Adeno-associated virus mutant and its application

Abstract

The present invention belongs to the field of biomedicine technology, and discloses an adeno-associated virus mutant and its application. The present invention pioneered the use of a brain-like chip method in vitro to simulate the blood-brain barrier in vivo, and efficiently screened adeno-associated virus mutants that can penetrate the blood-brain barrier and infect nerve cells. The amino acid sequence of the AAV capsid protein mutant of the present invention is shown in SEQ ID No. 3 or 4. The present invention also provides a recombinant adeno-associated virus comprising the AAV capsid protein mutant. The recombinant adeno-associated virus vector constructed by the AAV capsid protein mutant of the present invention has high efficiency in penetrating the blood-brain barrier and good infection effect, providing a better gene therapy vector tool for nervous system diseases for a large number of patients with the disease, and has great clinical value and commercial application scenarios.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an adeno-associated virus mutant and application thereof. Background Art

[0002] Adeno-associated virus (AAV) is a small non-enveloped virus that encapsulates a linear single-stranded DNA genome. It belongs to the genus Dependoviridae of the family Parvoviridae and requires a helper virus (usually adenovirus) to participate in replication. The AAV genome is a single-stranded DNA fragment contained in a non-enveloped viral capsid and can be divided into three functional regions: two open reading frames (Rep gene, Cap gene) and inverted terminal repeats (ITR). Recombinant adeno-associated virus vector (rAAV) is derived from non-pathogenic wild-type adeno-associated virus. Due to its advantages such as wide host range, non-pathogenicity, low immunogenicity, long-term stable expression of foreign genes, good diffusion performance and stable physical properties, it is widely used as a gene transfer vector in gene therapy and vaccine research. In medical research, rAAV has been used in the study of gene therapy for a variety of diseases (including in vivo and in vitro experiments), such as gene function research, construction of disease models, and preparation of gene knockout mice.

[0003] There are many types of neurological diseases with complex phenotypes. Diseases affecting the central nervous system (CNS) have a serious impact on the quality of life and physical and mental health of patients. The traditional drug therapies currently used are not effective and have a high risk of off-target effects. In recent years, with the continuous development of molecular biology technologies such as AAV in vivo delivery vectors, gene editing technology, and RNA interference, gene therapy may provide a targeted long-term solution for monogenic and idiopathic diseases of the central nervous system. AAV is currently the main vector used for in vivo delivery of transgenes to the CNS. It has the ability of efficient transduction, highly engineered cell targeting, low toxicity, and the potential to overcome physical barriers. These advantages have brought exciting prospects and many clinical successes. Among them, genetic diseases of the nervous system represented by spinal muscular atrophy (SMA) have made breakthrough progress in gene therapy in recent years. For example, Zolgensma is a gene therapy based on AAV9 vectors launched in the United States in 2019 for the treatment of spinal muscular atrophy caused by allelic mutations in the survival motor neuron gene 1 (SMN1) in children under 2 years old. However, the one-time treatment cost is as high as more than 2 million US dollars, which is related to its high intravenous injection dose, reaching 1.1E14 vg / kg. The disadvantages of using large doses are: on the one hand, it is difficult to control the purity of process development and the production cost is high; on the other hand, its specificity is poor, and liver toxicity is particularly obvious when injected with high doses throughout the body, which increases the risk of use.

[0004] Although AAV is one of the safest gene therapy vectors currently and has been widely used in the field of gene therapy. However, it is hindered by specificity issues, especially the treatment method of entering the nervous system through the blood-brain barrier by systemic injection, which requires higher doses, and the costs and expenses have risen sharply, making it difficult for patients to afford. In addition, low specificity and high doses also make the potential toxic and side effects of drugs more obvious. Given that successful gene therapy requires the effective expression of therapeutic genes in target cells and minimizes side effects, the efficiency and targeting of delivery vehicles are extremely critical. Therefore, the development of AAV that can cross the blood-brain barrier, has better targeting of the nervous system, and has lower dose requirements and costs is of great significance to the clinical gene therapy of neurological diseases. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an adeno-associated virus mutant that can cross the blood-brain barrier and target brain nerve cells and its application. The adeno-associated virus mutant has better targeting and lower dosage requirements.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides a heterologous peptide that can cross the blood-brain barrier and has brain nerve cell targeting, and its amino acid sequence is shown as SEQ ID No. 1 or 2.

