A recombinant genetically engineered bacterium for biosynthesizing gallic acid

Abstract

The present invention belongs to the field of bioengineering fermentation technology, and specifically relates to a recombinant genetically engineered bacterium for biosynthesizing gallic acid. The genetically engineered bacterium of the present invention comprises a recombinant Pseudomonas sp. containing the 3-deoxy-7-phosphoheptanoate synthase gene aroG, the 3-dehydroshikimate dehydratase gene quiC, and the 4-hydroxybenzoate monooxygenase gene pobA. The genetically engineered bacterium can efficiently produce gallic acid through fermentation, has the advantages of high yield, stable passage, simple fermentation process, low cost, good tolerance, etc., is suitable for industrial scale-up production, and has good application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering fermentation, and in particular relates to a recombinant genetic engineering bacterium for biosynthesizing gallic acid. Background Art

[0002] Gallic acid is a polyphenolic compound found in a variety of plants, including blueberries, apples, pomegranates, and tea. Gallic acid and its derivatives possess potent antioxidant properties, along with numerous other biological activities, including antibacterial, anti-inflammatory, anti-tumor, and neuroprotective properties. Consequently, they are widely used in food and cosmetics. Furthermore, gallic acid is used as a raw material in the production of blue-black ink.

[0003] Currently, the main method for producing gallic acid is to extract it from the dried pods of the Tara plant (Tara flour). This involves extracting tannins from Tara flour through processes such as acid hydrolysis, alkaline hydrolysis, and enzymatic hydrolysis. The acid-alkaline hydrolysis process is severely detrimental to equipment, produces large amounts of wastewater, and is complex to handle. Furthermore, this process relies heavily on the availability of Tara flour, a raw material that is only cultivated in South American regions like Peru, Chile, and Bolivia, as well as parts of Yunnan and Luxi in China.

[0004] The process of biosynthesizing gallic acid with a simple carbon source through microbial fermentation has the advantages of low pollution and easy availability of raw materials, and is a highly promising alternative to the gallic acid production process. For example, the U.S. patent "US6472190B1 Biocatalytic synthesis of galloid organics" discloses a recombinant Escherichia coli that can ferment and produce gallic acid. However, the transformation of the gallic acid production strain described in the patent requires additional plasmid expression, and the additional plasmid system may be unstable and lost during the strain propagation, and antibiotics and inducers need to be added during the fermentation process to make the fermentation process more complicated and more expensive. Therefore, this field still urgently needs to develop more new gallic acid production engineered bacteria to meet the needs of large-scale industrial production. Summary of the Invention

[0005] In response to the problems of the prior art, the present invention provides a recombinant genetically engineered bacterium for efficiently biosynthesizing gallic acid.

[0006] A recombinant genetic engineering bacterium for biosynthesizing gallic acid is a recombinant Pseudomonas sp. containing a 3-deoxy-7-phosphoheptanoate synthase gene aroG, a 3-dehydroshikimate dehydratase gene quiC and a 4-hydroxybenzoate monooxygenase gene pobA.

[0007] Preferably, the nucleotide sequence of the 3-deoxy-7-phosphoheptoneate synthase gene aroG is shown as SEQ ID NO.1, the nucleotide sequence of the 3-dehydroshikimate dehydratase gene quiC is shown as SEQ ID NO.2, and the nucleotide sequence of the 4-hydroxybenzoate monooxygenase gene pobA is shown as SEQ ID NO.4.

[0008] Preferably, the recombinant Pseudomonas does not contain the protocatechuate 3,4-dioxygenase gene pcaGH;

[0009] And / or, the recombinant Pseudomonas does not contain the pyruvate kinase gene pykA and the pyruvate kinase gene pyk;

[0010] And / or, the recombinant Pseudomonas does not contain the gallate dioxygenase gene galA, the gallate transporter gene galP, and the gallate transporter gene galT;

[0011] And / or, the recombinant Pseudomonas does not contain the gluconate-2-dehydrogenase gene PP3382-PP3384, the gluconate-2-dehydrogenase gene PP3623, the gluconate-2-dehydrogenase gene PP4232, and the DNA transcription repressor gene hexR.

