Poxvirus human neutralizing antibody MV129 or its antigen-binding fragment and its application

Abstract

The present invention relates to a poxvirus human neutralizing antibody MV129 or an antigen-binding fragment thereof and its application, which comprises a heavy chain variable region and a light chain variable region, wherein the amino acid sequences of CDR1H, CDR2H and CDR3H of the heavy chain variable region are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively; the amino acid sequences of CDR1L, CDR2L and CDR3L of the light chain variable region are shown in SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6. The neutralizing antibody MV129 of the present invention can bind to the A35 antigen of MPXV and also has good neutralizing activity against the MPXV true virus.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and specifically to a humanized neutralizing antibody against poxvirus or an antigen-binding fragment thereof and applications thereof, and more specifically to a humanized neutralizing antibody MV129 or an antigen-binding fragment thereof, a polynucleotide, a nucleic acid construct, an expression vector, a transformed cell, a pharmaceutical composition that binds to the A35 protein of monkeypox virus and / or the A33R protein of cowpox virus, and applications thereof in the preparation of drugs for preventing or treating or detecting or diagnosing poxvirus infection or complications caused by infection with poxvirus. Background Art

[0002] Monkeypox virus (MPXV) is a zoonotic virus. MPXV infection can directly damage immune organs such as the spleen, tonsils, lymph nodes, and thymus, leading to lymphocytopenia. Immunocompromised individuals, including children, the elderly, and immunodeficient patients, are more susceptible to these severe manifestations.

[0003] The use of effective therapeutic drugs can greatly reduce the severity and mortality of diseases caused by viral infection, shorten the course of the disease, and relieve the pain of patients. So far, few therapeutic drugs for MPXV infection have been developed. During the pathogen infection process, specific neutralizing antibodies can prevent the pathogen from binding to the host cell surface receptors, thereby preventing the pathogen from infecting the target cell.

[0004] In the early stages of MPXV infection, there are two different infectious virus particles: extracellular enveloped virus particles (EEV) and intracellular mature virus particles (IMV). IMV is the most abundant virus particle, and the surface proteins exposed by IMV trigger higher neutralizing antibody production and activate complement response. There are at least 25 and 6 surface proteins on the surfaces of the two MPXVs, respectively. Among them, in previous studies based on vaccinia virus homologs, the H3L protein on the surface of IMV and the A35R protein on the surface of EEV were considered to be the main targets of neutralizing antibodies. Therefore, it is urgent to screen a humanized neutralizing antibody that can be used to prevent and treat MPXV infection. Summary of the invention

[0005] Purpose of the Invention

[0006] The purpose of the present invention is to provide a humanized neutralizing antibody MV129 or an antigen-binding fragment thereof and its application, more specifically, a humanized neutralizing antibody MV129 or an antigen-binding fragment thereof, polynucleotides, nucleic acid constructs, expression vectors, transformed cells, pharmaceutical compositions, and their use in the preparation of drugs for preventing or treating or detecting or diagnosing poxvirus infection or complications caused by infection with poxvirus. The humanized neutralizing antibody of the present invention can effectively neutralize monkeypox virus, can meet the drug demand for the treatment of monkeypox infection in my country, and provide an important tool for scientific response to monkeypox.

[0007] Solution

[0008] To achieve the above object, the present invention provides the following technical solutions:

[0009] In a first aspect, the present invention provides a humanized neutralizing antibody MV129 or an antigen-binding fragment thereof that binds to the A35 protein of monkeypox virus and / or the A33R protein of vaccinia virus, comprising a heavy chain variable region and a light chain variable region, wherein:

[0010] The amino acid sequences of CDR1H, CDR2H and CDR3H in the heavy chain variable region are shown in SEQ ID NO: 1 (i.e., GDSISSDNY), SEQ ID NO: 2 (i.e., YTSGS) and SEQ ID NO: 3 (i.e., CARDRGNSYGNWYFDHW), respectively; or the amino acid sequences of CDR1H, CDR2H and CDR3H have 1, 2 or 3 amino acid differences from the amino acid sequences shown in SEQ ID NO: 1 (i.e., GDSISSDNY), SEQ ID NO: 2 (i.e., YTSGS) and SEQ ID NO: 3 (i.e., CARDRGNSYGNWYFDHW), respectively, and have the same or substantially the same immunogenicity as those;

[0011] The amino acid sequences of CDR1L, CDR2L and CDR3L in the light chain variable region are as shown in SEQ ID NO:4 (i.e., TLSSEHSSYAIA), SEQ ID NO:5 (i.e., LNSDGSHNKGD) and SEQ ID NO:6 (i.e., CQTWGTGTVVF); or the amino acid sequences of CDR1L, CDR2L and CDR3L have 1, 2 or 3 amino acid differences from the amino acid sequences shown in SEQ ID NO:4 (i.e., TLSSEHSSYAIA), SEQ ID NO:5 (i.e., LNSDGSHNKGD) and SEQ ID NO:6 (i.e., CQTWGTGTVVF), respectively, and have the same or substantially the same immunogenicity as those.