[0008] In a second aspect, the present invention provides a nucleic acid encoding the heterologous peptide, the nucleotide sequence of which is shown as SEQ ID No. 5 or 6.

[0009] In a third aspect, the present invention provides an AAV capsid protein mutant, comprising the heterologous peptide.

[0010] As a preferred embodiment of the AAV capsid protein mutant of the present invention, the AAV capsid protein mutant is obtained by inserting or replacing 5 to 20 amino acids of the AAV capsid protein with the heterologous peptide.

[0011] As a preferred embodiment of the AAV capsid protein mutant of the present invention, the insertion site of the heterologous peptide is located between amino acids 586 and 589 of AAV capsid protein VP1.

[0012] Furthermore, the insertion site of the heterologous peptide is between amino acids 588 and 589 of AAV9 VP1.

[0013] As a preferred embodiment of the AAV capsid protein mutant of the present invention, its amino acid sequence is shown in SEQ ID No. 3 or 4.

[0014] The present invention uses AAV9 as the parent skeleton and utilizes a directed screening method to screen out rAAV mutations with mutant capsid proteins containing two heterologous peptides after several rounds of screening and enrichment of brain-like chips. The AAV capsid protein mutant of the present invention includes a heterologous peptide with an amino acid sequence as described in SEQ ID No. 1 or 2. The insertion site of the heterologous peptide is located between amino acids 588 and 589 of AAV capsid protein VP1. The nucleotide sequence encoding the heterologous peptide is as shown in SEQ ID No. 5 or 6.

[0015] The mutant of the present invention has the ability to cross the blood-brain barrier and the targeting of nerve cells far exceeding the parent AAV9, and is a serotype mutant with excellent performance. Among them, the blood-brain barrier crossing amount of AAV-M6 is about 5 times that of AAV-PHP.eB. The crossing amount of AAV-M8 is about 3 times that of AAV-PHP.eB. At the same time, AAV-M6 that crosses the blood-brain barrier can efficiently and specifically infect nerve cells.

[0016] In a fourth aspect, the present invention provides a nucleic acid encoding an AAV capsid protein mutant, whose nucleotide sequence is shown in SEQ ID No. 7 or 8.

[0017] In a fifth aspect, the present invention provides a recombinant adeno-associated virus, comprising the AAV capsid protein mutant.

[0018] The recombinant adeno-associated virus vector constructed by the AAV capsid protein mutant of the present invention can cross the blood-brain barrier, has a strong nerve cell infection effect, is safer, and has a wide range of applications.

[0019] As a preferred embodiment of the recombinant adeno-associated virus of the present invention, it also includes a heterologous target gene.

[0020] As a preferred embodiment of the recombinant adeno-associated virus of the present invention, the heterologous target gene encodes any gene product of interfering RNA, aptamer, endonuclease, and guide RNA.

[0021] In a sixth aspect, the present invention uses the heterologous peptide, the AAV capsid protein mutant, and the recombinant adeno-associated virus in the preparation of a drug for delivering a gene product to cells or tissues of a subject.

[0022] As a preferred embodiment of the application of the present invention, the cells are nerve cells.

[0023] In a seventh aspect, the present invention uses the heterologous peptide, the AAV capsid protein mutant, and the recombinant adeno-associated virus in the preparation of a delivery tool that crosses the blood-brain barrier in vivo and has brain nerve cell targeting.

