Monoclonal antibodies, antibody pairs and kits targeting human cone opsin-like protein 1 and their applications

Abstract

The present invention belongs to the technical field of antibody preparation, and in particular, relates to monoclonal antibodies, antibody pairs and kits for human cone protein-like protein 1 and their applications. The monoclonal antibody is a first antibody or a second antibody, and the amino acid sequences of CDR1-3 on the light chain of the first antibody are shown as SEQ ID NO.3-5, respectively, and the amino acid sequences of CDR1-3 on the heavy chain are shown as SEQ ID NO.8-10, respectively; the amino acid sequences of CDR1-3 on the light chain of the second antibody are shown as SEQ ID NO.13-15, respectively, and the amino acid sequences of CDR1-3 on the heavy chain are shown as SEQ ID NO.18-20, respectively. The antibody of the present invention has high binding activity and affinity to human VILIP-1 protein, and can form a double antibody sandwich enzyme-linked immunosorbent assay system to achieve specificity, sensitivity, reliability and accuracy detection of extremely trace levels of VILIP-1 in samples.

Description

Technical Field

[0001] The present invention relates to the technical field of antibody preparation, and in particular to a monoclonal antibody, an antibody pair and a kit targeting human cone opsin-like protein 1 and applications thereof. Background Art

[0002] Visinin-like protein-1 (VILIP-1) is encoded by the VSNL1 gene and is a member of the visinin / recoverin family of neuronal calcium sensors. It is mainly expressed in brain nerve cells and is involved in neuronal signal transduction. VILIP-1 is strongly expressed in cerebellar granule cells, binds to the membrane in a calcium-dependent manner, and regulates the intracellular signal transduction pathways of the central nervous system by regulating the activity of adenylate cyclase. In addition, VILIP-1 is also expressed in some liver, lung, kidney, spleen, pancreas and rectal tissues.

[0003] As a major participant in the Ca ion signaling cascade, VILIP-1 plays an important role in the pathophysiological process of central nervous system (CNS) diseases. Studies have shown that VILIP-1 is associated with neuronal damage and is abnormally expressed in neuropsychiatric diseases such as cerebrovascular diseases, Alzheimer's disease, brain tumors, and schizophrenia. It is a potential diagnostic marker and has great value in the early diagnosis and prognostic indicators of related diseases. Alzheimer's disease (AD) is a progressive, incurable and fatal neurodegenerative disease and the most common cause of senile dementia. Its clinical symptoms are persistent cognitive decline and its pathophysiological characteristics are extracellular amyloid-β (a-β) deposition, intracellular hyperphosphorylated tau neurofibrillary tangles and neuronal loss. Studies have shown that VILIP-1 can affect the progression of neurodegenerative diseases by affecting the deposition of a-β and the phosphorylation of tau protein. Therefore, neurons expressing VILIP-1 are more vulnerable to damage. The concentration of VILIP-1 is significantly increased in the cerebrospinal fluid of AD patients and in the hippocampus of schizophrenia patients. The detection of cerebrospinal fluid VILIP-1 and the ratio of VILIP-1 / amyloid protein-β42 (a-β42) are used as indicators to predict the progression of whole brain and local brain atrophy in early AD patients and normal cognitive control subjects. In addition to its diagnostic and predictive role in AD, VLIP-1 has also been found to be associated with ischemic stroke (IS). IS is one of the stroke diseases that seriously threatens human health. VILIP-1 is highly expressed in the brain. Increased levels of VILIPs can be detected in the serum and cerebrospinal fluid of patients in the early stage of IS with high sensitivity and specificity. NR2 peptide is a product of the cleavage of N-methyl-D-aspartate receptor (NMDAR) when brain cells are damaged and released into the blood through the blood-brain barrier. Studies have found that the combined detection of VILIP-1 and NR2 peptides can improve the early diagnosis rate of IS patients. In short, VILIP-1 plays an important role in neuronal damage and has high central nervous system specificity. Given the specificity and sensitivity of VILIP-1 as a biomarker for early diagnosis of Alzheimer's disease and ischemic stroke, it has strong diagnostic efficacy and clinical application value. Therefore, the high specificity and sensitivity of VILIP-1 detection has important medical and social significance for the early diagnosis and effective prevention and treatment of central nervous system-related diseases.

[0004] At present, the antibody-based enzyme-linked immunosorbent assay (ELISA) is the main technology for measuring VILIP-1 protein levels. The high specificity and high sensitivity of this method are mainly due to the development of VILIP-1 antibodies or antibody pairs. However, almost all VILIP-1 ELISA test kits on the market currently use mouse anti-human VILIP-1 monoclonal antibodies, which generally have low affinity and specificity. Therefore, ELISA test kits developed using mouse monoclonal antibodies have challenges such as poor specificity, low sensitivity, and difficulty in controlling batch differences. Summary of the invention

[0005] In view of the problems existing in the prior art, the present invention provides a monoclonal antibody, an antibody pair and a kit for human VILIP-1 and its application. The antibody of the present invention has high binding activity and affinity for human VILIP-1 and can realize the specificity, sensitivity, reliability and accuracy detection of trace amounts of VILIP-1 in samples. The present invention is specifically implemented by the following technical solutions:

[0006] In a first aspect, the present invention provides a monoclonal antibody against human cone opsin-like protein 1, which is a first antibody or a second antibody, wherein: the amino acid sequences of CDR1-3 on the light chain variable region of the first antibody are respectively shown as SEQ ID NOs.3-5, and the amino acid sequences of CDR1-3 on the heavy chain variable region are respectively shown as SEQ ID NOs.8-10; the amino acid sequences of CDR1-3 on the light chain variable region of the second antibody are respectively shown as SEQ ID NOs.13-15, and the amino acid sequences of CDR1-3 on the heavy chain variable region are respectively shown as SEQ ID NOs.18-20.

[0007] Furthermore, the amino acid sequence of the light chain variable region of the first antibody is shown as SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO.7; the amino acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO.17.

[0008] Furthermore, the amino acid sequence of the light chain of the first antibody is shown as SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown as SEQ ID NO.6; the amino acid sequence of the light chain of the second antibody is shown as SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown as SEQ ID NO.16.

[0009] Furthermore, the first antibody or the second antibody is a full-length antibody or an antibody fragment; the antibody fragment is selected from at least one of a Fab fragment, a F(ab)2 fragment, a Fv fragment, a (Fv)2 fragment, a scFv fragment and a sc(Fv)2 fragment.

