A targeted pathogen detection method, system and device

Abstract

The present invention provides a targeted pathogen detection method, system, device, medium and program product, which belongs to the field of biotechnology. The method uses the core genome of the pathogenic species and the cleavage site of CRISPR-Cas9 to screen the specific region of the pathogenic species, and uses the sgRNA combination of the cleavage site to achieve targeted sequencing of multiple sites on the pathogenic genome, thereby achieving high sensitivity and high identification accuracy detection of pathogens. In addition, the species-specific region obtained in this method is not limited to the CRISPR-Cas9 targeted detection process, and can also be applied to the multiplex PCR detection process and the probe capture process.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more specifically, to a targeted pathogen detection method, system, device, medium and program product. Background Art

[0002] Pathogenic microorganism infection refers to the process in which the human body is invaded by microorganisms such as bacteria, viruses, fungi and parasites and reproduces in the body, causing disease, which has a significant impact on human health and production and life. Faced with the increasingly severe threat of pathogenic microorganisms, it is of great significance to accurately and quickly detect pathogenic microorganisms.

[0003] The emergence and development of high-throughput sequencing technology has provided a new option for clinical pathogen detection. With the rapid development of next-generation sequencing (NGS) technology and the rapid decline in costs, metagenomic next-generation sequencing (mNGS) has been successfully applied to clinical microbial diagnosis. mNGS can obtain all nucleic acid fragment sequence information in a sample at one time, compare sequences with tens of thousands of microorganisms in a large nucleic acid database, and find suspected pathogens. It has the advantages of being independent of culture and high throughput, especially when detecting difficult-to-culture and unknown pathogens, which makes up for the shortcomings of traditional detection technology. However, due to the high proportion of human hosts and low microbial content in clinical samples, mNGS has the risk of missed detection, which is easy to cause false negatives, limited sensitivity, and generally requires no less than 20 M sequencing data to ensure the effective detection of pathogens, and the sequencing cost is high. Targeted sequencing technology can selectively amplify and sequence the gene region of interest, which can be used to overcome the above problems. At present, the most widely used technologies in pathogen detection are probe hybridization capture technology and multiplex PCR amplification technology, which can positively enrich the target pathogens and improve the detection sensitivity. Although the amount of sequencing data required for probe hybridization capture detection of pathogens is relatively low, the cost of the entire capture process is still high due to the cost of probe design and synthesis. In addition, probe hybridization capture technology has the disadvantages of complex operation and long time consumption, which does not meet the timeliness requirements of clinical pathogen detection. Although the multiplex PCR amplification technology has a short detection cycle, the number of primers is limited. Due to the differences in dimers and amplification efficiency, the primers interfere with each other greatly, and the number of pathogens that can be detected is limited. At the same time, due to the limitation of the number of primers, the multiplex PCR system usually sets 3-6 target regions in each species, and the fragment diversity is insufficient, which is easy to cause false positives. In view of the above problems, there is still a need for a detection technology for pathogenic microorganisms that takes into account both detection throughput and sensitivity and is low in cost in the clinic. Summary of the invention

[0004] The present invention aims to solve at least one of the technical problems existing in the prior art. To this end, the present invention provides a targeted pathogen detection method, which uses the core genome of the pathogenic species and the cleavage site of CRISPR-Cas9 to screen the specific region of the pathogenic species, and uses the sgRNA combination of the cleavage site to achieve targeted sequencing of multiple sites on the pathogenic genome, thereby achieving high sensitivity and high identification accuracy detection of pathogens. In addition, the species-specific region obtained in this method is not limited to the CRISPR-Cas9 targeted detection process, and can also be applied to the multiplex PCR detection process and the probe capture process.

[0005] The first aspect of the present application discloses a method for screening pathogenic species-specific regions, the method comprising:

[0006] 101, obtaining genome data of the species to be tested;

[0007] 102, clustering each gene in the genome set data to obtain at least one gene cluster whose sequence similarity is greater than a first threshold; and screening out genes present in each of the genomes as core gene clusters from the gene clusters;

[0008] 103, aligning the core gene cluster, and selecting a region without SNP sites from the alignment results as a conserved region;

[0009] 104, screening sgRNA from the conserved region; combining the screened sgRNAs according to a preset interval length to obtain an sgRNA combination; extracting a target sequence of the region cut by the sgRNA combination;

[0010] 105, aligning the target sequence with a pathogen alignment database to obtain an alignment result; using the target sequence in the alignment result whose sequence similarity is higher than a second threshold and which is aligned to the species to be detected but not to other species as the specific region of the species to be detected.

[0011] Optionally, the first threshold is 85-98%, preferably 95%;

[0012] Optionally, the clustering uses a roary tool.

[0013] In some embodiments, the preset interval length is: 100-1000 bp;

[0014] Optionally, the method further comprises: annotating the open reading frames of the genome set data of the species to be tested to obtain an annotated genome file; and clustering each genome in the annotated genome file.

