Application of oscad3 protein and its coding gene in regulating rice bacterial leaf blight resistance
By regulating the expression of the OsCAD3 protein through gene editing technology, the problem of insufficient resistance of rice varieties to bacterial blight was solved, achieving efficient regulation of rice resistance to bacterial blight and providing new disease resistance gene resources.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- JIANGXI AGRICULTURAL UNIVERSITY
- Filing Date
- 2024-05-08
- Publication Date
- 2026-04-17
AI Technical Summary
Existing rice varieties lack sufficient resistance to bacterial blight, especially due to the lack of broad-spectrum resistance genes. Furthermore, pathogen mutations lead to a rapid loss of resistance, making it difficult to effectively improve rice resistance to bacterial blight using current technologies.
By using gene editing technology to knock out or overexpress the OsCAD3 protein-coding gene, and utilizing the CRISPR/Cas9 system to achieve efficient site-specific knockout or overexpression of the OsCAD3 gene, the disease resistance of rice can be regulated.
This study aims to improve or reduce rice resistance to bacterial blight, significantly shorten or lengthen lesion length, without affecting rice yield, and provides new disease resistance gene resources.
Smart Images

Figure CN118308317B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering, specifically to the application of the OsCAD3 protein and its encoding gene in regulating resistance to bacterial blight in rice. Background Technology
[0002] Rice (Oryza sativa L.) is one of the world's most important food crops, feeding approximately half of humanity. Bacterial blight (Xanthomonas oryzae pv. oryzae, Xoo), caused by Xanthomonas oryzae, has become one of the most destructive diseases in most rice-producing areas, severely impacting rice yield and quality. In areas where bacterial blight outbreaks occur, yield reductions can reach approximately 10%, and in severe cases, 50%-60%. Enhancing disease resistance is crucial for ensuring rice yield and quality, and developing high-yielding varieties resistant to bacterial blight has always been a goal of rice breeding. Currently, 47 genes resistant to bacterial blight in rice have been reported domestically and internationally. However, among the reported bacterial blight resistance genes, some genes only express resistance after the rice reaches maturity, and only a few genes with broad-spectrum resistance have been cloned and applied; most resistance genes exhibit narrow resistance spectra. On the other hand, the widespread planting of rice varieties carrying single major resistance genes has led to strong selection pressure and rapid evolution of pathogens. Consequently, these pathogens are typically effective only against certain specific strains and races, and potentially virulent races gradually become dominant. Furthermore, the rice bacterial blight pathogen exhibits complex diversity and high variability; mutations in the pathogen can lead to the emergence of new virulent races, causing rice varieties to rapidly lose their resistance to bacterial blight. Currently, rice bacterial blight resistance resources remain relatively scarce. Therefore, for a considerable period to come, more genes resistant to rice bacterial blight, especially those that both ensure stable and even increased yields while regulating disease resistance, need to be identified and cloned.
[0003] With the rapid development of molecular biology techniques, the cloning of genes resistant to bacterial blight has provided the material basis for transgenic breeding, while the maturity of transgenic technology has provided technical support for it. Transgenic technology can efficiently and rapidly obtain homozygous rice materials carrying disease-resistant genes, greatly shortening the breeding cycle and solving a major problem for breeders and plant pathologists. Therefore, identifying new rice genes resistant to bacterial blight and improving rice's disease resistance mechanisms provides genetic resources and a theoretical foundation for rice molecular breeding, which is of great significance for solving rice disease and food security issues. Summary of the Invention
[0004] The purpose of this invention is to at least solve one of the technical problems existing in the prior art, and to provide the application of OsCAD3 protein and its encoding gene in regulating resistance to bacterial blight in rice.
[0005] This invention provides a protein OsCAD3 derived from rice (Oryzae sativa L.).
[0006] The OsCAD3 protein is any of the following proteins:
[0007] a1: A protein consisting of the amino acid sequence shown in SEQ ID NO.3;
[0008] a2: A protein derived from SEQ ID NO.3 that has the same function as the amino acid sequence shown in a1 by substitution and / or deletion and / or addition of one or more amino acid residues.
[0009] a3: A protein derived from rice that has more than 80% identity with the amino acid sequence defined by either a1 or a2 and has the function of regulating resistance to rice bacterial blight.
[0010] a4: A fusion protein obtained by attaching a tag to the end of any of the proteins defined in a1-a3.