[0010] The second aspect of the present invention provides a nucleic acid molecule, a recombinant vector or a host cell comprising the nucleic acid molecule, wherein the nucleic acid molecule encodes the first antibody or the second antibody as described above.

[0011] Furthermore, the nucleotide sequence of the light chain variable region of the first antibody is shown as SEQ ID NO.22, and the nucleotide sequence of the heavy chain variable region is shown as SEQ ID NO.24; the nucleotide sequence of the light chain variable region of the second antibody is shown as SEQ ID NO.26, and the nucleotide sequence of the heavy chain variable region is shown as SEQ ID NO.28.

[0012] Furthermore, the nucleotide sequence of the light chain of the first antibody is shown as SEQ ID NO.21, and the nucleotide sequence of the heavy chain is shown as SEQ ID NO.23; the nucleotide sequence of the light chain of the second antibody is shown as SEQ ID NO.25, and the nucleotide sequence of the heavy chain is shown as SEQ ID NO.27.

[0013] The third aspect of the present invention provides a monoclonal antibody pair against human cone opsin-like protein 1, which consists of the first antibody and the second antibody as described above.

[0014] The fourth aspect of the present invention provides a kit for detecting human cone opsin-like protein 1, the kit comprising the monoclonal antibody or monoclonal antibody pair against human cone opsin-like protein 1 as described above.

[0015] Furthermore, the kit is a double antibody sandwich ELISA kit, which includes a first antibody and a second antibody, wherein the first antibody serves as a capture antibody, and the second antibody modified with a detectable label serves as a detection antibody.

[0016] Compared with the prior art, the advantages and positive effects of the present invention are as follows: the first antibody and the second antibody provided by the present invention have good binding activity and high affinity to the human VILIP-1 protein, and specifically recognize different epitopes of the human VILIP-1 protein, and can form a double antibody sandwich enzyme-linked immunosorbent assay system for quantitative detection, and have good specificity and extremely high sensitivity, with a detection limit as low as 4.98 pg / mL, which can meet the specificity, sensitivity, reliability and accuracy of VILIP-1 at extremely trace levels in samples, and has the advantages of a wide linear range and strong thermal stability, etc., and has good application value in the clinical diagnosis and prognosis of diseases related to the expression level of the human VILIP-1 protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0018] Figure 1 The vector map used to construct the rabbit monoclonal antibody expression vector in Example 1 of the present invention, from left to right are the pRB322 vector maps carrying the light chain constant region and the heavy chain constant region;

[0019] Figure 2 This is an affinity curve diagram of the rabbit monoclonal antibody 1D2 binding to human VILIP-1 in Example 2 of the present invention;

[0020] Figure 3 This is an affinity curve diagram of the binding of rabbit monoclonal antibody 1F9 to human VILIP-1 in Example 2 of the present invention;

[0021] Figure 4 This is the standard curve for detecting human VILIP-1 using double antibody sandwich ELISA established based on rabbit monoclonal antibody 1D2 and antibody 1F9 in Example 3 of the present invention.

[0022] Figure 5 This is a graph showing the thermal stability test results of the double antibody sandwich ELISA method established based on rabbit monoclonal antibody 1D2 and antibody 1F9 in Example 4 of the present invention. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0024] Based on the information contained in the present invention, it is easy for those skilled in the art to make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined processes, properties or components, because these embodiments and other descriptions are only for the purpose of illustrating specific aspects of the present invention. In fact, various changes that a person skilled in the art or related fields can obviously make to the embodiments of the present invention are covered within the scope of the appended claims.

[0025] In order to better understand the present invention but not to limit the scope of the present invention, all the numbers and other numerical values ​​used in the present invention to express the amount, percentage, etc. should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the attached claims are approximate values, which may be changed according to the different ideal properties to be obtained. Each numerical parameter should at least be regarded as obtained according to the reported significant figures and by conventional rounding methods.

[0026] In addition, it should be noted that, unless otherwise defined, in the context of the present invention, the scientific and technical terms used should have the meanings commonly understood by those of ordinary skill in the art.

[0027] The meaning of the terms "including", "comprising", "containing", "having" and the like is non-restrictive, that is, other steps and other ingredients that do not affect the results can be added. The term "and / or" should be regarded as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" is regarded as including the following situations: (i) A, (ii) B and (iii) A and B. The terms "first", "second", etc. are used to distinguish similar objects, and are not necessarily used to describe a specific order or sequence. It should be understood that such usage can be interchangeable under appropriate circumstances.

[0028] The terms "rabbit monoclonal antibody", "monoclonal antibody", "antibody" and "monoclonal antibody" and other similar terms have the same meaning and can be used interchangeably. Unless otherwise specified, they all refer to antibodies that specifically bind to human visin-like protein 1 (VILIP-1). The terms "human visin-like protein 1", "Human Visinin-like protein-1", "Human VILIP-1", "HumanVSNL1", "Human VSNL1 / VILIP-1" and other similar terms have the same meaning and can be used interchangeably. The modifier "rabbit" indicates that the complementarity determining region (CDR) of the antibody is derived from a rabbit immunoglobulin sequence.

[0029] Antibody is an immunoglobulin molecule that can specifically bind to a target antigen or epitope through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In the present invention, the term "antibody" should be interpreted in the broadest sense and includes different antibody structures, including but not limited to so-called full-length antibodies, antibody fragments and their genetics or chemical modifications, as long as they show the desired antigen binding activity. Antibody fragments can be one or more parts or fragments of a full-length antibody, retaining the ability of the antibody to specifically bind to human VILIP-1. In a typical example, antibody fragments include: Fab, Fab', F(ab)2, F(ab')2, Fv, (Fv)2, scFv, sc(Fv)2.

[0030] A typical antibody molecule (full-length antibody) consists of two identical light chains (L) and two identical heavy chains (H). Light chains can be divided into two types, namely κ chain and λ chain; heavy chains can be classified into five types, namely μ, δ, γ, α and ε chains, and antibodies are defined as IgM, IgD, IgG, IgA and IgE, respectively. The amino acid sequences near the N-terminus of the heavy and light chains vary greatly, while the amino acid sequences of other parts are relatively constant. The regions near the N-terminus of the light and heavy chains where the amino acid sequences vary greatly are called variable regions (V), and the regions near the C-terminus where the amino acid sequences are relatively stable are called constant regions (C). The heavy chain variable region (VH) and the light chain variable region (VL) are usually the most variable parts of the antibody and contain antigen recognition sites. The VH and VL regions can be further subdivided into hypervariable regions (HVR) and framework regions (FR). The hypervariable regions are also called complementarity determining regions (CDRs), which are ring-shaped structures. The heavy chain CDR and the light chain CDR are closely together and cooperate with each other through the FR region, forming a surface that can complement the three-dimensional structure of the target antigen or epitope, determining the specificity of the antibody and being the site where the antibody recognizes and binds to the antigen. The FR region is the more conservative part of VH and VL. They are generally in a β-folded configuration and are connected by three CDRs that form a connecting loop. Each VH and VL is usually composed of three CDRs and four FRs, arranged from the amino terminus to the carboxyl terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0031] CDRs and FRs can be identified according to the Kabat definition, the Chothia definition, the accumulation of both the Kabat definition and the Chothia definition, the AbM definition, the contact definition, the IMGT unique numbering definition and / or the conformational definition, or any CDR determination method known in the art. As used herein, the Kabat numbering system is used to define.