[0015] Optionally, the species to be tested include any one or more of the following: Enterococcus faecium Enterococcus faecium, Staphylococcus aureus Staphylococcus aureus , Klebsiella pneumoniae Klebsiella pneumoniae ;

[0016] Optionally, the pathogen comparison database is composed of pathogen genome sequences in a known database.

[0017] The second aspect of the present application discloses a sgRNA design method for pathogenic species detection, the method comprising:

[0018] 201. Obtain a conserved region of a pathogenic species; optionally, the conserved region is a region disclosed in the first aspect of the present application;

[0019] 202, obtaining all sgRNAs and their position information from the conserved region, traversing the sgRNAs according to a preset interval length, and obtaining a sgRNA combination that meets the length of the cleavage region;

[0020] 203, screening out an sgRNA combination whose cleavage region is a species-specific sequence from the sgRNA combination;

[0021] In some embodiments, the method further includes: 204, screening N sgRNAs from the sgRNA combination as a sgRNA combination for detecting the species to be tested.

[0022] Optionally, the screening method in screening sgRNA from the conserved region includes: excluding sgRNAs of any of the following types: sgRNAs with cleavage sites on the human genome, sgRNAs containing structures that affect cleavage activity;

[0023] Optionally, the structure affecting cutting activity includes: a hairpin structure;

[0024] Optionally, the number of sgRNA combinations is 10-10,000.

[0025] The third aspect of the present application discloses a method for detecting targeted pathogens, the method comprising: obtaining a complex consisting of the sgRNA combination disclosed in the first or second aspect of the present application and the Cas9 protein; using the complex to detect the species to be detected to obtain a detection result;

[0026] Optionally, when there are 10 sgRNAs in the complex, the complex is used to detect any one of Enterococcus faecium, Staphylococcus aureus, and Klebsiella pneumoniae to obtain a detection result containing 1000 copies;

[0027] Optionally, when there are more than 40 sgRNAs in the complex, the complex is used to detect any one of Enterococcus faecium, Staphylococcus aureus, and Klebsiella pneumoniae to obtain detection results containing 10 and 1000 copy numbers.

[0028] The fourth aspect of the present application discloses a screening system for pathogenic species-specific regions, the system comprising:

[0029] The first acquisition module is used to obtain genome set data of the species to be tested;

[0030] The first processing module is used to cluster each gene in the genome set data of the species to be tested to obtain at least one gene cluster whose sequence similarity is greater than a first threshold; and to screen out genes present in each of the genomes from the gene clusters as core gene clusters;

[0031] The second processing module is used to compare the core gene cluster and select the region without SNP site as the conservative region from the comparison result;

[0032] The third processing module is to screen sgRNA from the conserved region; combine the screened sgRNAs according to a preset interval length to obtain an sgRNA combination; and extract the target sequence of the region cut by the sgRNA combination;

[0033] The fourth processing module compares the target sequence with the pathogen comparison database to obtain a comparison result; the sequence similarity in the comparison result is higher than the second threshold, and the sequence is not compared to the target sequence of other species except the species to be tested, as the specific region of the species to be tested.

[0034] The fifth aspect of the present application discloses a sgRNA design system for pathogenic species detection, the system comprising:

[0035] The second acquisition module is used to obtain the conserved regions of pathogenic species;

[0036] A fifth processing module is used to obtain all sgRNAs and their position information from the conserved region, traverse the sgRNAs according to a preset interval length, and obtain an sgRNA combination that meets the length of the cutting region;

[0037] A sixth processing module is used to screen out an sgRNA combination whose cleavage region is a species-specific sequence from the sgRNA combination;

[0038] In some embodiments, the system further includes: a seventh processing module, configured to screen N sgRNAs from the sgRNA combination as a sgRNA combination for detecting the species to be tested.

[0039] A sixth aspect of the present application discloses a targeted pathogen detection system, the system comprising:

[0040] A complex combination module, used to obtain a complex consisting of the sgRNA combination and the Cas9 protein described in the first or second aspect of the present application;

[0041] The species detection module is used to detect the species to be detected using the complex to obtain a detection result.

[0042] In a seventh aspect, the present application discloses a computer device, comprising: a memory and a processor; the memory is used to store program instructions; the processor is used to call program instructions, and when the program instructions are executed, it is used to execute the steps of the method described in the first, second or third aspect of the present application.

[0043] In an eighth aspect, the present application discloses a computer-readable storage medium having a computer program stored thereon. When the computer program is executed by a processor, the steps of the method described in the first, second or third aspect of the present application are implemented.

[0044] The ninth aspect of the present application discloses any of the following applications:

[0045] (1) Application of the method according to the first aspect of the present application in the design of primers and probes for pathogenic species;

[0046] (2) Application of the method according to the first aspect and / or the second aspect of the present application in the detection of pathogenic species.

[0047] This application has the following beneficial effects:

[0048] 1. The present application provides another pathogen targeted sequencing technology different from multiplex PCR and probes, which overcomes the difficulties of multiplex PCR in primer design and target region search; a process for finding species-specific target regions is established, and the obtained species-specific regions can be used for the detection of microbial species, which is not limited to the CRISPR / Cas9 targeting process, and can also be applied to the multiplex PCR detection process and the probe capture process.

