well is different; S3, washing away the enzyme cutting system by centrifugation, adding the reverse transcription primer and reverse transcription buffer to each well where the cell nucleus is located, wherein the cell label 1 sequence R of the reverse transcription primer added to each well is different and mutually different from and one-to-one corresponding to the cell label 1 sequence A, performing a reverse transcription reaction in a reverse transcription buffer to obtain a cDNA sequence, and collecting and mixing the cells or cell nuclei; S4, using terminal transferase to add a poly A sequence to the 3' end of the cDNA sequence, then evenly dispensing the cell nuclei into the multi-well plate again, adding the first hybridization primer to each well, wherein the cell label 2 sequence of the first hybridization primer added to each well is different, and connecting the connection sequence 1 and the connection sequence 2 in the presence of the bridge primer; S5, collecting and mixing the cell nuclei, and evenly dispensing them into the multi-well plate again, adding the cell lysate, the second hybridization primer and the third hybridization primer into each well, wherein the cell label 3 sequence A of the second hybridization primer and the cell label 3 sequence R of the third hybridization primer added into each well are different and correspond to each other; S6, using DNA ligase and DNA polymerase to complete the cut DNA and cDNA into a complete double-stranded chain; S7, using the first PCR amplification primer combination to perform a first round of amplification, and then splitting the product into two, and using the second PCR amplification primer combination to perform a second round of amplification respectively.

10. The method according to claim 9, characterized in that In step S1, the fixing method includes: (1) Resuspend the nuclei in 4 mL of 0.2% PFA and fix at room temperature for 10 min, mixing occasionally. (2) Add 30 μL of 2.5 M glycine and place on ice for 10–20 min to terminate fixation, mixing occasionally. (3) Centrifuge at 300-800 g for 3-10 min at 4°C, wash the precipitate, and filter through a 30-50 μM filter.

Images