[0032] The light chain constant region (CL) and the heavy chain constant region (CH) are not directly involved in the binding of antibodies to antigens, but they exhibit different effector functions, such as participating in antibody-dependent cytotoxicity of antibodies. The length of CL of different types of Ig (κ or λ) is basically the same, but the length of CH of different classes of Ig is different, such as IgG, IgA and IgD include CH1, CH2 and CH3, while IgM and IgE include CH1, CH2, CH3 and CH4. The amino acid sequences of the heavy chain and light chain constant regions of antibodies are well known in the art.

[0033] A full-length antibody is the most complete antibody molecular structure and has a typical Y-shaped molecular structure. Therefore, in the context of the present invention, "full-length antibody", "complete antibody" and "Y-shaped antibody" have the same meaning and can be used interchangeably.

[0034] The term "antigen-binding fragment (Fab)" refers to the region of an antibody molecule that can bind to an antigen. It consists of a complete light chain (variable region and constant region) and a partial heavy chain (variable region and a constant region fragment). By proteolytic cleavage of the full-length antibody, fragments such as Fab, F(ab')2, and Fab' can be obtained. For example, under the action of papain, IgG can be degraded into two Fab fragments and an Fc fragment; under the action of pepsin, IgG can be degraded into a F(ab')2 fragment and a pFc' fragment. The F(ab')2 fragment is further reduced to form two Fab' fragments. Because Fab has an antigen-binding region and a partial constant region, it not only has the same antibody-antigen affinity and excellent tissue penetration as a single-chain antibody (scFv), but also has a more stable structure, and is widely used in clinical diagnosis and treatment.

[0035] The term "variable fragment (Fv)" is located at the N-terminus of the antibody Fab fragment, contains only the variable region, and is composed of the variable regions of a light chain and a heavy chain. It is a dimer of VH and VL non-covalently bound (VH-VL dimer). The three CDRs of each variable region interact with each other to form an antigen binding site on the surface of the VH-VL dimer, which has the ability to recognize and bind to antigens, although the affinity is lower than that of a complete antibody.

[0036] The term "single-chain variable fragment (scFv)" refers to the smallest antibody fragment formed by connecting the heavy chain variable region (VH) and the light chain variable region (VL) through a flexible linker (generally composed of 10-25 amino acids), which retains the binding specificity of the original antibody to the antigen. The linker in the present invention is not particularly limited as long as it does not hinder the expression of the antibody variable regions connected to its two ends. Compared with full-length antibodies, scFv has the characteristics of small molecular weight, so it has higher penetration and lower immune side effects.

[0037] In some embodiments, the full-length sequence of the antibody or antibody fragment of the present invention may include a complementary determining region (CDR) and a framework region (FR) from a rabbit immunoglobulin sequence. In other embodiments, the antibody may include amino acid residues encoded by non-rabbit immunoglobulin sequences, for example, humanized antibodies, chimeric antibodies, etc., to reduce the body's rejection reaction while maintaining the required specificity and affinity. The term "chimeric antibody" refers to a portion of an antibody derived from a specific source or species, while the rest is derived from a different source or species. The term "humanized antibody" is a chimeric antibody of a non-human antibody such as a rabbit antibody's CDR region and a human FR region. In some cases, the variable region of a non-human antibody is combined with a constant region of a human antibody, such as a human-rabbit chimeric antibody; in other cases, the CDR region of a non-human antibody is combined with a FR region and a constant region derived from a human antibody sequence, that is, the CDR region of a non-human antibody is grafted onto a human antibody framework (FR) sequence, and this framework sequence is derived from a single or multiple other human antibody variable region framework sequences. In the present invention, the CDR region in the chimeric antibody or humanized antibody is derived from a rabbit-derived CDR region.

[0038] The terms "monoclonal antibody" or "single antibody" and the like are used interchangeably and refer to a homogeneous antibody population, i.e., the individual antibodies constituting the population are identical except for a small amount of mutations and / or post-translational modifications (e.g., isomerization, amidation) that may occur naturally. "Monoclonal antibodies" are highly specific and exhibit a single binding specificity and affinity for the same or substantially identical epitopes on an antigen. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous antibody population and should not be construed as limiting the source or preparation method of the antibody. The antibody can be prepared by a variety of methods, including but not limited to hybridoma methods, phage display methods, yeast display methods, recombinant DNA methods, single cell screening, or single cell sequencing methods.

[0039] The term "specific binding" is a well-known term in the art, and a molecule exhibits "specific binding" if it reacts with a specific target antigen or epitope more frequently, more rapidly, longer lastingly, and / or with greater affinity than with other target antigens or epitopes. "Specific binding" or "preferential binding" does not necessarily require (although it can include) exclusive binding.

[0040] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings.

[0041] The embodiment of the present invention provides a monoclonal antibody against human cone opsin-like protein 1, which is a first antibody or a second antibody, wherein the monoclonal antibody comprises a light chain variable region and a heavy chain variable region, wherein the light chain variable region and the heavy chain variable region both comprise three complementary determining regions (CDRs), which are named CDR1, CDR2 and CDR3, respectively; wherein: the amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region of the first antibody are shown as SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are shown as SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, respectively; the amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region of the second antibody are shown as SEQ ID NO.13, SEQ ID NO.14 and SEQ ID NO.15, respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are shown as SEQ ID NO.18, SEQ ID NO.19 and SEQ ID NO.20, respectively. Shown in NO.20.