[0012] The humanized neutralizing antibodies or antigen-binding fragments thereof of the present invention are mainly directed against monkeypox virus, and may also have neutralizing activity against other orthopoxviruses (eg, vaccinia virus).

[0013] In some embodiments, the heavy chain variable region further comprises four framework regions HFR1-4, and the HFR1-4 are arranged alternately with the CDR1H, CDR2H and CDR3H in sequence;

[0014] And / or, the light chain variable region further includes four framework regions LFR1-4, and the LFR1-4 are arranged alternately in sequence with the CDR1L, CDR2L and CDR3L.

[0015] In some embodiments, the heavy chain variable region comprises an amino acid sequence as shown in SEQ ID NO:7, or an amino acid sequence that has at least 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence as shown in SEQ ID NO:7 and has the same or substantially the same immunogenicity as the amino acid sequence as shown in SEQ ID NO:7; the amino acid sequence as shown in SEQ ID NO:7 is as follows:

[0016]

[0017] Among them, the underlined parts are the framework regions HFR1 to 4, and the black parts are CDR1H, CDR2H and CDR3H of the heavy chain variable region.

[0018] In some embodiments, the light chain variable region comprises an amino acid sequence as shown in SEQ ID NO:8, or an amino acid sequence having at least 90%, 92%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence as shown in SEQ ID NO:8 and having the same or substantially the same immunogenicity as the amino acid sequence as shown in SEQ ID NO:8, and the amino acid sequence as shown in SEQ ID NO:8 is as follows:

[0019]

[0020] Among them, the underlined parts are the framework regions LFR1 to 4, and the black parts are CDR1L, CDR2L and CDR3L of the heavy chain variable region.

[0021] In some embodiments, the human neutralizing antibody or its antigen-binding fragment, wherein the antigen-binding fragment is selected from Fab, Fab', Fab'-SH, Fv, scFv, F(ab')2, and diabody.

[0022] In a second aspect, a polynucleotide is provided, which encodes the human neutralizing antibody MV129 or its antigen-binding fragment that binds to the A35 protein of monkeypox virus and / or the A33R protein of vaccinia virus.

[0023] Furthermore, the polynucleotide is DNA or mRNA.

[0024] Furthermore, the polynucleotide has a nucleotide sequence of SEQ ID NO:9 and / or SEQ ID NO:10.

[0025] The nucleotide sequence shown in SEQ ID NO:9 corresponds to the amino acid sequence encoded by SEQ ID NO:7. The nucleotide sequence shown in SEQ ID NO:9 is as follows:

[0026] CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACC

[0027] CTGTCCCTCACCTGCACTGTCTCTGGTGACTCCATCAGCAGTGATAATTACTACTGG

[0028] AGCTGGATCCGGCAGCCCGCCGGGAAGGGACTGGAGTGGATTGGGCGTATCTATA

[0029] CCAGTGGGAGCACCAACTTCAACCCCTCCCTCAAGAGTCGAGTCACCATGTCAGT

[0030] AGACACGTCCAAGAACCAGTTCTCCCTGAGGGGTGAGGTCTGTGACAGCCGCAGA

[0031] CACGGCCGTGTATTATTGTGCGAGAGATAGGGGAAACAGCTATGGCAACTGGTACT

[0032] TTGACCACTGGGGCCAGGGGGACCCTGGTCACCGTGTCCTCA.

[0033] The nucleotide sequence shown in SEQ ID NO: 10 corresponds to the amino acid sequence encoded by SEQ ID NO: 8. The nucleotide sequence shown in SEQ ID NO: 10 is as follows:

[0034] CAGCTTATGCTGACTCAATCGCCCTCTGCCTCTGCCTCCCCTGGGAGCCTCGGT

[0035] CAAGCTCACCTGCACTCTGAGCAGTGAACACAGCAGCTACGCCATCGCATGGCAT

[0036] CAGCAGCAGCCAGAGAAGGGCCCTCGGTACTTGATGAAGCTTAACAGTGATGGCA

[0037] GCCACAACAAGGGGGACGGGATCCCTGATCGCTTCTCAGGCTCCAGCTCTGGGGC

[0038] TGAGCGCTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACT

[0039] GTCAGACCTGGGGCACTGGCACTGTGGTATTCGGCGGAGGGACCAAACTGACCGT

[0040] CCTA.