[0011] This invention also provides the application of substances that regulate the expression of the OsCAD3 protein-encoding gene or the target sequences of the following sgRNAs as knockout targets in any of the following situations:
[0012] (1) Improve the disease resistance of rice;
[0013] (2) Genetic breeding to improve rice disease resistance;
[0014] (3) Improve the disease resistance of rice germplasm resources.
[0015] Optionally, according to the above applications, the relevant biomaterial is any one of the following:
[0016] c1: A nucleic acid molecule encoding the OsCAD3 protein;
[0017] c2: An expression cassette containing the nucleic acid molecule described in c1;
[0018] c3: A recombinant vector containing the nucleic acid molecule described in c1, or a recombinant vector containing the expression cassette described in c2;
[0019] c4: Recombinant microorganisms containing the nucleic acid molecules described in c1, or recombinant microorganisms containing the expression cassette described in c2, or recombinant microorganisms containing the recombinant vector described in c3;
[0020] c5: A transgenic rice cell line containing the nucleic acid molecule described in c1, or a transgenic rice cell line containing the expression cassette described in c2;
[0021] c6: Transgenic rice tissue containing the nucleic acid molecules described in c1, or transgenic rice tissue containing the expression cassette described in c2;
[0022] c7: Transgenic rice organs containing the nucleic acid molecules described in c1, or transgenic rice organs containing the expression cassette described in c2;
[0023] Alternatively, according to the above applications,
[0024] The nucleic acid molecule mentioned in c1 is any of the following DNA molecules:
[0025] d1: The nucleotide sequence is the DNA molecule shown in SEQ ID NO.1;
[0026] d2: The coding region sequence is the DNA molecule shown in SEQ ID NO.2 of the sequence listing;
[0027] d3: DNA molecules derived from rice that have more than 80% identity with the nucleotide sequence defined by d1 or d2 and encode the aforementioned OsCAD3 protein;
[0028] d4: A DNA molecule that hybridizes to the nucleotide sequence defined by d1 or d2 under stringent conditions and encodes the aforementioned OsCAD3 protein.
[0029] Optionally, the recombinant vector described in c3 is a plasmid having the DNA molecule shown in SEQ ID No. 1 or SEQ ID No. 2, such as the gene editing vector pYL-HU-OsCAD3 and the gene overexpression vector pBWA(V)BU-OsCAD3 prepared in the following examples.
[0030] Optionally, according to the above application, the substance regulating the expression of the OsCAD3-Crispr protein-encoding gene is a substance that knocks out the expression of the OsCAD3 gene; the substance is any one of the following:
[0031] e1: A nucleic acid molecule that inhibits or reduces the expression of the OsCAD3 protein-encoding gene;
[0032] e2: An expression cassette containing the nucleic acid molecule described in e1;
[0033] e3: A recombinant vector containing the nucleic acid molecule described in e1, or a recombinant vector containing the expression cassette described in e2;
[0034] e4: Recombinant microorganisms containing the nucleic acid molecules described in e1, or recombinant microorganisms containing the expression cassette described in e2, or recombinant microorganisms containing the recombinant vector described in e3;
[0035] e5: A transgenic rice cell line containing the nucleic acid molecule described in e1, or a transgenic rice cell line containing the expression cassette described in e2;
[0036] e6: Transgenic rice tissue containing the nucleic acid molecules described in e1, or transgenic rice tissue containing the expression cassette described in e2;
[0037] e7: A transgenic rice organ containing the nucleic acid molecule described in e1, or a transgenic rice organ containing the expression cassette described in e2.
[0038] Optionally, according to the above application, the nucleic acid molecule of e1 is the sgRNA of the rice OsCAD3 gene edited using CRISPR / Cas9 or the gene encoding the sgRNA thereof.
[0039] The aforementioned sgRNA can work in conjunction with CRISPR / Cas9 gene editing tools to achieve efficient site-specific knockout of the rice OsCAD3 gene, thereby disrupting the biological function of the rice OsCAD3 gene.
[0040] In this article, identity refers to the similarity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage.
[0041] Optionally, according to the above application, the disease resistance refers to the resistance of rice to bacterial blight.
[0042] The above-mentioned regulation of rice disease resistance can improve rice disease resistance, for example, by shortening the length of lesions caused by rice bacterial wilt.