[0042] The present invention uses the 2-191 amino acid fragment of human VILIP-1 protein as an immunogen to immunize rabbits to prepare the first antibody and the second antibody having the above CDR sequence. The obtained antibodies can specifically recognize and bind to the human VILIP-1 protein, have good binding activity and high affinity, and the affinity constant K between the first antibody and the human VILIP-1 protein is D is 4.21×10 -11 (M), affinity constant K of the second antibody and human VILIP-1 protein D 6.14×10 -11(M), and the aforementioned antibodies can specifically bind to different epitopes of human VILIP-1 protein, can form a double antibody sandwich mode, use the first antibody as the capture antibody and the second antibody as the detection antibody, construct a double antibody sandwich enzyme-linked immunosorbent assay (double antibody sandwich ELISA) system, and quantitatively detect VILIP-1 of various concentrations, with good detection specificity and extremely high detection sensitivity, and the detection limit is as low as 4.98pg / mL, which is much better than the various VILIP-1 ELISA kits currently on the market, and can meet the requirements of stable, extremely trace levels of VILIP-1 in samples. Specificity, sensitivity, reliability and accuracy detection. In addition, the double double antibody sandwich ELISA system established by the present invention has a larger linear range and excellent thermal stability, and is more widely applicable. It has good application value in the early clinical diagnosis and prognosis evaluation of diseases related to the expression of human VILIP-1 protein levels, such as AD or other neurological diseases, and is also of great significance in the laboratory AD drug development process.

[0043] Optionally, the light chain variable region and the heavy chain variable region each include 4 framework regions (FRs), and the 4 FRs and 3 CDRs are arranged alternately in sequence to form a variable region. The amino acid sequence of the light chain variable region (VL) of the first antibody is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region (VH) is shown in SEQ ID NO.7. The amino acid sequence of the light chain variable region (VL) of the second antibody is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region (VH) is shown in SEQ ID NO.17.

[0044] Optionally, the rabbit monoclonal antibody of the present invention further includes a light chain constant region and a heavy chain constant region, CL and VL constitute the light chain, and CH and VH constitute the heavy chain. The constant region of the antibody can usually be obtained by public query, such as: through the IMGT online database (www.imgt.org), search for rabbit IgG gamma C reign to obtain CH, and search for rabbit IgG Kappa C reign to obtain CL. Specifically, the amino acid sequence of the light chain (FL chain) of the first antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain (FH chain) is shown in SEQ ID NO.6. The amino acid sequence of the light chain (FL chain) of the second antibody is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain (FH chain) is shown in SEQ ID NO.16.

[0045] It should be noted that the monoclonal antibody of the present invention can be a full-length antibody (having a typical Y-shaped molecular structure) or an antibody fragment, and the antibody fragment refers to a polypeptide that substantially retains the same biological function or activity as the full-length form of the rabbit monoclonal antibody. Specifically, the antibody fragment includes the CDR region as described above, and more preferably has the variable region as described above, thereby retaining a complete antigen recognition and binding site, and can bind to the same antigen as the full-length antibody, especially to the same epitope.

[0046] The antibody fragments include, but are not limited to: (i) Fab fragments, which are monovalent fragments consisting of the variable region and the first constant region of each heavy chain and light chain; (ii) F(ab)2 fragments, which are bivalent fragments comprising two Fab fragments connected by a disulfide bridge in the hinge region; (iii) Fv fragments, which are composed of one heavy chain variable region and one light chain variable region of an antibody; (iv) (Fv)2 fragments, which are composed of two covalently linked Fv fragments; (v) scFv fragments, which are Fv fragments consisting of a single polypeptide chain, in which one heavy chain variable region and one light chain variable region are connected by a linker; (vi) sc(Fv)2 fragments, which are formed by connecting two heavy chain variable regions and two light chain variable regions by a linker, etc. These antibody fragments can be obtained by conventional techniques in the art.

[0047] Yet another embodiment of the present invention provides a nucleic acid molecule, a recombinant vector or a host cell comprising the nucleic acid molecule, wherein the nucleic acid molecule encodes the first antibody and / or the second antibody as described above.

[0048] Nucleic acid molecules can be in the form of DNA (such as cDNA or genomic DNA or synthetic DNA) or RNA (such as mRNA or synthetic RNA). DNA can be single-stranded or double-stranded, and can also be a coding strand or a non-coding strand.

[0049] The sequence of the nucleic acid molecule can be obtained by conventional means such as deduction of codon coding rules based on the amino acid sequence of the antibody. The full-length sequence of the nucleic acid molecule or its fragment can usually be obtained by PCR amplification, recombination or artificial synthesis. The obtained nucleic acid molecule is inserted into an expression vector, then transfected into a host cell, and the transfected host cell is cultured under specific conditions to express the antibody of the present invention.

[0050] Illustratively, the nucleotide sequence of the light chain variable region of the first antibody is shown in SEQ ID NO. 22, and the nucleotide sequence of the heavy chain variable region is shown in SEQ ID NO. 24. The nucleotide sequence of the light chain variable region of the second antibody is shown in SEQ ID NO. 26, and the nucleotide sequence of the heavy chain variable region is shown in SEQ ID NO. 28.

[0051] Illustratively, the nucleotide sequence of the light chain of the first antibody is shown in SEQ ID NO. 21, and the nucleotide sequence of the heavy chain is shown in SEQ ID NO. 23. The nucleotide sequence of the light chain of the second antibody is shown in SEQ ID NO. 25, and the nucleotide sequence of the heavy chain is shown in SEQ ID NO. 27.

[0052] The original vector for constructing the recombinant vector is various vectors conventional in the art, as long as it can hold the nucleic acid molecule. Typical vectors include plasmids, viral vectors, bacteriophages, cosmids and minichromosomes. Plasmids are the most common vector forms, and therefore, in the context of the present invention, vectors and plasmids are used interchangeably. The vector can be a cloning vector (i.e., used to transfer the nucleic acid molecule to a host and multiply in a host cell) or an expression vector (i.e., containing necessary genetic elements to allow the nucleic acid molecule inserted into the vector to be expressed in a host cell). The nucleic acid molecule of the present invention can be inserted into a suitable vector to form a cloning vector or an expression vector carrying the nucleic acid molecule. This is a known technology and will not be described in detail herein.

[0053] The nucleic acid molecules encoding the heavy and light chains of the antibodies of the present invention can be constructed into two vectors, respectively, which can be introduced into the same or different host cells. When the heavy and light chains are expressed in different host cells, each chain can be separated from the host cells expressing them, and the separated heavy and light chains are mixed and incubated under suitable conditions to form antibodies. In other embodiments, the nucleic acid molecules encoding the heavy and light chains of the rabbit monoclonal antibodies of the present invention can also be cloned into a vector, and each nucleic acid sequence is connected to a suitable promoter downstream; for example, each nucleic acid sequence encoding the heavy and light chains can be operably connected to different promoters, or the nucleic acid sequences encoding the heavy and light chains can be operably connected to a single promoter, so that both the heavy and light chains can be expressed by the same promoter. The choice of expression vector / promoter depends on the type of host cell used to produce the antibody.