[0012] Preferably, the recombinant Pseudomonas further comprises a transketolase gene tktA, a transaldolase gene tal and a phosphoenolpyruvate synthase gene ppsA.

[0013] Preferably, the nucleotide sequence of the transketolase gene tktA is shown as SEQ ID NO.19, the nucleotide sequence of the transaldolase gene tal is shown as SEQ ID NO.20, and the nucleotide sequence of the phosphoenolpyruvate synthase gene ppsA is shown as SEQ ID NO.21.

[0014] Preferably, the recombinant Pseudomonas is obtained by two-step homologous recombination, wherein:

[0015] The recombinant plasmid pBR1-MCS2 containing at least 3-deoxy-7-phosphoheptanoate synthase gene aroG, 3-dehydroshikimate dehydratase gene quiC and 4-hydroxybenzoate monooxygenase gene pobA was constructed, wherein the promoter of the recombinant plasmid pBR1-MCS2 was P rpsj12 , the promoter P rpsj12 The nucleotide sequence is shown in SEQ ID NO.22;

[0016] The open reading frame and site homology arms were constructed on the plasmid pk18mobsacB, transformed into Pseudomonas by electroporation, and the engineered strain was obtained through two-step homologous recombination screening.

[0017] Preferably, the recombinant Pseudomonas uses Pseudomonas putida KT2440, HB3267, H8234, NBRC14164, DLL-E4 or derivative strains thereof as a production host.

[0018] The present invention also provides use of the recombinant genetically engineered bacteria in preparing gallic acid or its preparation.

[0019] The present invention also provides a method for preparing gallic acid, which comprises: using a carbon source as a substrate and fermenting with the recombinant genetically engineered bacteria, wherein the carbon source is selected from at least one of glucose and / or glycerol.

[0020] Preferably, the fermentation medium comprises: 20-40 g / L glucose, 4-10 g / L (NH4)2SO4, 5-20 g / L yeast extract, 5-10 g / L MgSO4·7H2O, 4-8 g / L Na2HPO4, 2-4 g / L K2HPO4, 0.01-0.1 mg / LH3BO3, 0.1-1 mg / L CuCl2, 0.1-1 mg / L Na2EDTA, 0.1-1 mg / L CoCl2, 0.5-2 mg / L ZnCl2, 1-3 mg / L MnCl2, and the remainder is water;

[0021] The fermentation conditions are as follows: shake flask fermentation temperature of 27-32°C, initial pH of 6-6.5, and rotation speed of 150-250 rpm; fed batch fermentation temperature of 27-32°C, pH maintained at 6.2±0.2, and dissolved oxygen maintained at 8-30%.

[0022] The present invention constructs a genetically engineered bacterium for gallic acid production using Pseudomonas as a host. By introducing additional exogenous genes and blocking competing pathways, the flux of the shikimate pathway is enhanced, increasing the supply of the key precursor protocatechuic acid. Deleting genes that degrade key intermediates and products significantly promotes the stabilization of metabolic flux and product accumulation. Furthermore, the highly active and specific 4-hydroxybenzoate oxygenase PobA is selected to maximize the synthesis of gallic acid from simple carbon sources.

[0023] The technical solution of the present invention has the following advantages:

[0024] 1. The genetically engineered bacteria of the present invention have the advantage of high yield in the production of gallic acid. Experiments have shown that the yield of the recombinant engineered bacteria in the present invention can reach 22.7 g / L in fed-batch fermentation, and have the potential for industrial scale-up.

[0025] 2. The recombinant genetically engineered bacteria of the present invention are genomically integrated strains and utilize a constitutive promoter, thus eliminating the need for specific antibiotics or inducers during the fermentation process. Compared to existing technologies, this method overcomes plasmid loss, is more stable, and offers a simpler fermentation process, lower costs, and greater potential for industrial scalability.