[0043] The present invention also provides a method for cultivating transgenic rice, comprising the following steps: knocking out the nucleic acid molecule encoding the OsCAD3 protein in the target rice to obtain transgenic rice with higher resistance to bacterial blight than the target rice.
[0044] The present invention also provides a method for creating rice with enhanced resistance to bacterial blight, wherein the method is P1, P2, P3 or P4.
[0045] P1 includes inhibiting or reducing the expression of the gene encoding the OsCAD3 protein in rice, resulting in rice with improved resistance to bacterial blight.
[0046] Inhibiting or reducing the expression of the gene encoding the OsCAD3 protein can specifically mean inhibiting or reducing the expression of the gene encoding any exon of the OsCAD3 protein.
[0047] P1 can be the introduction of a substance that inhibits or reduces the expression of the OsCAD3 protein-coding gene into rice, resulting in rice with enhanced resistance to bacterial blight. The substance that inhibits or reduces the expression of the OsCAD3 protein-coding gene can be any of the substances described above that regulate the expression of the OsCAD3 protein-coding gene.
[0048] As one embodiment of the present invention, P1 includes introducing a CRISPR / Cas9 system containing sgRNA that expresses a gene targeting OsCAD3 into rice to obtain rice with enhanced resistance to bacterial blight.
[0049] P2 involves replacing “GCGATAAAGATTCTGTTTCTGTGG” in OsCAD3 of the rice genomic DNA with “GCGATAAAGATTCTGTTCTGTGG”, and replacing “CCGACGCGTTCGTCGTGAGCAGC” in OsCAD3 of the rice genomic DNA with “CCGACGACGTTCGTCGTGAGCAGC”, resulting in rice with improved resistance to bacterial blight.
[0050] P3 involves replacing “CCGACGCGTTCGTCGTGAGCAGC” in OsCAD3 of the rice genome DNA with “CCGACGACGTTCGTCGTGAGCAGC” to obtain rice with improved resistance to bacterial blight.
[0051] P4 involves replacing “GCGATAAAGATTCTGTTCTGTGGAATCTG” in OsCAD3 of the rice genome DNA with “GCGATAAAGATTCTG”, resulting in rice with improved resistance to bacterial blight.
[0052] The replacement can be a homozygous replacement, meaning that the same replacement occurs in homologous chromosomes.
[0053] The rice mentioned above can be any of the various subspecies of rice, such as japonica rice and indica rice.
[0054] This invention also provides the application of substances that regulate the overexpression of OsCAD3 protein-encoding genes in any of the following:
[0055] (1) Reduces the disease resistance of rice;
[0056] (2) Genetic breeding to reduce rice disease resistance;
[0057] (3) Improve the disease resistance of rice germplasm resources;
[0058] The present invention is used to construct a plant expression vector for overexpressing the OsCAD3 gene and to enhance the expression of the OsCAD3 gene. The DNA sequence of the OsCAD3 gene is shown in SEQ ID No. 1, and the amino acid sequence is shown in SEQ ID No. 3.
[0059] In the method described above, the OsCAD3 gene can be introduced into rice via a recombinant expression vector. The recombinant expression vector can be transformed into rice cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation.
[0060] The recombinant expression vector can specifically be a recombinant plasmid obtained by inserting the double-stranded DNA molecule shown in SEQ ID No. 2 of the sequence listing into the vector pBWA(V)BU.
[0061] This invention utilizes a coding region fragment of the OsCAD3 gene from the rice variety Zhonghua 11 as the applied gene. This gene is forward-transferred into rice to increase the expression level of the OsCAD3 gene. The transgenic rice plants exhibit weakened resistance to bacterial blight.
[0062] The present invention also protects a method for cultivating transgenic rice, comprising the following steps: increasing the expression of the OsCAD3 gene in the target rice to obtain transgenic rice with reduced resistance to bacterial blight.
[0063] The above-mentioned regulation of rice disease resistance can reduce rice disease resistance, for example, by increasing the length of lesions caused by rice bacterial wilt.
[0064] For example, the rice may be japonica rice Zhonghua 11.
[0065] The bacterial blight is caused by the bacterial blight pathogen.
[0066] The bacterial blight is caused by Xanthomonas rice pathogenic species (Xoo), more specifically physiological race PXO99.
[0067] The OsCAD3 protein, its biological materials, the substances that regulate the expression of the OsCAD3 protein encoding gene, or the target sequence of the sgRNA mentioned above are also within the scope of protection of this invention.