[0024] In an eighth aspect, the present invention uses the heterologous peptide, the AAV capsid protein mutant, and the recombinant adeno-associated virus as inactive ingredients in the preparation of a delivery device for treating or preventing nervous system diseases.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The present invention pioneered the combination of brain-like chip technology and AAV screening technology to obtain some AAV virus mutants that can cross the blood-brain barrier and infect nerve cells. A batch of potential brain-targeted AAVs can be obtained quickly, on a large scale, and at a lower cost, and the use of human cells can avoid the application risks brought by species differences to a certain extent. Using brain-like chips and directional screening methods, after three rounds of gradient screening with gradually reduced AAV virus input titers and gradually shortened incubation times, two serotype mutants targeting the nervous system were screened. Among them, the blood-brain barrier crossing amount of mutant AAV-M6 is about 5 times that of AAV-PHP.eB. The crossing amount of mutant AAV-M8 is about 3 times that of AAV-PHP.eB. The recombinant adeno-associated virus vector constructed by the AAV capsid protein mutant has a stronger ability to cross the blood-brain barrier and infect nerve cells, better safety, and a wide range of applications, providing a better gene therapy vector tool for nervous system diseases for a large number of patients with diseases, with great clinical value and commercial application scenarios. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The construction of in vitro BBB bionic chip model, the construction of AAV library and three rounds of AAV screening based on BBB bionic chip; Figure 1 In the figure, (A) Schematic diagram of the chip design, which includes a medium storage layer, an upper chamber for cell seeding, a PET membrane separating the upper and lower layers, and a lower chamber for cell seeding; (B) Cross-sectional view of the BBB chip. Astrocytes are implanted in the upper chamber to form a neural cavity, and brain microvascular endothelial cells are implanted inverted in the lower chamber to form a vascular cavity; (C) Schematic diagram of the construction of the AAV heptapeptide variant library and the library screening process using the BBB model chip.

[0028] Figure 2 To characterize the in vitro BBB biomimetic chip model; Figure 2In the figure, (A) the transmembrane resistance (TEER) of blood-brain barrier model cells was monitored for 7 consecutive days; (B) small molecule permeability experiment, fluorescein sodium (FLU) solution or FITC-dextran solution with a molecular weight of 40KDa or 70KDa was added to the vascular chamber of the BBB biomimetic chip model; after incubation for 2 hours, the culture medium was sampled from the neural chamber to detect the fluorescence signal by fluorescence spectrophotometry. Data are the mean + / -SD of 3 independent experiments; significance was determined by two-way ANOVA, followed by Tukey's multiple comparison test for mean comparison; *** indicates P < 0.005; (C) immunofluorescence staining to detect the expression of ZO-1 tight junction protein; blue, DAPI-stained nuclei; green, FITC-stained ZO-1 protein.

[0029] Figure 3 To quantitatively analyze and sequence the genome copy numbers of 19 AAV variants obtained from three rounds of screening in the neural compartment of the BBB chip model; Figure 3 (A) Quantification and sequencing of the genome copy numbers of 19 AAV variants obtained from three rounds of screening in the neural compartment of the BBB chip model; data are the mean + / - SD of 3 independent experiments; significance was determined by two-way ANOVA followed by Tukey's multiple comparison test for mean comparison; *p<0.05, **p<0.001, ***p<0.005; (B) Amino acid sequences of the random heptapeptides inserted into the capsid proteins of AAV-M6 and AAV-M8.

[0030] Figure 4 To analyze the efficiency of two novel AAVs crossing the BBB; Figure 4 (A) Comparison of the efficiency of two novel AAVs crossing the BBB; 200 μL of 1×10 10 GC / mL of AAV suspension, culture medium was extracted from the neural chamber 24 hours later, and AAV titer was determined by qPCR; Data are the mean + / - SD of 3 independent experiments; significance was determined by two-way ANOVA, followed by Tukey's multiple comparison test for mean comparison;; *p<0.05, **p<0.001, ***p<0.005; (B) Changes in TEER values ​​after adding AAV; TEER values ​​of the BBB bionic chip model were continuously detected, in which AAV was added to the model on the 5th day and TEER values ​​were continued to be monitored.

[0031] FIG5 is a characterization of the ability of AAV-M6 to cross the BBB in vitro; in FIG5 , (A) 200 μL of virus suspension (1×10 10GC / mL) were added to the vascular cavity of the BBB model and cultured for 24 hours, and then the cells were labeled with the viability tracking dye CMTPX; red, HA-1800 cells labeled with CMTPX; green, AAV labeled with DyLightTM 488; (B) AAV fluorescence in the HA-1800 cell layer in Figure 5 was quantified using Image J software; data are the mean + / - SD of 3 independent experiments; significance was determined by two-way ANOVA, followed by Tukey's multiple comparison test for mean comparison; ***P<0.005.