[0041] In a third aspect, the present invention provides a nucleic acid construct comprising the polynucleotide described in the second aspect.

[0042] Further preferably, the polynucleotide further comprises at least one expression control element operably linked to the polynucleotide, such as a histidine tag, a stop codon, etc.

[0043] In a fourth aspect, the present invention provides an expression vector comprising the nucleic acid construct.

[0044] In a fifth aspect, the present invention provides a transformed cell, which comprises the polynucleotide as described in the second aspect, the nucleic acid construct as described in the third aspect, or the expression vector as described in the fourth aspect. Optionally, it is a eukaryotic expression vector.

[0045] In the sixth aspect, the present invention provides a pharmaceutical composition comprising the human neutralizing antibody MV129 or its antigen-binding fragment that binds to the A35 protein of monkeypox virus and / or the A33R protein of cowpox virus as described in the first aspect above, the polynucleotide as described in the second aspect above, the nucleic acid construct as described in the third aspect above, the expression vector as described in the fourth aspect above or the transformed cell as described in the fifth aspect above, and a pharmaceutically acceptable carrier and / or excipient.

[0046] Further preferably, the pharmaceutical composition is in the form of a nasal spray, an oral preparation, a suppository or a parenteral preparation.

[0047] Further preferably, the nasal spray is selected from aerosols, sprays and powder sprays.

[0048] Further preferably, the oral preparation is selected from tablets, powders, pills, powders, granules, fine granules, soft / hard capsules, film-coated capsules, pellets, sublingual tablets and ointments.

[0049] Further preferably, the parenteral preparation is a transdermal preparation, an ointment, a plaster, an external liquid, an injectable or pushable preparation.

[0050] In the seventh aspect, the present invention provides a human neutralizing antibody MV129 or its antigen-binding fragment that binds to the A35 protein of monkeypox virus and / or the A33R protein of cowpox virus as described in the first aspect above, the polynucleotide as described in the second aspect above, the nucleic acid construct as described in the third aspect above, the expression vector as described in the fourth aspect above, or the transformed cell as described in the fifth aspect above, or the pharmaceutical composition as described in the sixth aspect above, for use in the preparation of a medicament for preventing or treating or detecting or diagnosing poxvirus infection or complications caused by poxvirus infection.

[0051] Preferably, the poxvirus is an orthopoxvirus, optionally monkeypox virus MPXV or vaccinia virus, optionally the vaccinia virus is vaccinia virus vaccine strain VACV.

[0052] In the eighth aspect, the present invention provides a method for preventing or treating poxvirus infection or complications caused by poxvirus infection, comprising: administering to a subject in need thereof a preventive or therapeutically effective amount of a human neutralizing antibody or its antigen-binding fragment that binds to the A35 protein of monkeypox virus and / or the A33R protein of cowpox virus as described in the first aspect above, the polynucleotide as described in the second aspect above, the nucleic acid construct as described in the third aspect above, the expression vector as described in the fourth aspect above, or the transformed cell as described in the fifth aspect above, or the pharmaceutical composition as described in the sixth aspect above.

[0053] Preferably, the poxvirus is an orthopoxvirus, optionally monkeypox virus MPXV or vaccinia virus, optionally the vaccinia virus is vaccinia virus vaccine strain VACV.

[0054] The effective dosage of the pharmaceutical composition of the present invention may vary depending on the subject of administration, the subject organ, symptoms, the method of administration, etc., and can be determined based on the doctor's judgment, taking into account the type of dosage form, the method of administration, the age and weight of the patient, the patient's symptoms, etc.

[0055] Beneficial Effects

[0056] (1) The neutralizing antibody MV129 of the present invention has good binding activity to MPXV A35 antigen and also has certain binding activity to the A33R protein of the vaccinia vaccine strain. The EC of the neutralizing antibody MV129 to the MPXV true virus 50 The neutralizing antibody of the present invention has application value in clinical treatment and prevention of MPXV infection, and provides a potential new antibody drug for clinical prevention, treatment and detection of monkeypox virus.