[0026] 3. The present invention uses Pseudomonas as the host, which has higher tolerance to phenolic acids and aromatic derivatives than Escherichia coli. Therefore, the recombinant engineered Pseudomonas in the present invention has better application prospects for producing gallic acid.

[0027] Obviously, based on the above contents of the present invention, according to common technical knowledge and customary means in this field, without departing from the above basic technical ideas of the present invention, other various forms of modifications, replacements or changes can be made.

[0028] The following further describes the above content of the present invention in detail through specific embodiments in the form of examples. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of the synthesis pathway for synthesizing gallic acid from a simple carbon source according to the present invention. DETAILED DESCRIPTION

[0030] In the following examples and experimental examples, reagents and raw materials not specifically described are all commercially available. The nucleotide sequence information involved in the present invention is as follows:

[0031] Gene aroG nucleotide sequence (SEQ ID NO.1):

[0032]

[0033] Gene quiC nucleotide sequence (SEQ ID NO.2):

[0034]

[0035] Gene PppobA nucleotide sequence (SEQ ID NO.3):

[0036]

[0037] Nucleotide sequence of gene PppobAT294A Y386F (SEQ ID NO.4):

[0038] ATGAAAACTCAGGTTGCAATTATCGGTGCAGGTCCGTCTGGCCTGCTGCTCGGCCAATTGCTGCACAATGCCGGTATCGAGACCGTCATCGTCGAACGCCAGACCCCTGAATACGTGCTTGGGCGCATCCGTGCCGGGGTGCTTGAGCAAGGCACTGTCGACCTGTTGCGTGAGGCCGGTGTATCGGCGCGCATGGACCGTGAAGGCCTGGTGCATGAAGGTGTCGAACTGCTGGTCGGCGGGCGTCGCCAGCGGTTGGACCTCAAGGCCCTGACCGGCGGCAAGACAGTGATGGTCTACGGCCAGACCGAGGTCACCCGTGACCTGATGCAGGCGCGTGAAGCCAGTGGGGCGCCGATCATCTACGCGGCGAACAATGTGCAGCCGCATGAGCTCAAAGGCGAGCGGCCGTACCTGACGTTCGAGAAGGACGGCCAGGCCCACCGCCTGGAGTGTGACTACATCGCCGGTTGCGATGGTTTCCACGGGGTTTCCCGGCAGAGCATTCCCGAGGGCGTGCTCAAGCAGTACGAGCGGGTCTATCCATTTGGCTGGCTTGGCTTGTTGTCCGATACGCCCCCGGTCAATCACGAACTGATCTATGCCCACCACGAGCGGGGTTTCGCGCTGTGCAGCCAACGCTCGCAGACGCGCAGCCGCTATTACCTGCAAGTGCCGCTGGACGATAAGGTCGAAGCCTGGTCCGACGAGCGTTTCTGGGACGAACTCAAGGCCCGTTTGCCCGCCGAGGTTGCGGCTGACCTGGTCACTGGCCCAGCCCTGGAAAAAAGCATCGCGCCGCTGCGTAGCCTGGTGGTCGAACCGATGCAGTACGGCCACCTGTTCCTGGTCGGTGACGCTGCGCACATCGTCCCACCC gccGGCGCCAAAGGTTTGAACCTGGCAGCTTCGGACGTCAACTACCTCTACCGCATCCTGGTCAAGGTGTACGGCGAAGGGCGTACCGACCTGCTTCAGCAATATTCGCCGCTGGCCCTGCGCCGGGTATGGAAGGGCGAGCGTTTCAGCTGGTTCATGACCCAGCTGCTGCATGACTTCGGCAGCCACAAGGATGCCTGGGACCAGAAGATGCAGGAGGCAGACCGCGAGTACTTCCTGAACTCCCCGGCGGGGCTGCTGAACATTGCCGAGAAC ttt GTGGGGCTGCCGTACGAAGCAGTAGTCTGA