[0068] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.
[0069] In this document, the introduction can be described as transforming a vector carrying the DNA molecule of the present invention into a host bacterium using any known transformation method, such as chemical transformation or electroporation. The introduced DNA molecule can be a single copy or multiple copies. The introduction can be the integration of a foreign gene into the host chromosome or the expression of a plasmid outside the chromosome.
[0070] The beneficial effects of this invention are as follows: This invention discovers that the rice OsCAD3 gene has a negative regulatory function on rice resistance to bacterial blight. By editing the gene to disrupt the biological function of the OsCAD3 gene, the resistance of rice to bacterial blight is improved, manifested as a shortening of lesion length, without affecting rice yield. Overexpression of the OsCAD3 gene in rice can significantly reduce rice resistance to bacterial blight without affecting yield. This invention can be used in the fields of rice germplasm resource improvement and genetic breeding, and is of great significance for breeding new rice varieties resistant to bacterial blight, with broad market application prospects. Attached Figure Description
[0071] Figure 1 This is a sequence alignment of the OsCAD3 gene-edited T1 generation homozygous mutant lines Crispr-1, Crispr-2, and Crispr-3 with the wild-type Zhonghua 11 from step 1 of Embodiment 1 of the present invention. The Crispr-1 line has an insertion of a "T" in target 1 and an insertion of an "A" in target 2, both marked with a "+" above their respective bases. The Crispr-2 line has an insertion of an "A" in target 2, marked with a "+" above its respective base. The Crispr-3 line has a deletion of the fragment "TTCTGTGGAATCTG" in target 1, marked with a "-" above its respective base.
[0072] Figure 2 The images (A) and (B) show the leaf lesion phenotype of the OsCAD3 gene knockout lineage in step 2 of Example 1 of this invention, specifically the statistical results of leaf lesion length. The scale bar indicates a 1cm interval. Zhonghua 11 is the wild-type control. Crispr-1, Crispr-2, and Crispr-3 represent three homozygous OsCAD3 gene knockout lines. Data represent the mean ± standard deviation of three biological replicates. An asterisk indicates a statistically significant difference between Zhonghua 11 and Crispr-1, Crispr-2, and Crispr-3, respectively (**P<0.005, ***P<0.0005; Student's t-test).
[0073] Figure 3 This is the PCR positive identification result of the transgenic plants overexpressing OsCAD3 in step 3 of Example 2 of the present invention. Lanes 1-11 correspond to T0 generation plants of 11 different lines, M is DNA Maker (DL2000 marker), + is plasmid positive control, - is Zhonghua 11 negative control, and O is water control.
[0074] Figure 4In step 3 of Example 2 of this invention, qRT-PCR was used to detect the relative expression level of the OsCAD3 gene in transgenic plants overexpressing the OsCAD3 gene. Con was the empty vector control, and OE-1 to OE-6 were positive transgenic plants from six lines overexpressing the OsCAD3 gene, with three biological replicates taken from each line.
[0075] Figure 5 The images (A) and (B) show the leaf lesion phenotype of the OsCAD3 gene overexpressing line in step 4 of Example 2 of this invention, during the identification of bacterial blight resistance. The scale bar is 1 cm. Con represents the empty control, and OE-1, OE-2, and OE-3 represent three independent positive transgenic lines. Data represent the mean ± standard deviation of three biological replicates. An asterisk indicates that Con differed significantly from OE-1, OE-2, and OE-3 (**P<0.005; Student's t-test)). Detailed Implementation
[0076] The following specific embodiments further describe the present invention and more fully explain its implementation. The examples listed below are merely illustrative and not intended to limit the scope of protection of the present invention.
[0077] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. Zhonghua 11 rice is a japonica rice variety, denoted by WT. The rice bacterial blight pathogen used in the examples is the physiological race PXO99 of *Bacillus pilosa*.
[0078] The OsCAD3 protein derived from rice is shown in SEQ ID NO.3; the open reading frame encoding the OsCAD3 protein is shown in SEQ ID NO.2; and the genomic sequence containing the OsCAD3 gene is shown in SEQ ID NO.1.
[0079] Example 1: Rice OsCAD3 gene editing and knockout improves resistance to bacterial blight while ensuring stable rice yield.