[0032] Figure 6 To analyze the transduction efficiency of AAV-M6 in astrocytes; Figure 6 (A) Luciferase fluorescence (Fluc) detection of HA-1800 cells transfected with AAV-M6 after crossing the BBB; (B) Quantitative analysis of Fluc signal in AAV-infected HA-1800 cells; Data are means + / - SD of 3 independent experiments; significance was determined by two-way ANOVA followed by Tukey's multiple comparison test for mean comparison; ***P < 0.005.

[0033] Figure 7 Molecular docking simulation of the inserted peptide in mutant AAV-M6 and different AAV receptor proteins; Molecular docking simulation of the inserted peptide in AV-M6 capsid and different AAV receptor proteins; Figure 7 Middle, (AE) Molecular docking simulations of the receptor proteins LY6E, M6PR, MELTF, LY6D, or HBEFG (grey) and the heptapeptide residues inserted into the AAV-M6 capsid (color); left: stick model of the interacting residues; right: space-filling model of the receptor binding site and the heptapeptide residues; (F) Binding energy between the AAV-M6 heptapeptide sequence and LY6E, M6PR, MELTF, LY6D, or HBEFG. DETAILED DESCRIPTION

[0034] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0035] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial sources. The AAV capsid protein amino acid sites described in the present invention correspond to AAV9VP1 (GenBank accession number AY530579.1), but are not limited to this serotype.

[0036] Example 1: Screening of novel mutants

[0037] (1) Construction of the backbone plasmid of the AAV9 capsid protein mutant library

[0038] The backbone vector contains an AAV5 p41 promoter fragment, an AAV2 rep splicing signal sequence, and a CAP sequence of AAV9 with a frameshift mutation (wherein the CAP sequence of AAV9 mutates the K at the original amino acid position 449 to R, the nucleic acid sequence mutates from tcaaag to tctaga, and introduces an Xba I restriction site; the nucleic acid sequence of the amino acid G at the original amino acid position 594 is mutated from ggc to ggt, and a BshT I restriction site is introduced; at the same time, a 34 bp sequence containing a termination codon is inserted between the original amino acid positions 588 and 589 to cause a frameshift of the sequence and avoid contamination caused by unclean enzyme cutting of the backbone vector), and an SV40 polyA sequence is added after the CAP sequence. The above sequence is synthesized by gene synthesis and inserted between the ITR sequences of the rAAV vector to form an AAV9 capsid protein mutant library backbone plasmid.

[0039] (2) Construction of mutant Rep-CAP vector

[0040] By introducing a stop codon at the N-terminus of the VP1, VP2, and VP3 proteins of the CAP sequence in AAV9, the Rep-CAP vector can normally express the Rep protein and AAP protein, but cannot express the VP1, VP2, and VP3 proteins of CAP, thereby avoiding contamination of the CAP sequence in the parent AAV9. The above sequence is synthesized by gene synthesis and inserted to replace the CAP sequence of the AAV9 Rep-CAP vector.

[0041] (3) Construction of random 7-peptide vector library

[0042] Design 2 primers (5'→3') as follows:

[0043] Primer 1: ACTCATCGACCAATACTTGTACTATCTCTCTAGAAC;

[0044] Primer 2:

[0045] GTATTCCTTGGTTTTGAACCCAACCGGTCTGCGCCTGTGCMNNMNNMNN MNNMNNMNNMNNTTGGGCACTCTGGTGGTTTGTG.

[0046] One of the designed primers contains a 21bp nucleic acid sequence of a random 7-peptide, and the AAV9 capsid protein mutant library backbone vector is used as a template to perform PCR amplification to obtain a fragment containing a random sequence. The fragment is subjected to gel electrophoresis and the target size fragment is recovered by gel to obtain a purified nucleic acid fragment of the random 7-peptide library. The fragment is connected to the AAV9 capsid protein mutant library backbone vector (after double digestion with XbaI and BshT I and gel recovery purification) by Gibson homologous recombination connection. The connected vector is purified by a PCR product purification kit and digested with Plasmid-Safe DNase enzyme to remove the unconnected fragments. Finally, after purification by a PCR product purification kit, the constructed AAV9 random 7-peptide vector library, i.e., the AAV9 mutant plasmid library, is obtained.