[0057] (2) The present invention uses a eukaryotic expression system (Chinese Hamster Ovary (CHO) cells) that stably and efficiently expresses antibodies, and can obtain fully humanized antibodies without the need for further humanization treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] One or more embodiments are exemplarily described by the pictures in the accompanying drawings, and these exemplary descriptions do not constitute limitations on the embodiments. The special word "exemplary" here means "used as an example, embodiment or illustrative". Any embodiment described as "exemplary" here is not necessarily interpreted as being superior or better than other embodiments.

[0059] Figure 1 These are the binding activities of the neutralizing antibody MV129 of Example 3 of the present invention to the monkeypox virus (MPXV) A35 antigen and the vaccinia vaccine strain A33R antigen, respectively.

[0060] Figure 2 It is a schematic diagram of the affinity constant results of the neutralizing antibody MV129 of Example 4 of the present invention with monkeypox virus (MPXV) A35 antigen and vaccinia vaccine strain A33R antigen, respectively, wherein A is monkeypox virus (MPXV) A35 antigen and B is vaccinia vaccine strain A33R antigen.

[0061] Figure 3 This is the pathological neutralization effect curve of the neutralizing antibody MV129 in Example 5 of the present invention on the MPXV true virus strain. DETAILED DESCRIPTION

[0062] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. Unless otherwise expressly stated, throughout the specification and claims, the term "including" or its variations such as "comprising" or "including" will be understood to include the stated elements or components, without excluding other elements or other components.

[0063] In addition, in order to better illustrate the present invention, numerous specific details are provided in the specific embodiments below. It should be understood by those skilled in the art that the present invention can also be implemented without certain specific details. In some embodiments, raw materials, elements, methods, means, etc. well known to those skilled in the art are not described in detail, so as to highlight the main purpose of the present invention.

[0064] Hereinafter, the present invention will be described in detail.

[0065] definition

[0066] When referring to a ligand / receptor, antibody / antigen or other binding pair, "specific" binding refers to determining the presence or absence of the binding reaction of the protein, such as the neutralizing antibody of the present invention, to the monkeypox virus A35 and / or A33R antigen in a heterogeneous population of proteins and / or other biological agents. Thus, under specified conditions, a specific ligand / antigen binds to a specific receptor / antibody and does not bind to other proteins present in the sample in significant amounts.

[0067] The reagents, enzymes, culture media, antibiotics, skimmed milk powder and other chemical materials used in the following examples of the present invention are all commercially available products, for example, the Chromium Single Cell V(D)J Reagent Kits, 10X Genomics) kits are purchased from 10X Genomics.

[0068] The antigens in the following embodiments of the present invention are commercially available products, for example: monkeypox virus A35 antigen was purchased from Beijing Sino Biological Science and Technology Co., Ltd. with the item number 40886-V08H; vaccinia vaccine strain A33R antigen was purchased from Beijing Sino Biological Science and Technology Co., Ltd. with the item number 40896-V07E.

[0069] Some commonly used biological materials, such as competent cells, vectors, helper phages, cells to be transformed, etc., are also commercially available products.

[0070] The amino acid sequences of the heavy chain variable region and the light chain variable region of the antibody MV129 of the present invention are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively. The main sequence information is shown in Table 1 below.

[0071] Table 1 Sequence information of antibody MV129

[0072]

[0073] The antibodies of the present invention are derived from PBMCs of patients who have recovered from monkeypox virus infection. First, B cells are enriched from the patient's blood, and single memory B cells that specifically bind to the monkeypox virus A35 antigen are sorted using flow sorting technology. Single cell library construction, BCR immune group library and high-throughput sequencing of transcriptomes are performed using 10×Genomics technology. The sequencing data is analyzed, and the antibody sequences are sorted and scored according to different parameters, including the abundance, frequency, germline genes used, mutation rate, etc. of the antibody sequences, and antibody sequences with potential affinity are selected for batch synthesis and eukaryotic system expression and purification. Then, ELISA, BLI and other methods are used to test the antigen binding ability and affinity of the candidate antibodies, and the neutralization ability of the MPXV true virus is also explored to screen out effective neutralizing antibodies.