[0049] 2. The present invention utilizes the characteristics of small mutual interference between sgRNAs and the compatibility of tens of thousands of them in one system. According to the design of the aforementioned target regions and sgRNAs, a large number of target regions are selected within the entire genome of each species, and corresponding sgRNAs (>40) are invested. This can greatly improve the accuracy and sensitivity of pathogenic microorganism detection without reducing specificity, and is applied to microbial detection of samples with different microbial loads, especially samples with low microbial copy numbers.

[0050] 3. The present application innovatively discloses a method for screening pathogen species-specific sequences, which can help to quickly screen out a set of specific sequence combinations that cover the most species genomes using the least primer sequences, thereby solving the difficulty in finding specific regions and overcoming the shortcomings of current methods that mainly rely on experience, literature retrieval, etc. for specific regions or PCR primer design templates for species identification, such as low efficiency, high trial and error costs, and unknown intraspecies conservation of specific sequences.

[0051] 4. This application only requires a simple enzyme reaction system to achieve target enrichment, which has the advantages of short time consumption, simple operation, no need for thermal denaturation of DNA, low cost, and high capture efficiency.

[0052] 5. The method of this application can accommodate tens of thousands of sgRNAs, so sgRNAs with uniform distribution and high coverage density can be designed for the entire genome of the target species. After library construction and sequencing of the DNA fragments obtained by sgRNA-Cas9 cutting, more genome sequence information of the target species can be obtained, thereby improving the accuracy of bacterial species identification and the sensitivity of detection.

[0053] 6. The method of this application can start from the species and simultaneously search for species-specific target regions and sgRNAs. The design process has low complexity and consumes little computing resources, and sgRNA combinations for species detection can be quickly obtained. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative work.

[0055] Figure 1 is a schematic diagram of a method flow chart provided by the first aspect of an embodiment of the present invention;

[0056] Figure 2 is a schematic diagram of a method flow chart provided by the second aspect of an embodiment of the present invention;

[0057] Figure 3 is a schematic diagram of a method flow chart provided by the third aspect of an embodiment of the present invention;

[0058] Figure 4 is a schematic flow chart of a system provided by a fourth aspect of an embodiment of the present invention;

[0059] Figure 5 is a schematic flow chart of a system provided by a fifth aspect of an embodiment of the present invention;

[0060] Figure 6 is a schematic flow chart of a system provided by a sixth aspect of an embodiment of the present invention;

[0061] Figure 7 is a schematic diagram of a computer device provided by an embodiment of the present invention;

[0062] Figure 8 It is a schematic diagram of the process of targeted pathogenic microorganism detection based on the CRISPR-Cas9 system provided in an embodiment of the present invention. DETAILED DESCRIPTION

[0063] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention.

[0064] In some of the processes described in the specification and claims of the present invention and the above-mentioned figures, multiple operations that appear in a specific order are included, but it should be clearly understood that these operations may not be executed in the order in which they appear in this article or executed in parallel. The serial numbers of the operations, such as 101, 102, etc., are only used to distinguish different operations, and the serial numbers themselves do not represent any execution order. In addition, these processes may include more or fewer operations, and these operations may be executed in sequence or in parallel. It should be noted that the descriptions of "first", "second", etc. in this article are used to distinguish different messages, devices, modules, etc., do not represent the order of precedence, and do not limit the "first" and "second" to be different types.

[0065] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0066] Figure 1 1 is a flow chart of a method for screening pathogen species-specific regions provided by an embodiment of the present invention. Specifically, the method comprises the following steps:

[0067] 101: Obtain genome data of the species to be tested;

[0068] In some embodiments, the species to be tested include any one or more of the following: Enterococcus faecium E. faecium , Staphylococcus aureus S. aureus , Klebsiella pneumoniae K. pneumoniae .

[0069] 102: clustering each gene in the genome set data to obtain at least one gene cluster whose sequence similarity is greater than a first threshold; and selecting genes present in each of the genomes from the gene clusters as core gene clusters;

[0070] In some embodiments, the number of core gene clusters in 102 varies depending on the pathogenic species. For example, the number of core gene clusters of Enterococcus faecium, Staphylococcus aureus, and Klebsiella pneumoniae are 285, 201, and 221, respectively. This number may vary greatly depending on the selected species and the number of genomes, and may range from 100 to 1000.

[0071] Optionally, the first threshold is 85-98%, preferably 95%;

[0072] Optionally, the clustering uses a roary tool.

[0073] 103: aligning the core gene cluster, and selecting a region without SNP sites from the alignment results as a conserved region;

[0074] In the present invention, the open reading frames of the genome are annotated to obtain genes, and then the genes are clustered to obtain gene clusters. For a gene cluster, if the genes contained therein exist on each genome, it is a core gene cluster;

[0075] 104: screening sgRNA from the conserved region; combining the screened sgRNAs according to a preset interval length to obtain an sgRNA combination; extracting a target sequence of the region cut by the sgRNA combination;

[0076] In some embodiments, the preset interval length is: 100-1000 bp;

[0077] Optionally, the screening method in screening sgRNA from the conserved region includes: excluding sgRNAs of any of the following types: sgRNAs with cleavage sites on the human genome, sgRNAs containing structures that affect cleavage activity;

[0078] Optionally, the structure affecting cutting activity includes: a hairpin structure;

[0079] 105: Compare the target sequence with the pathogen comparison database to obtain a comparison result; and use the target sequence in the comparison result whose sequence similarity is higher than a second threshold and which is not compared to the target sequence of other species except the target sequence of the target species as the specific sequence of the target species.