[0054] In the present invention, the recombinant vector is transfected or transformed into the host cell using conventional techniques. When the host is a prokaryotic organism such as Escherichia coli, competent cells that can absorb DNA are harvested after the exponential growth phase and treated with CaCl2 or MgCl2; they can also be transfected by microinjection, electroporation or liposome packaging. When the host is a eukaryotic organism, the following DNA transfection methods can be selected: calcium phosphate coprecipitation, microinjection, electroporation, liposome packaging, etc. The host cell can be a prokaryotic or eukaryotic cell. Representative examples include: Escherichia coli, Streptomyces, Salmonella typhimurium, yeast, Drosophila S2 or Sf9 cells, mammalian CHO, COS7, 293 series cells, etc. After obtaining the host cell transfected or transformed with the recombinant vector as described above, the antibody can be expressed by culturing under suitable conditions, and then separated to obtain purified antibodies. In a preferred embodiment, the recombinant vector is a mammalian expression vector pBR322, and the host cell is a human kidney epithelial cell (293F cell).

[0055] Another embodiment of the present invention provides a monoclonal antibody pair against human cone opsin-like protein 1, which consists of the first antibody and the second antibody as described above.

[0056] The advantages of the monoclonal antibodies against human VILIP-1 over the prior art are the same as those of the monoclonal antibodies against human VILIP-1 over the prior art as described above, and will not be repeated here.

[0057] Still another embodiment of the present invention provides the use of the monoclonal antibody or monoclonal antibody pair against human cone opsin-like protein 1 as described above in the preparation of a kit for detecting human cone opsin-like protein 1.

[0058] The advantages of using the monoclonal antibody or antibody pair against human VILIP-1 in preparing a kit for detecting human VILIP-1 are the same as the advantages of the monoclonal antibody against human VILIP-1 over the prior art as described above, and will not be repeated here.

[0059] Based on the same inventive concept as above, an embodiment of the present invention further provides a kit for detecting human cone opsin-like protein 1, wherein the kit comprises the first antibody and / or the second antibody as described above.

[0060] It should be noted that the first antibody and the second antibody can be used separately, together, or in pairs. When detecting, if used separately or together, the first antibody and / or the second antibody are used as a primary antibody or a capture antibody, the sample to be tested is contacted with the first antibody and / or the second antibody, and then the antibody is detected. In some embodiments, the first antibody and / or the second antibody can be coupled to a detectable label, and the qualitative or quantitative detection of VILIP-1 is achieved by analyzing the changes in the identifiable signals generated by the detectable label. In other embodiments, the first antibody and / or the second antibody (as a primary antibody or a capture antibody) of anti-human VILIP-1 is not labeled, and the detectable label is coupled to a secondary antibody (as a detection antibody) or other molecules that can bind to the primary antibody. For example, if the anti-human VILIP-1 antibody is a rabbit IgG antibody, the secondary antibody can be an anti-rabbit IgG antibody, thereby generating a change in the identifiable signal by coupling the secondary antibody of the detectable label. When used in pairs, one of the first antibody and the second antibody is used as a primary antibody or a capture antibody, and the other is used as a secondary antibody or a detection antibody.

[0061] The detection method described above adopts common immunological methods, including but not limited to: enzyme immunoassay (EIA), enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot (ELISPOT), immunohistochemistry (IHC), immunofluorescence (IF), immunoblotting (WB), flow cytometry (FC), etc. Therefore, the kit can be an enzyme immunoassay kit, an enzyme-linked immunosorbent assay kit, an ELISPOT kit, an immunohistochemistry kit, an immunofluorescence kit, an immunoblotting kit or a flow cytometry kit.

[0062] Preferably, the kit includes a first antibody and a second antibody, the first antibody is used as a capture antibody (or primary antibody), the second antibody is used as a detection antibody (or secondary antibody), and the second antibody is modified with a detectable label. The present invention verifies that the first antibody and the second antibody bind to different antigenic epitopes on the surface of human VILIP-1 through protein interaction non-labeling technology, and can be used to establish a double antibody sandwich enzyme-linked immunosorbent assay system for human cone protein-like protein 1. The obtained double antibody sandwich enzyme-linked immunosorbent assay kit has good specificity and high sensitivity.

[0063] The detectable labels for generating identifiable signal changes include, but are not limited to, biotin, fluorescein, chemiluminescent groups, chemical fluorescent groups, fluorescent proteins (such as allophycocyanin, B-phycoerythrin, PerCP and R-phycocyanin), enzymes (such as alkaline phosphatase, glucose oxidase, horseradish peroxidase, acid phosphatase), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies or combinations thereof. In a preferred embodiment, the detectable label is biotin.

[0064] The present invention is further described below in conjunction with specific examples. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as the conditions described in the Molecular Cloning Laboratory Guide (Fourth Edition) published by Cold Spring Harbor Laboratory, or usually under the conditions recommended by the manufacturer.

[0065] Example 1 Preparation of rabbit monoclonal antibodies

[0066] In this embodiment, recombinantly expressed Human VILIP-1 is used as an immunogen to immunize New Zealand white rabbits, and then based on the monoclonal antibody development technology of single B lymphocyte screening and culture, B lymphocytes are sorted from the spleen cells of the white rabbits and cultured, RNA in the B lymphocytes is extracted, reverse transcribed into cDNA, and PCR amplification is performed to obtain naturally paired heavy chain variable region (VH) genes and light chain variable region (VL) genes encoding rabbit monoclonal antibodies, and the aforementioned genes are loaded onto expression vectors, and the vectors are co-transformed or transfected into host cells, and the host cells are cultured, and the rabbit monoclonal antibodies 1D2 and 1F9 with high specificity and affinity for VILIP-1 are obtained by separation and purification. In this embodiment, by first screening and locking candidate monoclonal B lymphocytes, then amplifying and obtaining antibody sequences therefrom, constructing host cells on the vectors through transformation or transfection, and obtaining antibodies through recombinant expression, compared with the traditional hybridoma method for preparing antibodies, the present invention can avoid the sacrifice of a large number of animals, and the recombinant antibody expression vector has higher storage stability and is easier to expand production.