[0047] (4) Production of AAV9 virus mutant library

[0048] The mutant Rep-Cap plasmid, AAV9 mutant plasmid library, and pHelper plasmid were co-transfected into HEK-293T cells, and the adeno-associated virus was purified by iodixanol gradient ultracentrifugation. The virus titer was measured at 1×10 12 GC / mL~1×10 13 GC / mL is the appropriate titer, and the AAV9 virus mutant library is obtained and placed at -80°C for future use.

[0049] (5) Screening of AAV9 mutants

[0050] (5.1) Brain-like chip screening process

[0051] Currently, most studies on AAV crossing the blood-brain barrier are based on animal model experiments. However, due to differences between species, the results obtained in these experiments may not be reproduced in human clinical trials. In order to overcome the differences in the blood-brain barrier between species, the present invention developed an in vitro model of a bionic organ chip of the human blood-brain barrier for multiple rounds of screening of AAV variants. Since a key part of the blood-brain barrier is the endothelial cell layer, which forms tight junctions and prevents macromolecules from entering the brain from the blood via paracellular transport, the in vitro human blood-brain barrier chip model described in this work establishes a layer of human brain microvascular endothelial cells (hCMEC / D3) and human astrocytes (HA-1800). This integrated biomimetic chip contains 24 independent functional units that can be used in parallel for high-throughput functional analysis of BBB-related properties. Each unit consists of an upper chamber separated by a PET membrane, a lower chamber, and an intermediate layer for storage ( Figure 1 A) In order to study AAV crossing the BBB, a human blood-brain barrier model was first constructed. 6Human astrocytes (HA-1800) with a density of 1×10 cells / mL were seeded into the on-chip chamber (i.e., the neural chamber). 7 The chip was then placed on a precision shaker and incubated at 2 rpm with a 30° tilt to simulate the blood flow velocity in the human body ( Figure 1 B).

[0052] To evaluate the formation and stability of the barrier before AAV screening, the transmembrane electrical resistance (TEER) values ​​of each compartment were measured every day starting from cell inoculation. After inoculation of hCMEC / D3 cells, the TEER values ​​gradually increased and stabilized on day 5, indicating that the in vitro BBB model had been established ( Figure 2 A). In addition, a small molecule permeation assay was performed to measure the diffusion of sodium fluorescein solution (376Da) or 40KDa or 70KDa FITC-dextran solution from the vascular compartment to the neural compartment to assess barrier function at day 5 post-inoculation. Permeability (Papp) estimated by spectrofluorometry showed that the amount of each solute that could cross the neural compartment was significantly reduced compared to the respective control group, and the larger the solute, the lower the permeability across the membrane ( Figure 2 B), indicating that the BBB barrier function has been established. Since the BBB barrier function depends on the high expression of specific proteins in endothelial cells, especially tight junction proteins such as ZO-1, the expression of ZO-1 in each chip was evaluated by FITC staining on the 5th day after model construction. Figure 2 As shown in C, ZO-1 protein could be clearly detected by FITC staining in hCMEC / D3 cells on day 5 after inoculation, indicating that ZO-1 protein was well expressed and the barrier function was intact.

[0053] After confirming the BBB function by TEER, the complete AAV virus library was inoculated into the vascular cavity of three repeated models, and sequence enrichment was performed by controlling different screening conditions in each screening round (the amount of virus library added was gradually reduced, and the incubation time was gradually reduced). The cells and supernatant of each round were collected for subsequent operations, and a total of three screenings were performed.

[0054] (5.2) AAV genome extraction and amplification

[0055] The AAV genome in the screened cells or supernatant was extracted using a DNA extraction kit, and the corresponding primers were designed for nested PCR amplification (the first round used: (F(5'→3'):ACTTCAACAGATTCCACTGCCACTTC, R(5'→3'):GCAATAAACAAGTTGGTCGACCATATG; the second round used: (F(5'→3'):ACTCATCGACCAATACTTGTACTATCTCTCTAGAAC, R(5'→3'):GGAAGTATTCCTTGGTT TTGAACCCA)), the amplified PCR product is subjected to gel electrophoresis to confirm the band size, and the target band fragment is cut off, and the product is recovered using a gel recovery kit. The amplified PCR fragment product is used for the next round of library construction and toxin production, and the brain-like chip screening process is repeated. NGS sequencing uses the corresponding NGS primers for amplification, and the sample is sent to a sequencing company for amplicon sequencing. After 2 to 3 rounds of screening, the sequencing results are compared until a highly repetitive enriched sequence is found. The highly repetitive sequence is used as a candidate AAV capsid protein mutant, and then further brain-like chip experiments are performed for verification.