[0039] Nucleotide sequence of gene PppobAL199V Y386F (SEQ ID NO.5):

[0040] ATGAAAACTCAGGTTGCAATTATCGGTGCAGGTCCGTCTGGCCTGCTGCTCGGCCAATTGCTGCACAATGCCGGTATCGAGACCGTCATCGTCGAACGCCAGACCCCTGAATACGTGCTTGGGCGCATCCGTGCCGGGGTGCTTGAGCAAGGCACTGTCGACCTGTTGCGTGAGGCCGGTGTATCGGCGCGCATGGACCGTGAAGGCCTGGTGCATGAAGGTGTCGAACTGCTGGTCGGCGGGCGTCGCCAGCGGTTGGACCTCAAGGCCCTGACCGGCGGCAAGACAGTGATGGTCTACGGCCAGACCGAGGTCACCCGTGACCTGATGCAGGCGCGTGAAGCCAGTGGGGCGCCGATCATCTACGCGGCGAACAATGTGCAGCCGCATGAGCTCAAAGGCGAGCGGCCGTACCTGACGTTCGAGAAGGACGGCCAGGCCCACCGCCTGGAGTGTGACTACATCGCCGGTTGCGATGGTTTCCACGGGGTTTCCCGGCAGAGCATTCCCGAGGGCGTGCTCAAGCAGTACGAGCGGGTCTATCCATTTGGCTGGCTTGGCTTGTTGTCCGATACGCCCCCGGTCAATCACGAA gtg ATCTATGCCCACCACGAGCGGGGTTTCGCGCTGTGCAGCCAACGCTCGCAGACGCGCAGCCGCTATTACCTGCAAGTGCCGCTGGACGATAAGGTCGAAGCCTGGTCCGACGAGCGTTTCTGGGACGAACTCAAGGCCCGTTTGCCCGCCGAGGTTGCGGCTGACCTGGTCACTGGCCCAGCCCTGGAAAAAAGCATCGCGCCGCTGCGTAGCCTGGTGGTCGAACCGATGCAGTACGGCCACCTGTTCCTGGTCGGTGACGCTGCGCACATCGTCCCACCCACCGGCGCCAAAGGTTTGAACCTGGCAGCTTCGGACGTCAACTACCTCTACCGCATCCTGGTCAAGGTGTACGGCGAAGGGCGTACCGACCTGCTTCAGCAATATTCGCCGCTGGCCCTGCGCCGGGTATGGAAGGGCGAGCGTTTCAGCTGGTTCATGACCCAGCTGCTGCATGACTTCGGCAGCCACAAGGATGCCTGGGACCAGAAGATGCAGGAGGCAGACCGCGAGTACTTCCTGAACTCCCCGGCGGGGCTGCTGAACATTGCCGAGAAC ttt GTGGGGCTGCCGTACGAAGCAGTAGTCTGA

[0041] Nucleotide sequence of gene PapobA (SEQ ID NO.6):

[0042]

[0043] Gene PapobA T294A Y385F nucleotide sequence (SEQ ID NO.7):

[0044]

[0045] Gene PapobAL199V Y385F nucleotide sequence (SEQ ID NO.8):

[0046]

[0047] Gene PppykA nucleotide sequence (SEQ ID NO.9):

[0048]

[0049] Gene Pppyk nucleotide sequence (SEQ ID NO.10):

[0050]

[0051] Gene pcaGH nucleotide sequence (SEQ ID NO.11):

[0052]

[0053] Gene galA nucleotide sequence (SEQ ID NO.12):

[0054]

[0055] Gene galP nucleotide sequence (SEQ ID NO.13):

[0056]

[0057] Gene galT nucleotide sequence (SEQ ID NO.14):

[0058]

[0059] Gene hexR nucleotide sequence (SEQ ID NO.15):