[0067] The above-mentioned immunogen is the 2nd to 191th amino acid fragment of Human VILIP-1 (protein sequence see SwissProt: P62760), and the gene fragment corresponding to the amino acid sequence is constructed into the mammalian expression vector pCDNA3 for expression, which is a conventional vector in the art; the construction of the expression system adopts conventional technical means in the art, and the present invention has not improved this and will not be repeated.

[0068] The amino acid (AA) and nucleotide (DNA) sequences of antibodies 1D2 and 1F9 are shown in Tables 1-2, respectively. For ease of description, light chain CDR1-3 are represented by LCDR1, LCDR2 and LCDR3, respectively, and heavy chain CDR1-3 are represented by HCDR1, HCDR2 and HCDR3, respectively.

[0069] Table 1 Sequence information of rabbit monoclonal antibody 1D2 in this example

[0070]

[0071] Table 2 Sequence information of rabbit monoclonal antibody 1F9 in this example

[0072]

[0073]

[0074] The preparation method of rabbit monoclonal antibody 1D2 and antibody 1F9 specifically comprises the following steps:

[0075] 1. Animal immunization: Human VSNL1 / VILIP-1 2-191AA fragment was used as an immunogen to immunize 2 New Zealand white rabbits; 200 μg of each white rabbit was immunized, and the immunogen was mixed with an equal amount of complete Freund's adjuvant to prepare an emulsifier before the first immunization, and injected subcutaneously at multiple points in the rabbit's abdomen and back; after the first immunization, 100 μg of the immunogen was mixed with an equal amount of incomplete Freund's adjuvant to prepare an emulsifier every 3 weeks, and injected subcutaneously at multiple points in the rabbit's abdomen and back, and boosted immunization was performed twice; after three immunizations, rabbit serum samples were collected, and the titer against human cone opsin-like protein 1 was determined by ELISA method, and rabbits with high serum titers were selected, and 200 μg of the immunogen was injected subcutaneously at multiple points for booster immunization once, and the animals were sacrificed and the spleen was taken three days later.

[0076] 2. Isolate B lymphocytes from the spleen and sort B lymphocytes: Use conventional methods to isolate B lymphocytes from the spleen, and sort out antigen-specific B lymphocytes. For related methods, please refer to the patent "Method for efficiently separating single antigen-specific B lymphocytes from spleen cells (publication number: CN110016462A, publication date: 2019-07-16)" and the patent "A B lymphocyte in vitro culture system and application (publication number: CN111518765A, publication date: 2020-08-11)".

[0077] 3. Cloning of the gene encoding rabbit monoclonal antibody: The cultured B lymphocyte supernatant was used to identify positive clones by antigen-coated ELISA. The positive clone cells were collected and lysed and then analyzed by Quick-RNA TMRNA was extracted according to the instructions of MicroPrep kit (purchased from ZYMO, catalog number R1051) and reverse transcribed into cDNA. Using cDNA as template, the naturally paired rabbit monoclonal antibody light chain variable region (VL) and heavy chain variable region (VH) were amplified from the cDNA of the corresponding positive clone by PCR and sequenced. The sequencing work was completed by Jinkairui Biotechnology Co., Ltd. The PCR reaction system included: 4μL cDNA, 1μL forward primer (10mM), 1μL reverse primer (10mM), 12.5μL 2×Gloria HiFi (from ABclonal self-sold and self-produced, catalog number RK20717) and 6.5μL H2O; the PCR amplification program included: 98℃ pre-denaturation for 30s, followed by 40 cycles of 98℃ for 10s, 64℃ for 30s, and 72℃ for 30s, and finally kept at 72℃ for 5min. The reaction solution was stored at 4℃. The primer sequences (5'-3') for amplifying VL and VH genes are as follows, where F and R represent forward primers and reverse primers, respectively:

[0078] VL-F: tgaattcgagctcggtacccATGGACACGAGGGCCCCCAC (see SEQ ID NO. 29);

[0079] VL-R: cacacacgatggtgactgTTCCAGTTGCCACCTGATCAG (see SEQ ID NO. 30);

[0080] VH-F: tgaattcgagctcggtacccATGGAGACTGGGCTGCGCTG (see SEQ ID NO. 31);

[0081] VH-R: gtagcctttgaccaggcagcCCAGGGTCACCGTGGAGCTG (see SEQ ID NO. 32).

[0082] 4. Production and purification of rabbit monoclonal antibodies: In order to scale up the production of rabbit monoclonal antibodies against human VILIP-1 protein, the amplified VL and VH genes containing signal peptides were loaded onto the mammalian expression vector pBR322 carrying the light chain constant region (CL) and heavy chain constant region (CH) genes, respectively, to obtain light chain gene and heavy chain gene expression vectors, which were successfully constructed after sequencing verification. The expression map of the vector used is shown in Figure 1In the figure, pRB322 origin and f1 origin are replication promoters in E. coli, Ampcillin is a plasmid resistance gene, CMV immearly promoter is a promoter in eukaryotes, SV40 PAterminator is a tailing signal, Light chain constant is the nucleic acid sequence of the light chain constant region (left figure), Heavy chain constant is the nucleic acid sequence of the heavy chain constant region (right figure). CL and CH genes were obtained by searching the IMGT online database (www.imgt.org) to obtain CH from rabbit IgG gamma C reign, and CL from rabbit IgG Kappa C reign.

[0083] The signal peptide of this embodiment can adopt the antibody expression signal peptide sequence commonly used in the art, such as the patent "rabbit monoclonal antibody against human interferon α2 and its application (publication number: CN116063487A, publication date: 2023-05-05)" and the patent "high affinity human IL-5 rabbit monoclonal antibody and its application (publication number: CN115819578A, publication date: 2023-03-21)" The light chain variable region upstream has a signal peptide "MDTRAPTQLLGLLLLWLPGATF" (coding gene: ATGGA CACGAGGGCCCCCACTCAGCTGCTGGGACTCCTGCTCCTGTGGTTGCCTGGCGCCACCTTT) or "MDTRAPTQLLGLLLLWLPGARC" (coding gene: ATGGACACGAGGGCCCCCACTC The heavy chain variable region has a signal peptide "METGLRWLLLVAVLKGVQC" upstream (coding gene: ATGGAGACTGGGCTGCGCTGGCTT CTCCTGGTAGCTGTGCTGAAGGGGGTGCAGTGC or ATGGAGACTGGGCTGCGCTGGCT TCTCCTGGTGGCCGTCCTGAAGGGTGTGCAGTGC).