[0056] Among them, the AAV capsid protein mutant 6 (AAV-M6) and mutant 8 (AAV-M8) screened and enriched, the amino acid sequences of their VP1 are shown as SEQ ID No.3 and SEQ ID No.4, respectively, and the nucleotide sequences are shown as SEQ ID No.7 and SEQ ID No.8, respectively; the amino acid sequences of the targeting peptides in VP1 are shown as SEQ ID No.1 and SEQ ID No.2, respectively, and the nucleotide sequences are shown as SEQ ID No.5 and SEQ ID No.6, respectively.

[0057] Example 2: Construction of AAV capsid protein mutants and virus production

[0058] In order to analyze the function of screening and enriching candidate serotypes, the enriched sequences were constructed into Rep-CAP, and the GOI plasmid carrying the reporter gene was used to package the virus for subsequent verification.

[0059] (1) Construction of mutant serotype vector and plasmid extraction:

[0060] The AAV9 Rep-CAP plasmid was double-digested with Smi I and BshT I, and the fragment band of about 5000 bp was cut out for gel electrophoresis and gel recovery to obtain the digested backbone fragment.

[0061] According to the Cap sequence of mutant 6, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of AAV9 as a template, using the Cap-f+mutant 6-R primers to amplify and gel-recover to obtain the target product mutant 6-1, using the Rep-CAP plasmid of AAV9 as a template, using the mutant 6-F+cap-r primers to amplify and gel-recover to obtain the target product mutant 6-2, and by mixing the backbone fragment, mutant 6-1, and mutant 6-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 6 can be recombined and constructed;

[0062] According to the Cap sequence of mutant 8, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of AAV9 as a template, using the Cap-f+mutant 8-R primers to amplify and gel-recover to obtain the target product mutant 8-1, using the Rep-CAP plasmid of AAV9 as a template, using the mutant 8-F+cap-r primers to amplify and gel-recover to obtain the target product mutant 8-2, and by mixing the backbone fragment, mutant 8-1, and mutant 8-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 8 can be recombined and constructed;

[0063] The primers involved in the construction of the Rep-CAP vector of the above-mentioned AAV capsid protein mutant 6 and mutant 8 are shown in Table 1:

[0064] Table 1 Primer sequences

[0065] Take a clean 200uL PCR tube, mark it and place it on an ice box. Prepare the reaction solution with the above enzyme-cut backbone and each target fragment at a backbone: fragment molar ratio of 1:3, and react in a PCR instrument at 50℃ for 30min for recombination connection. Take 50μL competent cells and thaw them on ice. Mix 10μL of the connection product with DH5α competent cells and place them on ice for 20-30 minutes; heat shock at 42℃ for 45 seconds; quickly place them on ice for 2 minutes, add 400μL of recovery SOC medium (without antibiotics), and culture at 37℃, 200rpm for 1h; evenly apply it to Amp resistance plate (50μg / mL) and culture at 37℃ for 14 hours. Select monoclonal bacteria, expand the culture in 4mL liquid LB medium (Amp+ resistance), and culture at 37℃ for 14 hours.

[0066] The bacterial solution was centrifuged at 12000rpm for 1min, and the supernatant medium was discarded; 250μL of buffer P1 / RNaseA mixture was added and the bacteria were resuspended by high-speed vortexing; 250μL of buffer P2 was added, and the solution was inverted 8-10 times; 350μL of buffer P3 was added, and the solution was immediately inverted and mixed 8-10 times to completely neutralize the solution; centrifuged at 13000rpm for 10min, and the supernatant was passed through the column; centrifuged at 12000 for 1min, the waste liquid was discarded, 500μL of PW1 was added, and the waste liquid was discarded; 600μL of PW2 was added, and the solution was centrifuged at 12000 for 1min, and the supernatant was discarded; 600μL of PW2 was added, and the solution was centrifuged at 12000 for 1min, and the supernatant was discarded; the solution was idling at 12000rpm for 2min; 30-50μL of 55℃ preheated eluent was added, and the solution was allowed to stand for 2min, and centrifuged at 12000rpm for 1min. Use a micro-volume nucleic acid quantifier to detect the concentration.