[0060] GTGCGAAACCTCCTGGAACAGATCCAGGGCCGCCTCGACGAGCTGAACAAGGCCGAACGCAAAGTCGCCGAAGTCATCCTGCTCAACCCGCAACAAGCCACCCGTTTCAGCATCGCTGCGCTGGCCCAGGCGGCCAAGGTCAGCGAACCGACCGTCAACCGCTTCTGCCGCTCGTTCGGCGTCAGCGGCTACCCCGAACTCAAGCTGCAACTGGCGCAGAGCCTGGCCAGTGGTGCCGCCTATGTCAGCCGCGCGGTAGAGGCCGACGATGACCCGGCCGCCTACACCCAGAAGATCTTCGCCAGCGCCATCGCCTCGCTTGACAGCGCCTGCCAGCAACTGGACCCGCAGCAGGTCAGCCGCGCCGTGGACATGATGATCCAGGCCCGGCAGATCCACTTCTTCGGCCTCGGCGCCTCAGCCCCGGTGGCCCTGGATGCGCAGCACAAGTTCTTCCGCTTCAACCTGGCCGTGTCGGCCCACGCCGATGTGCTGATGCAGCGCATGCTGGCCTCGGTCGCCCACACCGGCGATCTGTTCGTGATCATTTCCTACACCGGGCGCACCCGCGAACTGGTCGAAGTGGCGCGCCTGGCACGTGAAAACGGCGCTTCGGTGCTGGGCCTCACCGCCGCAGGCTCGCCACTGGCCAATGCCTGCAGCCTGAGCCTGCACATTCCGCTGCCGGAAGATACCGACATCTACATGCCAATGACCTCGCGGATCATCCAGCTGACCGTGCTCGATGTACTGGCCACCGGCATGACCCTGCGCCGCGGCGTGGACTTCCAGCCTCACCTGCGCAAGATCAAGGAAAGCCTCAACGCCAGCCGTTACCCGATCGAGGACGACGACCTCAACTGA

[0061] Nucleotide sequence of gene PP3382 - PP3384 (SEQ ID NO.16):

[0062] ATGCCTGAGCATGCCCCAGACAACTCGCGCAGGGATTTTCTGCGCAAGACCTTGACCCTGATCCCTGTCGTTACCGTGGCCAGCACGGGCCTTGGCGCAGGCGCCAGCCAGCTGCTTGCGGCCCCGCAACAGCAACCGAACGTGCCCGCCACGCCACCTGCGGGCGACTATCGACCGACATTCTTCAG