[0080] In some embodiments, the pathogen comparison database is composed of pathogen genome sequences in a known database.

[0081] In some embodiments, the method further comprises: combining the sgRNA of the specific sequence as a sgRNA combination for detecting the species to be tested;

[0082] The second aspect of the present application discloses a sgRNA design method for pathogenic species detection, such as Figure 2 As shown, the method includes:

[0083] 201. Obtain a conserved region of a pathogenic species; optionally, the conserved region is a region disclosed in the first aspect of the present application;

[0084] 202, obtaining all sgRNAs and their position information from the conserved region, traversing the sgRNAs according to a preset interval length, and obtaining a sgRNA combination that meets the length of the cleavage region;

[0085] 203, screening out an sgRNA combination whose cleavage region is a species-specific sequence from the sgRNA combination;

[0086] In some embodiments, the method further includes: 204, selecting N sgRNAs from the sgRNA combination as the sgRNA combination for detecting the species to be detected, wherein N is an integer greater than or equal to 1.

[0087] Optionally, the screening method for screening the target sgRNA from the conserved region includes: excluding any of the following types of sgRNAs: sgRNAs with cleavage sites on the human genome, sgRNAs containing structures that affect cleavage activity;

[0088] Optionally, the structure affecting cutting activity includes: a hairpin structure;

[0089] Optionally, the number of sgRNA combinations is 10-10,000.

[0090] The third aspect of the present application discloses a targeted detection method, such as Figure 3 As shown, the method includes: 301, obtaining a complex consisting of the sgRNA combination and the Cas9 protein disclosed in the first or second aspect of the present application; 302, using the complex to detect the species to be tested to obtain a test result;

[0091] Optionally, when there are 10 sgRNAs in the complex, the complex is used to detect any one of Enterococcus faecium, Staphylococcus aureus, and Klebsiella pneumoniae to obtain a detection result containing 1000 copies;

[0092] Optionally, when there are more than 40 sgRNAs in the complex, the complex is used to detect any one of Enterococcus faecium, Staphylococcus aureus, and Klebsiella pneumoniae to obtain detection results containing 10 and 1000 copy numbers.

[0093] In some embodiments, the CRISPR / Cas9 (Clustered regularly interspaced shortpalindromic repeats (CRISPR) / CRISPR-associated protein 9) system is widely used in gene editing due to its precise and flexible targeting function. The CRISPR-Cas9 system includes two short-chain crRNAs (CRISPR-derived RNAs) and tracrRNA (trans-acting crRNA) and Cas9 nuclease, which together form a ribonucleoprotein (RNP) complex to perform the function of cutting double-stranded DNA. Now researchers have fused crRNA with tracrRNA to obtain single-stranded guide RNAs (sgRNAs). Cas9 protein recognizes the PAM sequence of the 5'-NGG-3' pattern, where N represents any nucleotide. If the PAM sequence is recognized and the sgRNA successfully binds to the target sequence, Cas9 can cut the DNA double strand 3-4 nucleotides upstream of the PAM sequence. This targeting ability of the CRISPR / Cas9 system has made it stand out in the field of targeted sequencing. However, the CRISPR / Cas9 system is currently only used for the detection of one or certain target sequences, such as the application of CRISPR / Cas9 combined with nanopore sequencing technology in the detection of fusion genes or drug-resistant genes, and has not yet been applied to the development of pathogenic microbial species detection systems.

[0094] Figure 4 A screening system for pathogen species-specific regions provided by an embodiment of the present invention comprises:

[0095] The first acquisition module 401 is used to acquire genome data of the species to be tested;

[0096] The first processing module 402 is used to cluster each gene in the genome set data of the species to be tested to obtain at least one gene cluster whose sequence similarity is greater than a first threshold; and select genes present in each of the genomes from the gene clusters as core gene clusters;

[0097] The second processing module 403 is used to compare the core gene cluster and select the region without SNP site as the conservative region from the comparison result;

[0098] The third processing module 404 is to screen sgRNAs from the conserved region; combine the screened sgRNAs according to a preset interval length to obtain a sgRNA combination; and extract the target sequence of the region cut by the sgRNA combination;

[0099] The fourth processing module 405 compares the target sequence with the pathogen comparison database to obtain a comparison result; the sequence similarity in the comparison result is higher than the second threshold, and the sequence is not compared to the target sequence of other species except the species to be tested, as the specific sequence of the species to be tested.

[0100] In one embodiment, the system further comprises:

[0101] An annotation module, used to annotate the open reading frames of the genome set data of the species to be tested to obtain an annotated genome file;

[0102] The clustering module is used to cluster each gene in the annotated genome file.