[0067] The obtained plasmid was tested for concentration, and 10 μL of the positive plasmid identified by enzyme digestion was taken for sequencing, and the positive plasmid was stored at -20°C. The sequencing results showed that the obtained plasmid could encode the variant capsid protein VP1. Finally, according to the amount of virus required for the later test, the relevant Helper plasmid, each group of Rep-Cap plasmid (AAV9 and the above-mentioned mutant of the present invention) plasmid, and the GOI plasmid (ssAAV.CAG.Fluc-2a-eGFP.WPRE.SV40pA) expressing firefly luciferase (Fluc) and green fluorescent protein (EGFP) were extracted.

[0068] (2) Packaging and purification of mutant serotype viruses

[0069] The obtained Rep-Cap plasmids of each group (AAV9 and the above-mentioned AAV mutants), the GOI plasmid expressing firefly luciferase (Fluc) and green fluorescent protein (EGFP), and the pHelper plasmid were co-transfected into HEK-293T cells in appropriate amounts, and the AAV virus was purified by iodixanol gradient ultracentrifugation. The virus titer was measured and 1E+12GC / mL to 1E+13GC / mL was considered appropriate. The cells were placed at -80°C for use.

[0070] Example 3: Functional verification of mutant serotype viruses

[0071] (1) Ability of mutant serotypes to cross the BBB

[0072] For the candidate serotypes screened and enriched, 19 serotype mutants were constructed separately and packaged into viruses separately, and compared and analyzed using the BBB model chip. Figure 3As shown in A, several serotype mutants showed stronger ability to cross the BBB, among which AAV-M6 and AAV-M8 had the best effect (sequences as Figure 3 B). Therefore, to further analyze the crossing efficiency of AAV-M6 and AAV-M8 variants, 200 μL containing each variant or AAV-PHP.eB control virus (1×10 10 GC / mL) was inoculated into the vascular cavity of the BBB model chip. After 6 hours of culture, samples were taken from the neural chamber of each model to quantify the virus titer. qPCR analysis showed that the BBB crossing efficiency of AAV-M6 and AAV-M8 was significantly higher than that of AAV-PHP.eB. The titer accumulation of AAV-M6 was about 5 times that of AAV-PHP.eB, and AAV-M8 was 3 times that of AAV-PHP.eB ( Figure 4 A).

[0073] To investigate whether AAV-M6 and AAV-M8 are suitable for use in humans, it was further tested whether exposure to these AAV vectors or AAV-PHP.eB compromises the integrity of the human BBB. To this end, TEER values ​​were measured in the BBB model on consecutive days after inoculation with AAV-M6 and AAV-M8 or AAV-PHP.eB to assess barrier integrity. Cells were seeded into the BBB chamber prior to the addition of the viral suspension, and barrier formation was then assessed for 5 days until a steady-state TEER ( Figure 4 B). TEER was then recorded for an additional two days following transduction with either the candidate vector or AAV-PHP.eB as the viral titers in the cells increased. No significant changes in TEER were detected in any of the AAV groups, suggesting that none of these serotypes significantly affected the integrity of the BBB compared to control cultures without virus exposure.

[0074] Based on the above verification that AAV-M6 efficiently crosses the BBB, the in vitro BBB crossing activity of AAV-M6 was further verified by live cell imaging in the BBB model. After the BBB model was established (day 5), AAV-M6 or AAV9 labeled with DyLightTM 488 amine-reactive dye was added to the lower chamber. After 24 hours of culture, the hCMEC / D3 and HA-1800 cells in the BBB chip were washed to remove unbound viruses, and the cells were stained with the activity tracking dye CMTPX for imaging with multiphoton live cell microscopy. It was observed that AAV-M6, AAV9, and AAV-PHP.eB were able to reach the HA-1800 parenchymal cell layer ( Figure 5A ), and ImageJ quantitative analysis showed that the fluorescence signal of AAV-M6 was significantly stronger than that of AAV9 or AAV-PHP.eB, indicating that its titer was significantly higher than that of AAV9 or AAV-PHP.eB ( Figure 5B), which is consistent with our above results. In addition, in the in vitro BBB model, it was found that AAV-M6 could enter HA-1800 cells, which proved that the heptapeptide insertion did not have a negative impact on the ability of AAV-M6 to infect cells.