[0084] The expression vectors containing the light chain gene and the heavy chain gene verified by sequencing were transfected into 293F cells together. After transfection, the cells were cultured for 72-96 hours to obtain the culture supernatant containing the recombinant rabbit monoclonal antibody that recognizes human VILIP-1. Protein A affinity gel resin (purchased from Tiandi Renhe, catalog number SA023100) was used to purify the target antibody from the culture supernatant. 12% SDS-PAGE gel electrophoresis was used to verify that the antibody purity was >95%, and the purified antibody was divided and stored at -20°C for later use.

[0085] Example 2 Affinity test of rabbit monoclonal antibodies 1D2 and 1F9

[0086] The antibody affinity of the anti-human VILIP-1 rabbit monoclonal antibodies 1D2 and 1F9 obtained above was identified using the Gator biomolecular interaction analyzer (Gator Prime device) of Probe Life Company, and the probe used was the HFC (Anti-HIgG FC) probe. The specific method is as follows: 1) Pre-wet: Before use, the HFC probe is shaken and wetted in the matching buffer at 1000rpm for 300sec; 2) Baseline1: The HFC probe is placed in the buffer for starting point calibration to ensure that the probe is initially in a stable state, and the probe is treated at 1000rpm for 60sec; 3) Loading: The human VILIP-1 antigen is immobilized on the HFC probe at a concentration of 3μg / mL, and the probe is treated at 1000rpm for 100sec; 4) Baseline2: The probe with the immobilized antigen is placed in the buffer for shaking and washing, and the probe is treated at 1000rpm for 60sec; 5) Association: The probe with the immobilized antigen is placed in 0.51μg / mL 1D2 antibody and 0.55μg / mL 1F9 antibody diluents, respectively, to test the affinity of the antibody binding to the antigen, and the probe is treated at 1000rpm for 900sec; 6) Dissociation: When the antigen-antibody binding reaches saturation, the probe is transferred to the dissociation system to complete the dissociation process, and the probe is treated at 1000rpm for 600sec.

[0087] The affinity test curves of antibodies 1D2 and 1F9 for human VILIP-1 are shown in Figure 2-3 , where the ordinate represents the change in the thickness of the conjugate after the probe binds to the antibody and protein, the abscissa represents the binding time, the dark gray curve is the real-time binding value curve, and the light gray curve is the fitted average curve. The affinity constants calculated by curve fitting are shown in Table 3, where the dissociation coefficient K off The constant used to characterize the dissociation rate between antibody and antigen, the binding coefficient K on A constant used to characterize how quickly an antibody binds to its target, the affinity constant K D Koff / K on The ratio of , represents the equilibrium dissociation constant between the antibody and its antigen.

[0088] Table 3 Affinity-related parameter determination results of rabbit monoclonal antibodies

[0089] Rabbit monoclonal antibody <![CDATA[K off (1 / s)]]> <![CDATA[K on (1 / Ms)]]> <![CDATA[K D (M)]]> 1D2 <![CDATA[2.56×10 -5 ]]> <![CDATA[6.08×10 5 ]]> <![CDATA[4.21×10 -11 ]]> 1F9 <![CDATA[4.06×10 -5 ]]> <![CDATA[6.61×10 5 ]]> <![CDATA[6.14×10 -11 ]]>

[0090] From the above results, it can be seen that the affinity constants K of antibodies 1D2 and 1F9 for human VILIP-1 protein are D Both were as low as below 0.1 nM level, indicating that antibodies 1D2 and 1F9 each had a high affinity to human cone opsin-like protein 1.

[0091] Example 3 Sensitivity test of double antibody sandwich ELISA based on antibodies 1D2 and 1F9

[0092] The double antibody sandwich enzyme-linked immunosorbent assay (ELISA) method was established using 1D2 as the capture antibody and 1F9 as the detection antibody. The steps are as follows: 1) Coating the capture antibody 1D2: dilute the antibody 1D2 to 0.3 μg / mL with 1×PBS, mix it with a vortexer, and add it to a 96-well microplate at 100 μL / well. Cover it with a cover film and incubate it in a 4°C refrigerator for 16-20 hours; 2) Wash the plate: after the incubation is completed, discard the liquid in the well, wash the plate once with 1×PBST, add 300 μL of the sample, let it stand for 40 seconds, then discard the liquid in the well, and pat the liquid in the well dry on a flat paper; 3) Block: add E013 blocking solution (1×PBS containing 2% BSA, 5% sucrose, 0.05% Tween and 0.1% proclin 300, pH 5.0) 7.2) Add 200 μL / well to the plate wells, cover with a cover film, and block at 37°C for 2 hours. After blocking, discard the blocking solution, pat the ELISA plate dry, place it in a 37°C oven to dry for 0.5-2 hours, and take it out for use; 4) Add antigen protein: dilute the human VILIP-1 protein with E013 blocking solution, and then add different concentrations of 100 μL / well to the ELISA plate in sequence, cover with a cover film, and incubate at 37°C for 2 hours; 5) Wash the plate: After incubation, discard the liquid in the wells, wash the plate three times with 1×PBST, add 300 μL of sample, and let it stand After 40 seconds, discard the liquid in the wells and pat dry on a flat paper; 6) Add detection antibody 1F9: dilute the rabbit monoclonal antibody 1F9 (1F9-biotin) labeled with biotin to 0.1 μg / mL, add 100 μL / well to the ELISA plate in sequence, cover with a cover film, and incubate at 37°C for 1 hour; wherein, the 1F9-biotin treatment method includes: preparing the antibody 1F9 into a 1 mg / mL solution, and preparing NHS-LC-biotin into a 60 mg / mL solution with DMSO; taking 200 μL of the 1 mg / mL antibody 1F9 solution, adding 10 μL of the 60 mg / mL NHS-LC-biotin solution; after mixing, leaving it at room temperature for 30 minutes, adding 50 μg 500mM Tris solution (pH9.0) was added to terminate the reaction; finally, a large amount of 1×PBS buffer solution at pH7.4 was added, and centrifuged with a centrifugal column with an exclusion limit of 30KD to remove excess biotin molecules and balance the buffer system; 7) Washing the plate: After the incubation is completed, the liquid in the wells was discarded, and the plate was washed three times with 1×PBST, 300μL of the sample was added, and the liquid in the wells was discarded after standing for 40s, and the liquid in the wells was patted dry on a flat paper; 8) Adding SA-HRP: 100×SA-HRP (horseradish peroxidase labeled streptavidin, purchased from Wuhan Sanying Biotechnology Co., Ltd., catalog number SA00001-0) concentrate was diluted 100 times, and 100μL / well was added to the ELISA plate in sequence, covered with a cover film, and incubated at 37℃ for 0.5h; 9) Washing: After the incubation is completed, discard the liquid in the well, wash the plate three times with 1×PBST, add 300μL of sample, let it stand for 40s, then discard the liquid in the well, and pat the liquid in the well dry on a flat paper; 10) Add TMB colorimetric solution: Add 3,3',5,5'-tetramethylbenzidine (TMB) colorimetric solution to the ELISA plate at 100μL / well, cover with a cover film, and incubate at 37℃ for 15min; 11) Reading: After the incubation is completed, take out the ELISA plate, add 50μL of stop solution (1mol / L hydrochloric acid) to each well, and immediately read with an ELISA reader. The concentration of human VILIP-1 protein is used as the horizontal axis, and the correction value of the absorbance value is Y1 (Y1=OD. 450nm -OD 630nm ) as the ordinate to obtain the standard curve. Figure 4 The sensitivity of the double antibody sandwich ELISA method was determined by taking the lowest human VILIP-1 concentration whose average absorbance value was greater than three times the average absorbance value of the blank control (see Table 4).