[0103] Figure 5 The fifth aspect of the present application discloses a sgRNA design system for pathogenic species detection, the system comprising:

[0104] The second acquisition module 501 is used to acquire the conserved region of the pathogenic species;

[0105] The fifth processing module 502 is used to obtain all sgRNAs and their position information from the conserved region, traverse the sgRNAs according to a preset interval length, and obtain a sgRNA combination that meets the length of the cutting region;

[0106] The sixth processing module 503 is used to screen out the sgRNA combination whose cleavage region is a species-specific sequence from the sgRNA combination.

[0107] In some embodiments, the system further includes: a seventh processing module, configured to screen N sgRNAs from the sgRNA combination as a sgRNA combination for detecting the species to be tested.

[0108] Figure 6 A pathogen species detection system provided by an embodiment of the present invention comprises:

[0109] A complex combination module 601 is used to obtain a complex consisting of the sgRNA combination and the Cas9 protein described in the first or second aspect of the present application;

[0110] The species detection module 602 is used to detect the species to be detected using the composite to obtain a detection result.

[0111] Figure 7 A computer device is provided in an embodiment of the present invention, and the device comprises: a memory and a processor; the memory is used to store program instructions; the processor is used to call program instructions, and when the program instructions are executed, it is used to execute the steps of the method described in the first, second or third aspect of the present application.

[0112] The embodiment of the present invention also provides a computer-readable storage medium on which a computer program is stored. When the computer program is executed by a processor, the steps of the method described in the first, second or third aspect of the present application are implemented.

[0113] The embodiment of the present invention further discloses a computer program product, including a computer program, which implements the steps of the above method when executed by a processor.

[0114] The present application also discloses any of the following applications:

[0115] (1) Application of the method according to the first aspect of the present application in the design of primers and probes for pathogenic species;

[0116] (2) Application of the method according to the first aspect and / or the second aspect of the present application in the detection of pathogenic species.

[0117] Example: Detection process of common clinical pathogenic bacteria species:

[0118] 1. Experimental Materials

[0119] Sample: Enterococcus faecium E. faecium , Staphylococcus aureus S. aureus , Klebsiella pneumoniae K. pneumoniae and human cells.

[0120] Reagents: Microbial genome extraction kit, Cas9 nuclease, fast phosphatase, PCR mix, Taq DNA polymerase, T7 in vitro transcription kit, RNA purification kit, etc.

[0121] 2. Experimental methods

[0122] Step 1: Construction of genome sequence set of species to be tested.

[0123] Collect all the public genome data of the species to be tested in the public database, and select the genome with good integrity as the representative genome set of the species. In this example, the bacterial species to be tested is Enterococcus faecium E. faecium , Staphylococcus aureus S. aureus and Klebsiella pneumoniae K. pneumoniae .

[0124] Step 2: Use the Roary tool to construct the pan-genome of the species and extract the core genome.

[0125] Annotate the open reading frame of each genome in the genome set of step 1. After obtaining the annotation file, use the Roary tool to cluster the genes. Genes with sequence similarity > 95% are clustered into the same gene cluster. After clustering, the pan-genome of the species is obtained. Genes that exist in each genome, namely the core gene cluster, are selected to form the core genome.

[0126] Step 3: Perform multiple sequence alignment for each core gene cluster and extract SNP positions.

[0127] Multiple sequence alignment was performed for each core gene cluster, and the locations of SNP sites were obtained based on the alignment results. The locations containing SNP sites were excluded, and only the conserved regions were used for the subsequent sgRNA design.

[0128] Step 4: Find all sgRNAs in the core gene cluster and eliminate those that do not meet the requirements.

[0129] After obtaining all sgRNAs at the conserved positions of each core gene cluster, sgRNAs in the following two situations were excluded: 1. The sgRNA contained a cleavage site on the human genome; 2. The sgRNA contained a hairpin structure or other structure that affected the cleavage activity.

[0130] Step 5: Obtain all sgRNA combinations at certain intervals and extract the regions cut out by these sgRNA combinations.

[0131] Combine the sgRNAs in step 4 at certain intervals of 100-1000 bp, and extract the sequences of the regions cut out by these sgRNA combinations.

[0132] Step 6: Verify the species specificity of the region cut by the sgRNA combination.

[0133] First, a database for sequence alignment is constructed, and high-quality genome sequences of all common pathogens are downloaded to form a database. Then the region obtained in step 5 is aligned with the database to obtain the alignment results, and the alignment results with similarity below the threshold are removed to obtain the filtered alignment results, with the threshold being 90-95%. If a sequence is aligned only to its source species and not to other species, the sequence is a species-specific sequence.

[0134] Step 7: Select the sgRNA combination for the species-specific region to obtain the sgRNA combination for the species.

[0135] The sgRNAs required for cutting all species-specific sequences screened in step 6 are combined together to form the sgRNA combination for detecting the species.

[0136] Step 8: Preparation of sgRNA template strand for in vitro transcription.