[0080] 1. Construction of rice OsCAD3 gene editing vector and acquisition of transgenic rice
[0081] (1) A recombinant vector for editing the OsCAD3 gene using the CRISPR / Cas9 method was constructed, with target sequences 1 and 2. This vector was used to edit the OsCAD3 gene and generate new alleles of the OsCAD3 gene.
[0082] Target sequence 1: GCGATAAAGATTCTGTTCTGTGG (positions 3810-3832 of SEQ ID NO.1 in the sequence listing); the sgRNA that targets target sequence 1 in the CRISPR / Cas9 method is denoted as sgRNA1;
[0083] Target sequence 2: CCGACGCGTTCGTCGTGAGCAGC (positions 4649-4671 of SEQ ID NO.1 in the sequence listing); the sgRNA that targets target sequence 2 in the CRISPR / Cas9 method is denoted as sgRNA2.
[0084] (2) The sequence was fused with the OsU3-gRNA expression cassette. The fused fragment was then ligated with the pYL-HU vector backbone using BsaI enzyme to construct the OsCAD3 gene knockout vector pYL-HU-OsCAD3. This plasmid was subsequently transformed into Agrobacterium EHA105 for transgenic processing. The gene knockout vector construction and transgenic process were handled by Wuhan Boyuan Biotechnology Co., Ltd. (http: / / www.biorun.net / ), with Zhonghua 11 as the recipient material. PCR sequencing of the T0 and T1 generation transgenic plants was performed using target sequencing primers. The primers used for target 1 and target 2 sequencing are as follows:
[0085] OsCAD3-F: 5'-GCTGCATTACAATTATGCATG-3';
[0086] OsCAD3-R: 5'-CGTGTTGATGACGCCGTCCATG-3'.
[0087] The PCR procedure is as follows: The PCR reaction system (25 μL) consists of: 22 μL of Gold Mix Ver.2 (Tsingke Biotechnology Co., Ltd. (https: / / www.tsingke.com.cn / )), 1 μL of upstream primer OsCAD3-F (10 μM), 1 μL of downstream primer OsCAD3-R (10 μM), and 1 μL of DNA template. The PCR reaction program is as follows: 98℃ for 2 min; 98℃ for 10 s, 55℃ for 15 s, 72℃ for 20 s; 35 cycles; 72℃ for 5 min; 4℃ for 10 min.
[0088] (3) The obtained PCR amplification products were subjected to 1% agarose gel electrophoresis, and the PCR amplification products were sequenced. The sequencing results of the knockout plants were compared with the reference genome of Zhonghua 11, such as... Figure 1As shown, the T1 generation knockout lines Crispr-1, Crispr-2, and Crispr-3 are homozygous mutations, meaning that the mutations on the two homologous chromosomes are identical. The knockout lines Crispr were obtained by editing the coding regions of the second and / or third exons of the OsCAD3 gene in the recipient variety Hua 11, while retaining other coding regions. All of these are new OsCAD3 alleles created through genome editing.
[0089] The Crispr-1 strain inserts a "T" in the target 1 sequence and an "A" in the target 2 sequence, both marked with a "+" above their respective bases.
[0090] Its target 1 sequence changed from GCGATAAAGATTCTGTTCTGTGG to GCGATAAAGATTCTG T TTCTGTGG;
[0091] Its target 2 sequence changed from CCGACGCGTTCGTCGTGAGCAGC to CCGACG A CGTTCGTCGTGAGCAGC.
[0092] The Crispr-2 strain inserts an "A" into the target 2 sequence, with a corresponding "+" mark above its base.
[0093] Its target 2 sequence changed from CCGACGCGTTCGTCGTGAGCAGC to CCGACG A CGTTCGTCGTGAGCAGC.
[0094] The Crispr-3 strain has a deletion of the fragment "TTCTGTGGAATCTG" in the target 1 sequence, which is marked with a "-" above its bases.
[0095] The target 1 and its surrounding sequence changed from GCGATAAAGATTCTGTTCTGTGGAATCTG to GCGATAAAGATTCTG.
[0096] 2. Knockout of the OsCAD3 gene in rice enhances resistance to bacterial blight.
[0097] The plants to be tested were: Zhonghua 11 rice (wild type), and T2 generation gene-edited homozygous plants of the Crispr / Cas9 transgenic lines Crispr-1, Crispr-2, and Crispr-3.