[0063] CGCCGAGGAGTGGGCTTTTGTCCAGGCTGCCGTGTCGCGCATCATCCC

[0064] GGCCGATGAGCTTGGCCCAGGGGCACTCGAAGCGGGTGCCGCCGAGTT

[0065] CATCGACCGCCAGATGAATACCCCCTACGCGACTGGCGCACAGTGGTA

[0066] CATGCAAGGGCCGTTCAACGCCGACGCCCCGCCCGAACTGGGCTACCA

[0067] GCTGCAGCTCAGCCCGCAACAAATCTACCGCCTGGGCATCGCTGCCGT

[0068] GGATGGCTGGTGCAAGGCCAATGGTGGACAGGTTTTTGCTGCGCAAGA

[0069] TAGCGCTACCCGGGACCGCATTCTCAGCAAATTGGAGGCAGGAGAGCT

[0070] GGTTTTCGAATCCGTTCCGGCCAAGGTGTTCTTCAGCCTGCTGGTGCAA

[0071] AACACGCGTGAAGGGTTCTTCTGCGACCCGATTCATGGCGGCAACAAA

[0072] GGAATGGTCGGCTGGACTCAGATCGGCTTCCCCGGCGCCCGCGCCGAT

[0073] TTCATGGACTGGGTCGAGCGCAATGAGCCTTACCCGTTCCCGGCTGTAT

[0074] CGATCCGTGGTGAGAGGGCCTGAGGCATGGCGACGGTGTTGAACAAA

[0075] GTGGATGCGGTGATCGTCGGCTTCGGCTGGGCCGGTGCGATCATGGCC

[0076] AAAGAGCTGACCGAGGCCGGGCTGCACGTGGTAGCCCTGGAGCGGGG

[0077] GCCGATGCAGGATACCTACCCCGAAGGCAGCTACCCGCAGGTGATCGA

[0078] TGAGCTGACCTACAGCGTGCGCAAGAAGCTGTTCGTCGATGTATCGAA

[0079] AGAAACCGTCACTGTCCGCCATAGCGTGAATGACGTGGCATTGCCCAAT

[0080] CGCCAGCTGGGCGCATTCCTGCCGGGCAAGGGCGTGGGGGGCGCGGG

[0081] CCTGCACTGGTCGGGTGTGCACTTCCGGGTCGACCCCGTCGAGTTGCG

[0082] CCTGCGCAGCCACTATGAAGAGCGCTACGGGCGCACGTTCATTCCCGA

[0083] AGGCATGACTATCCAGGACTTCGGCGTCAGTTACGAAGAGCTGGAGCC

[0084] CTATTTCGACTTTGCCGAAAAGGTCTTTGGCACTTCAGGCCAGGCCTGG

[0085] ACCGTCAAAGGCCAGGTGGTCGGTGAAGGGAAGGGCGGCAACCCCTA

[0086] TGCGCCGGACCGTTCCAACCCGTTCCCGCTGCCCGCGCAGAAGAACGT

[0087] TGTATCGGCAAGGCTGTTCGAAAAGGCTGCCACCAGCCTGGGCTACAA

[0088] ACCCTACAACCTGCCGTCGGCCAACACGTCGGGGCCATACACCAACCC

[0089] CTACGGGGCGCAGATGGGGCCTTGCAACTTCTGCGGTTTCTGCAGCGG

[0090] CTACGTGTGTTACATGTACTCCAAGGCCTCGCCCAACGTGAATATCCTG

[0091] CCGGCGCTGCGCCAGGTGCCCAACTTCGAGTTGCGGCCCAATGCCCAT

[0092] GTGCTGCGGGTGAACCTGGACGACAGCAAGCGCAGGGCCACCGGCGT

[0093] GACCTACATCGATGCCCAGGGGCGCGAGGTGGAGCAGCCGGCAGAGC

[0094] TGGTGATTCTGGCGGCGTTCCAGTTCAACAACGTGCGTCTGATGCTGCT

[0095] TTCCGGCATTGGCAAACCTTACGACCCGGTAAAGAACGAGGGTGTGGT

[0096] CGGGCGTAACTTCGCCTATCAGAACATGGGTACAGTGAAGGCGTTCTTC

[0097] GACAAGGACACCTACACCAACAACTTCATCGGCGCGGGTGGCAATGGC

[0098] ATTGCCATCGACGATTTCAACGCCGACAACTTCGACCATGGCCCGCACG

[0099] GCTTCGTCGGCGGTTCGCCAATGTGGGTGAACCAGGCCGGCAGCCGGC

[0100] CGATTGCCGGTACCTCCAACCCGCCGGGCACTCCGGCCTGGGGCAGTG

[0101] CCTGGAAGAAAGCCACGGCCGACTACTACACCCACCAGGTGTCGATGG