[0137] Design sgRNA primers for in vitro transcription according to the sgRNA sequence obtained in step 7. Synthesize the template DNA used for in vitro transcription by PCR. The template sequence is:

[0138] AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC. The forward primer sequence is: TTCTAATACGACTCACTATAGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGA, where N represents the sequence in the sgRNA that is complementary to the target DNA. The reverse primer sequence is: AAAAGCACCGACTCGGTGCC.

[0139] The amplification system is:

[0140]

[0141] Amplification conditions were:

[0142]

[0143] Step 9: Purify the PCR product using magnetic beads.

[0144] After the reaction, the PCR product was purified by magnetic beads. The purification steps are as follows: Take 90 μl of AMPure XP magnetic beads and place them in the PCR product. Mix thoroughly and let it stand for 5 min. Place the PCR tube in a magnetic rack to separate the magnetic beads and liquid. After the solution is clear, carefully remove the supernatant. Keep the PCR tube in the magnetic rack and rinse the magnetic beads with 200 μl of 80% ethanol freshly prepared with nuclease-free water. Incubate at room temperature for 30 sec and carefully remove the supernatant. Repeat the rinse once. Keep the PCR tube in the magnetic rack and dry the magnetic beads at room temperature with the lid open. Add 22 μl of nuclease-free water, pipette until fully mixed, and let it stand at room temperature for 5 min. Centrifuge the PCR tube briefly and place it in a magnetic rack to stand. After the solution is clear, carefully transfer 20 μl of supernatant to a new PCR tube. Use Qubit to measure the concentration of the recovered product.

[0145] Step 10: In vitro transcription of sgRNA.

[0146] The T7 in vitro transcription kit was used to perform in vitro transcription of sgRNA. The steps were as follows: add the following reagents to the PCR tube in order: 10 µl of NTP Buffer Mix, 1 µg of sgRNA template DNA purified in the previous step, 2 µl of T7 RNA polymerase Mix, and make up to 30 µl with water. The reaction conditions were: 37°C, 16 h.

[0147] Step 11: Purification of RNA.

[0148] RNA was purified using an RNA purification kit and the concentration of sgRNA was determined using Qubit.

[0149] Step 12: Assembly of the Cas9-sgRNA complex.

[0150] Mix the components according to the following system:

[0151]

[0152] The above system was fully assembled by incubating at room temperature (25°C) for 30 min.

[0153] Step 13: Extract microbial genomes and prepare simulated samples.

[0154] Extract Enterococcus faecium using a microbial genome extraction kit E. faecium , Staphylococcus aureus S. aureus , Klebsiella pneumoniae K. pneumoniae and human cell genome. They are mixed in proportion to make a simulated sample to be tested.

[0155] Step 14: Simulate sample genome dephosphorylation.

[0156] Prepare 400 ng of DNA dissolved in nuclease-free water, add nuclease-free water to 24 µl according to the concentration, and gently tap the tube to mix. Centrifuge briefly; mix the phosphatase by pipetting and equilibrate to room temperature; mix the following reagents in a 0.2 ml thin-walled PCR tube:

[0157]

[0158] Flick to mix and centrifuge briefly. Incubate on a PCR machine as follows: 37ºC for 10 minutes; 80ºC for 2 minutes to achieve dephosphorylation.

[0159] Step 15: Simulate sample genome cutting and A addition.

[0160] Add 10 µl of Cas9-sgRNA complex to the reaction tube in the previous step, flick to mix, spin briefly, and incubate at 37°C for 45 min; incubate at 80°C for 15 min. Vortex to mix dATP, place on ice, spin briefly, and place on ice. Add 1 µl of dATP and 1 µl of Taq polymerase to the reaction tube in the previous step, flick to mix, spin briefly, and react at 72°C for 5 min to add A to the cut DNA ends. The reaction product is purified using 1.7× magnetic beads.

[0161] Step 16: Adapter ligation and library purification.

[0162] Gently flick to mix and briefly spin off the second-generation sequencing universal adapter and rapid T4 DNA ligase, and place on ice; thaw the ligation buffer at room temperature, centrifuge slightly after thawing, and mix with a pipette, and place on ice; carefully transfer the reaction solution in the PCR tube in the previous step to a 1.5 ml centrifuge tube; mix the following reagents in a new 1.5 ml centrifuge tube:

[0163]

[0164] After flicking to mix and centrifuging, add the above mixture to the DNA library sample, flick to mix and centrifuge; react at room temperature for 15 min. After the reaction, purify the reaction solution using 1× magnetic beads.

[0165] Step 17: Library amplification and product magnetic bead purification.

[0166] The amplification system is:

[0167]

[0168] Amplification conditions were:

[0169]

[0170]

[0171] After amplification, the product was purified by 1× magnetic beads, and then fragments were sorted using 0.6-0.8× double-wheel magnetic beads. After sorting, 1 µl was taken for Qubit quantification.

[0172] Step 18: Sequencing.

[0173] The sequencing platform is the Illumina sequencing platform.

[0174] Step 19: Off-line data analysis.