[0098] (1) Soak the seeds of the plant to be tested in water (8 hours) and dry them in water (2 hours) three times. After the seeds have fully absorbed water, place them on a culture tray and germinate them in a constant temperature incubator at 37℃ until they show white and germinate. During this period, cover them with a damp towel to maintain humidity.
[0099] (2) Spread the germinated seeds evenly in the seedbed, and gently pat and spread them with your hands so that the seeds are properly buried in the moist soil. They should not be too deep or too invisible.
[0100] (3) After 3-4 weeks of seedling cultivation, transplant the plants to the field at the three-leaf stage, planting them individually with 25 plants per line. Perform routine water and fertilizer management.
[0101] (4) During the peak tillering stage of rice plants in step 3, artificially inoculate rice plants with the physiological race PXO99 of bacterial blight using the leaf-cutting method (dipping scissors in the bacterial solution and cutting off 2-3 cm of the leaf tip, cutting off one leaf after each dip). Inoculate 5 leaves per plant (bacterial solution concentration is 1×10⁻⁶). 9 (cfu / mL) to ensure that the inoculation amount is equal for each leaf.
[0102] (5) Twelve days after inoculation with rice bacterial blight pathogen, observe the lesion damage phenotype of the plant leaves and count the lesion length. Measure the lesion length of 3 inoculated leaves of each plant and calculate the average value.
[0103] Statistical results are as follows Figure 2 As shown, in the knockout group, the average lesion length of Zhonghua 11 (wild type) was 10.5 cm, while the average lesion lengths of OsCAD3 knockout transgenic plants Crispr-1, Crispr-2, and Crispr-3 were 8.2 cm, 7.2 cm, and 6.4 cm, respectively, all significantly shorter than the lesion length of Zhonghua 11. This indicates that knocking out the OsCAD3 gene can improve the resistance of rice to bacterial blight.
[0104] 3. Knockout of the OsCAD3 gene in rice does not affect rice yield.
[0105] Agronomic traits of rice OsCAD3 gene knockout transgenic plants at maturity were analyzed. Three representative knockout transgenic lines were selected and compared with the ZH11 control. Each line had three biological replicates for evaluation. The results are shown in Table 1. Compared with the control group Zhonghua 11, there were no significant differences in plant height, tiller number, panicle length, total number of grains, number of grains per panicle, number of filled grains, and thousand-grain weight among the three OsCAD3 gene knockout lines (Crispr-1, Crispr-2, and Crispr-3). This indicates that OsCAD3 gene knockout in rice does not affect important agronomic traits of rice, including yield traits.
[0106] Table 1 shows the agronomic phenotypic characteristics of the Zhonghua 11 control and the rice OsCAD3 gene knockout lines.
[0107]
[0108]
[0109] Note: Data were obtained from the Zhonghua 11 control and three OsCAD3 gene knockout lines (mean ± standard deviation from 3 biological replicates). Statistical analysis was performed using GraphPad Prism 5 (v5.01) software. The three OsCAD3 gene knockout lines (Crispr-1, Crispr-2, and Crispr-3) in the experimental group were compared with the control group Zhonghua 11 for agronomic traits (plant height, number of tillers, panicle length, total number of grains, number of grains per panicle, number of filled grains, and 1000-grain weight). No significant differences were found among the groups.
[0110] Example 2: Overexpression of the rice OsCAD3 gene reduces resistance to rice bacterial blight while ensuring stable rice yield.
[0111] 1. Construction of OsCAD3 gene overexpression vector
[0112] (1) Total RNA was extracted from rice Zhonghua 11 and cDNA was obtained by reverse transcription.
[0113] (2) Using the cDNA obtained in step 1 as a template, two primers, OsCAD3-OE-F and OsCAD3-OE-R, were designed to amplify the full-length CDS sequence of the target gene OsCAD3 by PCR. The PCR reaction system consisted of: 25 μL of 2×Biorun Pfu PCR Mix, 2 μL of cDNA template, 1 μL of forward primer, 1 μL of reverse primer, and 21 μL of nuclease-free water. The PCR reaction program was as follows: 94℃ for 5 min; 94℃ for 30 s, 50℃ for 45 s, 72℃ for 60 s, for 30 cycles; 72℃ for 10 min; 16℃ for 30 min.