[0093] Table 4 Sensitivity test data of double antibody sandwich ELISA based on rabbit monoclonal antibodies 1D2 and 1F9

[0094]

[0095] The experimental results showed that the linear range of the double antibody sandwich ELISA for detecting human VILIP-1 protein based on antibodies 1D2 and 1F9 was 31.2-2000 pg / mL, R 2 =0.9980, a wide range of detectable sample concentrations, and a sensitivity of 4.98 pg / mL, which is much better than the commercially available VILIP-1 ELISA kits currently developed on the market, such as Abcam's VILIP1 ELISA kit (ab300310) with a sensitivity of 11.493 pg / mL, Jianglai Bio's VILIP-1 ELISA Kit (JL16968-48T) with a sensitivity of 80 pg / mL, BioVendor's VILIP-1 ELISA Kit (RD191119200R) with a sensitivity of 27 pg / mL, and EIAab's VILIP-1 ELISA Kit (E1450h) with a sensitivity of 12 pg / mL. It can be seen that the antibody of the present invention can meet the high sensitivity and high reliability detection of trace amounts of human VILIP-1 protein in the sample to be tested.

[0096] Example 4 Thermal stability test of double antibody sandwich ELISA based on antibodies 1D2 and 1F9

[0097] The detection system formed by the enzyme labeling plate coated with the capture antibody, the human VILIP-1 protein, and the 100× concentrated detection antibody was sealed and stored at -20°C, 4°C, and 37°C, respectively. After 7 days, the plate was taken out and tested according to the double antibody sandwich ELISA established in Example 2. The standard curves obtained under different storage temperatures are shown in FIG. Figure 5 and Table 5.

[0098] Table 5 Standard curve test data of antibody 1D2 and 1F9 for detecting human VILIP-1 protein at different storage temperatures

[0099] concentration 4℃ 37℃ -20℃ 0pg / mL 0.0168 0.01445 0.02335 31.25pg / mL 0.06385 0.05415 0.0674 62.5 pg / mL 0.1132 0.09215 0.1039 125pg / mL 0.2086 0.1545 0.1897 250pg / mL 0.40635 0.30745 0.35825 500pg / mL 0.769 0.6185 0.69315 1000pg / mL 1.4793 1.138 1.36095 2000pg / mL 2.5411 2.16885 2.5385 CV 12％ 2％

[0100] The results showed that the stability coefficients of variation of the 1D2 and 1F9 antibody pairs treated at 4°C, 37°C, and -20°C were all less than 15%, and the stability met the standard, indicating that the anti-antibodies 1D2 and 1F9 had strong thermal stability.

[0101] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A monoclonal antibody against human cone opsin-like protein 1, characterized in that The monoclonal antibody is a primary antibody or a secondary antibody, wherein: The amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the light chain variable region of the first antibody are shown as SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, respectively, and the amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the heavy chain variable region are shown as SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, respectively; The amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the light chain variable region of the second antibody are shown as SEQ ID NO.13, SEQ ID NO.14 and SEQ ID NO.15, respectively, and the amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the heavy chain variable region are shown as SEQ ID NO.18, SEQ ID NO.19 and SEQ ID NO.20, respectively.

2. The monoclonal antibody against human cone opsin-like protein 1 according to claim 1, characterized in that The amino acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.7; The amino acid sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

17.

3. The monoclonal antibody against human cone opsin-like protein 1 according to claim 2, characterized in that The amino acid sequence of the light chain of the first antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6; The amino acid sequence of the light chain of the second antibody is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.

16.

4. The monoclonal antibody against human cone opsin-like protein 1 according to claim 1, characterized in that The first antibody or the second antibody is a full-length antibody or an antibody fragment; The antibody fragment is selected from at least one of a Fab fragment, a F(ab)2 fragment, a Fv fragment, a (Fv)2 fragment, a scFv fragment and a sc(Fv)2 fragment.

5. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the first antibody or the second antibody according to any one of claims 1 to 4.

6. The nucleic acid molecule according to claim 5, characterized in that The nucleotide sequence of the light chain variable region of the first antibody is shown in SEQ ID NO.22, and the nucleotide sequence of the heavy chain variable region is shown in SEQ ID NO.24; The nucleotide sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.26, and the nucleotide sequence of the heavy chain variable region is shown in SEQ ID NO.

28.

7. The nucleic acid molecule according to claim 6, characterized in that The nucleotide sequence of the light chain of the first antibody is shown in SEQ ID NO.21, and the nucleotide sequence of the heavy chain is shown in SEQ ID NO.23; The nucleotide sequence of the light chain of the second antibody is shown in SEQ ID NO.25, and the nucleotide sequence of the heavy chain is shown in SEQ ID NO.

27.

8. A monoclonal antibody pair against human cone opsin-like protein 1, characterized in that: The method comprises the first antibody and the second antibody as described in any one of claims 1 to 4.

9. A kit for detecting human cone opsin-like protein 1, characterized in that: The kit comprises the monoclonal antibody against human cone opsin-like protein 1 as described in any one of claims 1 to 4 or the monoclonal antibody pair against human cone opsin-like protein 1 as described in claim 8.

10. The kit for detecting human cone opsin-like protein 1 according to claim 9, characterized in that: The kit is a double antibody sandwich ELISA kit, which includes a first antibody and a second antibody, wherein the first antibody is a capture antibody, the second antibody is a detection antibody, and the second antibody is modified with a detectable label.

Images