[0075] (2) Analysis of the transduction efficiency of AAV-M6 in astrocytes

[0076] Based on the above results, AAV-M6 showed higher BBB crossing ability in in vitro models, so this variant was focused on in subsequent functional experiments.

[0077] To verify the ability of AAV-M6 to cross the BBB and transduce HA-1800 cells in vitro, after the barrier function was established in the BBB model (day 5), 200 μL of AAV-M6 or AAV-PHP.eB suspension (1×10 10 GC / mL) were inoculated into the vascular chamber. After 24 h of culture, samples were taken from the neural chamber and the culture medium was transferred to a pre-inoculated 1×10 4 After 5 days of culture, the results showed that AAV-M6 and AAV-PHP.eB could indeed cross the endothelial cell layer and transduce HA-1800 cells ( Figure 6 A). Quantitative analysis of AAV-infected HA-1800 cells showed that the GFP fluorescence signal was significantly higher in AAV-M6-infected cells compared with the AAV-PHP.eB-treated group ( Figure 6 B). Consistent with the above experimental results, these results further confirmed that AAV-M6 has a stronger ability to transduce brain parenchymal cells after passing through the hCMEC / D3 cell layer than AAV-PHP.eB.

[0078] (3) Molecular docking simulation

[0079] The present invention then investigated the molecular mechanism of candidate AAV vectors crossing the BBB, which is crucial for the development of vectors. Lymphocyte antigen 6 complex locus E (LY6E), a human homolog of mouse lymphocyte antigen 6 complex locus A (LY6A), has been reported to mediate AAV crossing the BBB20, 29, while membrane proteins M6PR and MELTF and epidermal growth factor HBEGF may also be involved in the endocytosis of AAV and transduction from endothelial cells. The present invention then performed molecular docking simulations to identify the receptors responsible for AAV cellular phagocytosis. The seven-peptide sequence inserted at AA588-589 of the AAV-M6 capsid protein was used for simulation with LY6D, LY6E, M6PR, MELTF and HBEFG, and independent three-dimensional structure predictions were generated for each of these five proteins using AlphaFold2. A 50 nanosecond (ns) docking simulation (GROMACS 5.0) showed that LY6D and M6PR could interact stably with the AAV-M6 seven-peptide capsid region ( Figure 7 AE). The list of residues that can interact with the heptapeptide insert is shown in Table 2.

[0080] Table 2 Complete list of interacting residues in molecular docking simulations between human viral receptor protein and AAV-M6 heptapeptide insertion residues

[0081]

[0082] Among them, M6PR has the highest binding energy (-22.81 kcal / mol) and the lowest Ki (0.12 μM), which indicates that the complex it forms is extremely stable and has extremely high affinity. In addition, the binding energy of LY6D is -19.83 kcal / mol, and the Ki value (0.96 μM) is also very low, which also means that this AAV variant can form a high-affinity, tightly bound and stable receptor-ligand complex ( Figure 7 F).

[0083] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. An AAV capsid protein mutant, characterized in that: Its amino acid sequence is shown in SEQ ID No.

4.

2. A nucleic acid encoding an AAV capsid protein mutant, characterized in that: Its nucleotide sequence is shown in SEQ ID No.

8.

3. A recombinant adeno-associated virus, characterized in that: Comprising the AAV capsid protein mutant described in claim 1.

4. The recombinant adeno-associated virus according to claim 3, characterized in that Heterologous genes of interest are also included.

5. The recombinant adeno-associated virus according to claim 4, characterized in that The heterologous target gene encodes any gene product of interfering RNA, aptamer, endonuclease, and guide RNA.

6. Use of the AAV capsid protein mutant described in claim 1 and the recombinant adeno-associated virus described in any one of claims 3 to 5 in the preparation of a delivery tool that crosses the blood-brain barrier in vivo.

Images