[0114] OsCAD3-OE-F: cagtCGTCTCacaac ATGGCTCCCACGGCGGCGTC
[0115] OsCAD3-OE-R: cgatCGTCTCactcg GCGGCGGCGGCGTGGA
[0116] In the above OsCAD3 gene-specific primers, the underlined part is the BsmBI / Esp3I endonuclease adapter sequence used for enzyme digestion and ligation, where the uppercase letters are the BsmBI / Esp3I endonuclease recognition sites; the non-underlined part of the primer is the OsCAD3 coding region-specific sequence.
[0117] (3) The pBWA(V)BU vector (purchased from Wuhan Boyuan Biotechnology Co., Ltd. (http: / / www.biorun.net / )) with a 3xflag-4xmyc tag at the 3' end of the gene cloning fusion site was digested with restriction endonuclease BsmBI / Esp3I, and the vector backbone of about 9857bp was recovered.
[0118] (4) The amplification product recovered in step 2 and the vector backbone recovered in step 3 were ligated seamlessly to obtain the recombinant plasmid pBWA(V)BU-OsCAD3, which was then transformed into E. coli DH10B. The 1438 bp gene fragment in the recombinant vector was sequenced and found to be completely identical to the corresponding sequence of Zhonghua 11 (SEQ ID NO.2).
[0119] 2. Obtaining recombinant Agrobacterium and preparing gene-overexpressing plants
[0120] The recombinant plasmid pBWA(V)BU-OsCAD3 was introduced into Agrobacterium EHA105 to obtain a recombinant Agrobacterium containing the recombinant plasmid pBWA(V)BU-OsCAD3, which was named Agrobacterium EHA105-pBWA(V)BU-OsCAD3 and used for transgenic purposes.
[0121] The empty vector pBWA(V)BU was introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium containing the vector pBWA(V)BU, named Agrobacterium EHA105-pBWA(V)BU, which served as an empty vector control for transgenic applications. The transgenic process was carried out by Wuhan Boyuan Biotechnology Co., Ltd. (http: / / www.biorun.net / ), with Zhonghua 11 as the recipient material.
[0122] 3. Identification of transgenic rice with OsCAD3 overexpression
[0123] (1) After obtaining transgenic T0 generation plants, positive identification was performed. Genomic DNA of transgenic plants was extracted and glyphosate screening gene Bar was amplified by PCR using primers Bar178F: 5'-AGAAACCCACGTCATGCCAGT-3' and Bar178R: 5'-ACGCTCTACACCCACCTGCT-3'. The results showed that plants transformed with pBWA(V)BU-OsCAD3 and pBWA(V)BU were all transgenic positive.
[0124] PCR identification results of some plants are as follows Figure 2 As shown. Figure 2In the diagram, M represents the DNA Marker, + represents the positive control, - represents the negative control, and O represents the water control. Lanes 1-10 correspond to 10 different T0 generation lines. The results showed that all 10 lines amplified specific bands consistent with the glyphosate selection gene on the plasmid vector, indicating that the T-DNA carrying the Bar marker gene had been inserted and integrated into the recipient genome. All 10 lines were positive overexpression transgenic lines. T0 generation plants were self-crossed to obtain T1 generation plants. T1 generation positive plants were self-crossed to obtain T2 generation positive plants, which were used for the following experiments.
[0125] (2) Total RNA was extracted from the T2 generation of positive plants of six OsCAD3 overexpressing transgenic lines (named OE-1, OE-2, OE-3, OE-4, OE-5, and OE-6) from the positive overexpressing transgenic lines in step 1, and reverse transcription was performed. The relative changes in the expression level of the OsCAD3 gene in each transgenic line were analyzed by qRT-PCR.
[0126] Primers used: F: 5'-AATCTGCCACTCTGACCTGC-3' and R: 5'-AGTGGTTCTCGAAGCCATTGT-3'. Results are as follows... Figure 3 and 4 As shown, compared with the empty vector control, the OsCAD3 gene was significantly upregulated in the six overexpressing transgenic lines.
[0127] 4. Overexpression of the rice OsCAD3 gene reduces resistance to rice bacterial blight.
[0128] The plants to be tested were: T2 generation positive plants of empty vector, and T2 generation positive plants of OsCAD3 overexpressing transgenic lines OE-1, OE-2, and OE-3.
[0129] The methods for cultivating, planting, and inoculating rice plants are the same as step 2 in Example 1.