[0074] Example 1: Obtaining Antibody Sequence Information by High-Throughput Single-Cell Sequencing

[0075] Fresh blood was collected from patients who recovered from monkeypox virus infection. Peripheral blood mononuclear cells (PBMCs) were separated by Ficoll gradient centrifugation. B cells were separated from PBMCs by magnetic beads and antigen-specific B cell enrichment was performed (using flow cytometry). Antibody library construction and antibody sequencing (commissioned to Novo sequencing platform) were performed using kits (Chromium Single Cell V(D)J Reagent Kits, 10×Genomics). Sequencing data were analyzed and antibodies were assembled. Antibody sequences were sorted and scored according to different parameters, including the abundance, frequency, germline genes used, mutation rate, etc. of antibody sequences. Antibody sequences with potential affinity were selected for batch synthesis and eukaryotic system expression and purification.

[0076] Example 2. Expression and purification of antibody protein

[0077] GenScript was commissioned to express and purify the antibody protein.

[0078] Example 3: Binding ability of neutralizing antibody MV129 to MPXV strain antigens

[0079] In the ELISA plate, 100ng of monkeypox virus A35 antigen or vaccinia vaccine strain A33R antigen was coated at 4°C overnight. Washed 3 times with 0.05% PBST. Add 100ul / well of 5wt% skim milk powder solution to the ELISA plate, block for 2h at room temperature, and wash 3 times with PBST. Gradient dilution was performed with PBS solution. The starting concentration of the neutralizing antibody MV129 was 10μg / mL, and it was diluted in 3-fold gradients in turn, with a total of 11 concentration gradients. The diluted neutralizing antibody MV129 was added to the wells respectively, and each concentration gradient was repeated for 3 wells. 50uL of 2ug / mL MV129 primary antibody (prepared with 5wt% skim milk powder solution) was added, and incubated for 1h at room temperature. Washed 3 times with PBST. Add 50uL of 8000-fold diluted Anti human-FC secondary antibody, incubate at room temperature for 45min, and wash 3 times with PBST. 100 μl TMB colorimetric solution (abcam) was added, color development was continued for 10 min, and an equal volume of TMB stop buffer (abcam) was added to terminate the color development, and the OD450 value was read. The ability of neutralizing antibodies to bind to monkeypox virus (MPXV) strain A35 antigen and vaccinia vaccine strain A33R antigen was analyzed.

[0080] The results of ELISA using monkeypox virus (MPXV) A35R antigen and vaccinia vaccine strain A33R antigen are as follows Figure 1 , Figure 1 The results showed that the neutralizing antibody MV129 had good binding activity with the monkeypox virus (MPXV) A35R antigen, but slightly weaker binding activity with the A33R antigen of the vaccinia vaccine strain.

[0081] Example 4 Determination of affinity constants of neutralizing antibody MV129 for monkeypox virus A35 antigen and vaccinia vaccine strain A33R antigen by BLI method

[0082] The MV129 antibody was coupled to the protein A probe and diluted with HBS-P buffer. The starting concentration of the antigen (monkeypox virus A35 antigen or vaccinia vaccine strain A33R) was 400nM, and the starting concentration of the MV129 antibody was 11μg / ml. The gradient was diluted 2-fold in sequence, and 7 gradients were diluted. Affinity detection was performed using the Biacore T200 (GE) instrument: 120s for each injection, 240s for dissociation, a flow rate of 30ul / min, and then regenerated with 10mM PH2.0 Glycine. The cycle was repeated until all concentration gradient injections were completed, and the control was HBS-P buffer. After the program was completed, the analysis program provided by the Biacore T200 (GE) instrument was used for fitting analysis to obtain the results of the neutralizing antibody affinity constant. The results are shown in Tables 2 and Figure 2The results showed that the neutralizing antibody MV129 had a higher affinity for the monkeypox virus A35 antigen and a slightly weaker affinity for the vaccinia vaccine strain A33R antigen.

[0083] Table 2 Binding dissociation constant KD (M) of neutralizing antibody MV129 and monkeypox virus A35 antigen affinity

[0084] MV129 Ka(1 / Ms) <![CDATA[2.20*10 4 ]]> Kdis(1 / s) <![CDATA[<1.0*10 7 ]]> KD(M) <![CDATA[2.19*10 -12 ]]>

[0085] Example 5 Detection of the Neutralizing Effect of Antibody MV129 on MPXV True Virus Strain

[0086] The Military Veterinary Research Institute was commissioned to conduct neutralizing activity testing of the neutralizing antibody MV129. The test strain was monkeypox virus (MPXV). The specific operation method was as follows:

[0087] Vero E6 cells were cultured at 5 × 10 3 The cells were inoculated at a density of 100 / well in a 96-well culture plate. The antibody (100 μg / mL) diluted three times in DMEM (Solarbio, Cat#S4990) containing 10% guinea pig serum complement (purchased from Solarbio) was added to the 100 TCID50 virus solution (equal volume). The antibody-virus mixture was incubated at 37°C for 1 hour and then added to the wells to examine the cytopathic effects 5 days after infection. The absence of cytopathic effects in the wells was considered protective. The half-maximal inhibitory concentration (IC50) was calculated using GraphPad Prism software, and the results are shown in the figure. Figure 3 .