[0175] Fastp software was used to remove adapters and low-quality sequences from the offline data, and then bwa was used for sequence alignment. The data were compared with the human reference genome, the microbial reference genome of the simulated sample, and the target sequence. The alignment results were then statistically analyzed to determine whether the pathogenic microorganisms were successfully detected and to calculate the enrichment factor (enrichment factor = percentage of target sequence reads after capture / percentage of target sequence reads not captured).

[0176] 3. Experimental results

[0177] like Figure 8The figure shows the schematic diagram of the targeted pathogen detection process based on the CRISPR-Cas9 system; find the species-specific region in the genomic DNA of the pathogen, dephosphorylate the genomic DNA, use the Cas9-sgRNA complex to cut the dephosphorylated genomic DNA, then add A to the end of the species-specific region, connect the adapter and perform PCR amplification.

[0178] Since sgRNAs interfere little with each other, tens of thousands of sgRNAs can be compatible in one system. Taking advantage of this feature of sgRNA, this experiment selected the designed sgRNA combination for species detection and Cas9 protein to form a complex, and detected Enterococcus faecium, Staphylococcus aureus and Klebsiella pneumoniae in the simulated samples. The test results are shown in Table 1. With a sequencing data volume of about 2 M, when 10 sgRNAs were put into the reaction system, 1000 copies of Enterococcus faecium, Staphylococcus aureus and Klebsiella pneumoniae in the reaction system could be successfully detected; when the number of sgRNAs put into the reaction system was further increased (>40), 10 and 1000 copies of Enterococcus faecium, Staphylococcus aureus and Klebsiella pneumoniae in the reaction system could be successfully detected, achieving an enrichment effect of more than 10,000 times on the target area, which proved that the detection method constructed by the present invention is available and has a good effect.

[0179] Table 1. Results of CRISPR-Cas9 targeted enrichment sequencing technology for pathogens

[0180]

[0181] There are two main traditional detection methods in clinical practice. One is based on microbial culture, which identifies pathogenic microorganisms by isolating and culturing microorganisms, observing their cell morphology, and conducting physiological and biochemical characteristics experiments. Although culture-based is still one of the gold standards for pathogen diagnosis, this method relies on the cultivation of samples, has a long detection cycle, requires high experimental and technical conditions, and has preferences, and has poor detection of difficult-to-cultivate microorganisms. The other is based on specific primers, probes or antibodies, such as antigen-antibody reactions, PCR reactions, and pathogen-specific rapid detection systems. This method is usually simple and fast, and plays an important role in daily clinical practice and disease control, but the identification accuracy is low, and the design of primers, probes or antibodies requires known sequence information of microorganisms, so it usually only targets known pathogens and cannot cope with unknown infections. It is a trial method detection with low detection efficiency and throughput.

[0182] Those skilled in the art can clearly understand that, for the convenience and brevity of description, the specific working processes of the systems, devices and units described above can refer to the corresponding processes in the aforementioned method embodiments and will not be repeated here.

[0183] In the several embodiments provided in the present application, it should be understood that the disclosed systems, devices and methods can be implemented in other ways. For example, the device embodiments described above are only schematic. For example, the division of the units is only a logical function division. There may be other division methods in actual implementation, such as multiple units or components can be combined or integrated into another system, or some features can be ignored or not executed. Another point is that the mutual coupling or direct coupling or communication connection shown or discussed can be an indirect coupling or communication connection through some interfaces, devices or units, which can be electrical, mechanical or other forms.

[0184] The units described as separate components may or may not be physically separated, and the components shown as units may or may not be physical units, that is, they may be located in one place or distributed on multiple network units. Some or all of the units may be selected according to actual needs to achieve the purpose of the solution of this embodiment.

[0185] In addition, each functional unit in each embodiment of the present invention may be integrated into one processing unit, or each unit may exist physically separately, or two or more units may be integrated into one unit. The above-mentioned integrated unit may be implemented in the form of hardware or in the form of software functional units.

[0186] A person skilled in the art may understand that all or part of the steps in the various methods of the above embodiments may be completed by instructing related hardware through a program, and the program may be stored in a computer-readable storage medium, and the storage medium may include: a read-only memory (ROM), a random access memory (RAM), a disk or an optical disk, etc.

[0187] A person skilled in the art can understand that all or part of the steps in the above-mentioned embodiment method can be completed by instructing related hardware through a program, and the program can be stored in a computer-readable storage medium. The above-mentioned storage medium can be a read-only memory, a disk or an optical disk, etc.

[0188] The above is a detailed introduction to a computer device provided by the present invention. For a person skilled in the art, according to the concept of the embodiments of the present invention, there may be changes in the specific implementation method and application scope. In summary, the content of this specification should not be understood as limiting the present invention.