[0130] Statistical results are as follows Figure 5 As shown, in the overexpression group, the average lesion length of rice transgenic empty vector rice was 9.9 cm, while the average lesion lengths of OsCAD3 overexpression transgenic positive plants OE-1, OE-2, and OE-3 were 12.8 cm, 12.6 cm, and 12.3 cm, respectively, all significantly longer than the lesion length of the empty vector control. This indicates that OsCAD3 gene overexpression can reduce the resistance of rice to bacterial blight.
[0131] 5. Overexpression of the rice OsCAD3 gene does not affect rice yield.
[0132] Agronomic traits at maturity were analyzed in transgenic rice plants overexpressing the OsCAD3 gene. Three representative overexpressing transgenic lines and empty vector transgenic lines were selected, with three biological replicates for each line. The results are shown in Table 2. Compared with the empty vector transgenic line (Con), there were no significant differences in plant height, tiller number, panicle length, total number of grains, number of grains per panicle, number of filled grains, and thousand-grain weight among the three OsCAD3 gene overexpressing lines (OE-1, OE-2, and OE-3). This indicates that OsCAD3 gene overexpression does not affect important agronomic traits of rice, including yield traits.
[0133] Table 2. Agronomic phenotypic characteristics of empty vector-transformed lines (Con) and rice OsCAD3 gene overexpression lines.
[0134]
[0135] Note: Data were obtained from empty vector transgenic lines (Con) and three OsCAD3 gene overexpression lines (mean ± standard deviation from 3 biological replicates). Statistical analysis was performed using GraphPad Prism 5 (v5.01) software. Arithmetic traits (plant height, tiller number, panicle length, total number of grains, number of grains per panicle, number of filled grains, and thousand-grain weight) of the experimental OsCAD3 gene overexpression lines OE-1, OE-2, and OE-3 and the control empty vector transgenic line Con were compared, and no significant differences were found among the groups.
[0136] The above results indicate that the OsCAD3 gene can negatively regulate rice resistance to bacterial blight.
[0137] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. The application of OsCAD3, a gene related to bacterial blight resistance, in regulating resistance to bacterial blight in rice, characterized in that... Deletion of the OsCAD3 gene, which is related to resistance to bacterial blight, significantly improves rice resistance to bacterial blight. The amino acid sequence encoded by the bacterial blight resistance-related gene OsCAD3 is the protein shown in SEQ ID NO.
3.
2. The application of an editing vector for the bacterial blight resistance-related gene OsCAD3 as described in claim 1 in improving resistance to bacterial blight in rice, characterized in that, The editing vector is used to knock out the OsCAD3 gene.
3. The application of a host bacterium containing an editing vector of the bacterial blight resistance-related gene OsCAD3 as described in claim 1 in rice bacterial blight resistance breeding, characterized in that, The editing vector is used to knock out the OsCAD3 gene.
4. The application as described in claim 3, characterized in that: The breeding method includes reducing the expression of the gene encoding the OsCAD3 protein in rice or reducing the content or activity of the OsCAD3 protein.
5. A method for creating rice with enhanced resistance to bacterial blight, characterized by: The method is P2, P3, or P4. P2 involves replacing "GCGATAAAGATTCTGTTTCTGTGG" in the OsCAD3 gene of rice genomic DNA with "GCGATAAAGATTCTGTTCTGTGG" and replacing "CCGACGCGTTCGTCGTGAGCAGC" in the OsCAD3 gene of rice genomic DNA with "CCGACGACGTTCGTCGTGAGCAGC", resulting in rice with improved resistance to bacterial blight; P3 involves replacing "CCGACGCGTTCGTCGTGAGCAGC" in the OsCAD3 gene of the rice genome DNA with "CCGACGACGTTCGTCGTGAGCAGC", resulting in rice with improved resistance to bacterial blight. P4 involves replacing "GCGATAAAGATTCTGTTCTGTGGAATCTG" in the OsCAD3 gene of the rice genome DNA with "GCGATAAAGATTCTG", resulting in rice with improved resistance to bacterial blight. The nucleotide sequence of the OsCAD3 gene is shown in SEQ ID NO.1 or SEQ ID NO.
2.
6. The application of an editing vector for the bacterial blight resistance-related gene OsCAD3 as described in claim 1 in rice bacterial blight resistance breeding, characterized in that: The editing vector is used to reduce the expression of the OsCAD3 gene.
Citation Information
Patent Citations
Rice OSCAD1 mutant gene and application thereof in rice breeding
CN118028312A