[0088] Figure 3 The results showed that the IC50 of MV129 was 2.675 μg / mL, which showed good neutralizing activity.

[0089] In summary, the neutralizing antibody MV129 can serve as a neutralizing antibody with high neutralizing activity for monkeypox virus (MPXV), and can exert neutralizing effects at both high and low concentrations.

[0090] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A humanized neutralizing antibody MV129 or an antigen-binding fragment thereof that binds to monkeypox virus A35 protein and / or vaccinia virus A33R protein, comprising a heavy chain variable region and a light chain variable region, wherein: The amino acid sequences of CDR1H, CDR2H and CDR3H in the heavy chain variable region are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively; The amino acid sequences of CDR1L, CDR2L and CDR3L in the light chain variable region are shown in SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

2. The humanized neutralizing antibody MV129 or its antigen-binding fragment according to claim 1, characterized in that: The heavy chain variable region also includes four framework regions HFR1-4, and the HFR1-4 are arranged alternately with the CDR1H, CDR2H and CDR3H in sequence.

3. The humanized neutralizing antibody MV129 or its antigen-binding fragment according to claim 1, characterized in that: The light chain variable region also includes four framework regions LFR1-4, and the LFR1-4 are arranged alternately with the CDR1L, CDR2L and CDR3L in sequence.

4. The human neutralizing antibody MV129 or its antigen-binding fragment according to claim 1, characterized in that: The heavy chain variable region comprises the amino acid sequence shown in SEQ ID NO: 7, or an amino acid sequence having at least 97% sequence identity with the amino acid sequence shown in SEQ ID NO: 7 and having the same immunogenicity as that of the amino acid sequence; and, The light chain variable region comprises the amino acid sequence shown in SEQ ID NO: 8, or an amino acid sequence that has at least 97% sequence identity with the amino acid sequence shown in SEQ ID NO: 8 and has the same immunogenicity as that of the amino acid sequence.

5. The human neutralizing antibody MV129 or an antigen-binding fragment thereof as described in any one of claims 1 to 4, wherein the antigen-binding fragment is selected from Fab, Fab', Fab'-SH, Fv, scFv or F(ab')2.

6. A polynucleotide encoding the human neutralizing antibody MV129 or an antigen-binding fragment thereof according to any one of claims 1 to 5.

7. The polynucleotide according to claim 6, characterized in that The polynucleotide is DNA or mRNA.

8. The polynucleotide according to claim 6, characterized in that The polynucleotide comprises the nucleotide sequences shown in SEQ ID NO:9 and SEQ ID NO:

10.

9. A nucleic acid construct comprising the polynucleotide according to any one of claims 6 to 8. 10 . An expression vector comprising the nucleic acid construct according to claim 9 .

11. A transformed cell comprising the polynucleotide according to any one of claims 6 to 8, the nucleic acid construct according to claim 9 or the expression vector according to claim 10.

12. The transformed cell according to claim 11, characterized in that The expression vector is a eukaryotic expression vector.

13. A pharmaceutical composition comprising the human neutralizing antibody MV129 or its antigen-binding fragment as described in any one of claims 1 to 5, the polynucleotide as described in any one of claims 6 to 8, the nucleic acid construct as described in claim 9, the expression vector as described in claim 10 or the transformed cell as described in claim 11 or 12, and a pharmaceutically acceptable carrier and / or excipient.

14. The pharmaceutical composition according to claim 13, characterized in that The pharmaceutical composition is a nasal spray, an oral preparation or a suppository.

15. The pharmaceutical composition according to claim 13, characterized in that The pharmaceutical composition is in the form of a parenteral preparation.

16. Use of the human neutralizing antibody MV129 or its antigen-binding fragment as described in any one of claims 1 to 5, the polynucleotide as described in any one of claims 6 to 8, the nucleic acid construct as described in claim 9, the expression vector as described in claim 10, the transformed cell as described in claim 11 or 12, or the pharmaceutical composition as described in any one of claims 13 to 15 in the preparation of a drug for treating, detecting or diagnosing monkeypox virus MPXV infection.

Images