Claims

1. A method for designing sgRNA for pathogenic species detection, characterized in that: The method comprises: Step 1: Collect all the public genome data of the species to be tested in the public database, and select the genome with good integrity as the representative genome set of the species; Step 2: Annotate the open reading frame of each genome in the genome set of step 1. After obtaining the annotation file, use the Roary tool to cluster the genes. Genes with sequence similarity > the first threshold are clustered into the same gene cluster. After clustering, the pan-genome of the species is obtained. Genes that exist in each genome, namely the core gene cluster, are selected to form the core genome; Step 3: Perform multiple sequence alignment on each core gene cluster, obtain the location of the SNP site based on the alignment results, exclude the location containing the SNP site, and only use the conservative region for subsequent sgRNA design; Step 4: After obtaining all sgRNAs at the conserved positions of each core gene cluster, exclude the sgRNAs in the following situations: sgRNAs contain cleavage sites on the human genome; sgRNAs contain structures that affect cleavage activity; the structures that affect cleavage activity include hairpin structures; Step 5: Combine the sgRNAs in step 4 at intervals of 100-1000 bp, and extract the sequences of the regions cut out by these sgRNA combinations; Step 6: Verify the species specificity of the region cut by the sgRNA combination; First, a database for sequence alignment is constructed, and high-quality genome sequences of all common pathogens are downloaded to form a database; then the region obtained in step 5 is aligned with the database to obtain an alignment result, and the alignment results with similarity lower than the second threshold are removed to obtain the screened alignment results; if a sequence is aligned only to its source species but not to other species, the sequence is a species-specific sequence; Step 7: Combine the sgRNAs required to cut all species-specific sequences screened in step 6 to obtain the sgRNA combination for species detection.

2. The sgRNA design method for pathogenic species detection according to claim 1, characterized in that: The species to be tested include any one or more of the following: Enterococcus faecium E. faecium , Staphylococcus aureus S. aureus , Klebsiella pneumoniae K. pneumoniae.

3. The sgRNA design method for pathogenic species detection according to claim 1, characterized in that: The first threshold is 95%.

4. The sgRNA design method for pathogenic species detection according to claim 1, characterized in that: The second threshold is 90-95%.

5. A targeted pathogen detection method, characterized in that: The method is used for non-disease diagnosis purposes, and comprises: obtaining a complex consisting of the sgRNA combination according to any one of claims 1 to 4 and the Cas9 protein; and using the complex to detect a species to be tested to obtain a test result.

6. The targeted pathogen detection method according to claim 5, characterized in that: When there are 10 sgRNAs in the complex, the complex is used to detect any one of Enterococcus faecium, Staphylococcus aureus, and Klebsiella pneumoniae, and a detection result containing 1000 copies is obtained.

7. The targeted pathogen detection method according to claim 5, characterized in that: When the number of sgRNAs in the complex is greater than 40, the complex is used to detect any one of Enterococcus faecium, Staphylococcus aureus, and Klebsiella pneumoniae, and detection results containing 10 and 1000 copies are obtained.

8. A computer device, characterized in that: The device comprises: a memory and a processor; the memory is used to store program instructions; the processor is used to call the program instructions, and when the program instructions are executed, it is used to execute the steps of the method described in any one of claims 1 to 4.

9. A computer device, characterized in that: The device comprises: a memory and a processor; the memory is used to store program instructions; the processor is used to call the program instructions, and when the program instructions are executed, it is used to perform the following method steps, which include: obtaining a complex composed of the sgRNA combination and the Cas9 protein according to any one of claims 1 to 4; using the complex to detect the species to be tested to obtain a detection result.

10. The computer device according to claim 9, characterized in that The method further includes: when there are 10 sgRNAs in the complex, using the complex to detect any one of Enterococcus faecium, Staphylococcus aureus, and Klebsiella pneumoniae to obtain a detection result containing 1000 copies.

11. The computer device according to claim 9, characterized in that The method further includes: when there are more than 40 sgRNAs in the complex, using the complex to detect any one of Enterococcus faecium, Staphylococcus aureus, and Klebsiella pneumoniae to obtain a detection result containing 10 and 1000 copies.

12. A computer-readable storage medium, characterized in that: A computer program is stored thereon, and when the computer program is executed by a processor, the steps of the method described in any one of claims 1 to 4 are implemented.

13. A computer-readable storage medium, characterized in that: A computer program is stored thereon, and when the computer program is executed by a processor, the following method steps are implemented, and the method steps include: obtaining a complex composed of the sgRNA combination according to any one of claims 1 to 4 and the Cas9 protein; using the complex to detect the species to be tested to obtain a detection result.

14. The computer-readable storage medium according to claim 13, wherein: The method further includes: when there are 10 sgRNAs in the complex, using the complex to detect any one of Enterococcus faecium, Staphylococcus aureus, and Klebsiella pneumoniae to obtain a detection result containing 1000 copies.

15. The computer-readable storage medium according to claim 13, wherein: The method further includes: when there are more than 40 sgRNAs in the complex, using the complex to detect any one of Enterococcus faecium, Staphylococcus aureus, and Klebsiella pneumoniae to obtain a detection result containing 10 and 1000 copies.

16. Any of the following applications: (1) Use of the method according to any one of claims 1 to 4 in the design of primers and probes for pathogenic species; (2) Use of the method according to any one of claims 5 to 7 in the detection of pathogenic species, wherein the application is for non-disease diagnosis purposes.

Images