[0102] ACGCCCACGGCGCACACCAGTCCTACCGTGGCAATTACCTGGACCTGG

[0103] ACCCCACCTACCGCGATGCCTACGGTCAGCCGCTGCTGCGCATGACGTT

[0104] CGACTGGCAGGAAAACGACATCAAGATGAACCAGTTCATGGTCGACAA

[0105] GCTGAGCAAGATCGCCCAGGCGATGAACCCCAAGGCCATTGCCGTGCT

[0106] GGGCAAGCAGGTCAAGGACCACTTCAACACCACCAGTTACCAGACCA

[0107] CCCACCTGAACGGTGGGGCGATCATGGGCACTGACCCCAAGACCAGTG

[0108] CACTGAACCGCTACCTGCAAAGCTGGGACGTACACAACGTGTTCGTTC

[0109] CGGGGGCTTCGGCGTTCCCGCAGGGGCTGGGTTACAACCCGACCGGGC

[0110] TGGTGGCTGCGCTCACGTACTGGTCGGCCCGCGCCATCCGTGAGCAGT

[0111] ACCTGAAAAACCCCGGTCCGTTGGTCCAGGCTTGAGGAGCGATGAGCA

[0112] TGAAGACACTGTTGATCGCCACCCTGGTGCTGGGCGCCGGTGCGGCTG

[0113] CACAGGCCGTAGCGAATGACGATGCGCAGGTACGCCTGGGCGAGTACC

[0114] TGGCCCGCGCCGGTGACTGCGTGGCCTGCCATACCGCCAAAGGCGGCA

[0115] AACCCTTTGCCGGCGGGTTGCCGATGGAAACGCCGATTGGCACGGTGT

[0116] ACTCCACCAACATCACCCCGGCGGCCAGTGGCATTGGCCAGTACAGCT

[0117] TCGAAGACTTCGACCAGGCCGTACGCAGGGGGATCGGCAAGGACGGC

[0118] AGTACGCTCTATCCGGCCATGCCATACCCGTCGTATGCGCGGGTCAGCG

[0119] AGCAGGACATGCAGGCGCTCTACGCCTATTTCATGAAGGGCGTGGCGC

[0120] CTGTCGAGCAGGCGAACAAGGCCTCTGACATTCCCTGGCCGCTGAGCA

[0121] TGCGCTGGCCACTGGCAATCTGGCGCGGCGTGTTCGCACCAGAGGCCA

[0122] AGCCCTGGCAGGCATCGGCGACAGCTGACCCTGTGGTGAACCGCGGTG

[0123] CGTACCTGGTCGAGGGCCTTGGGCATTGTGGCGCTTGTCATACGCCGCG

[0124] GGCGCTGACCATGCAGGAGAAGGCTCTGAGTGCGGCCGATGGCGAGC

[0125] AGTTTCTGGCCGGCAGCGCGCCGCTGGAAGGCTGGATTGCCAAGAACC

[0126] TGCGTGGCGATCACAAAGACGGCCTGGGCAGCTGGAGCGAAGCGCAG

[0127] TTGGTGCAGTTTCTCAAGACTGGGCGCAGTGATCGCAGCGCCGTGTTC

[0128] GGCGGCATGAGCGATGTGGTCGAGCACAGCATGCAGCACATGAGTGAT

[0129] GCCGACCTGACCGCTATCGCCCGCTACCTGAAAACCCTGCCGCCGAGT

[0130] AATCCGGATGACCAGCTACATGTGTACGACAAGCAGGTAGCCGATGCG

[0131] CTATGGAAGGGTGACGACAGCAAGCCTGGGGCGGCGGTGTACATCGAC

[0132] AACTGCGCGGCCTGCCACCGCACCGACGGGCAGGGCTACACCCGCGTGTTCCCGGCTTTGGCCGGCAACCCGGTGGTGCAGACTGCGGATGCCACGTCGCTGATCCATGTGGTGCTCGCCGGTGGCACGGTACCGGCAACGCACAGTGCACCGTCGAACTTCACCATGCCGGCTTTCGGCTGGCGCCTGAGTGACCAGGAGGTTGCCGAGGTGGTGAATTTCATTCGCAGCAGTTGGGGTAACCAAGGCAGTGCCGTCACCGCCGGTGATGTAAAGTCGCTTCGCTGA

[0133] Nucleotide sequence of gene PP3623 (SEQ ID NO.17):

[0134]

[0135] Gene PP4232 nucleotide sequence (SEQ ID NO.18):

[0136]

[0137] Nucleotide sequence of gene tktA (SEQ ID NO.19):

[0138] ATGCCCAGCCGTCGTGAACGTGCCAACGCCATTCGTGCCCTCAGCATGGATGCCGTGCAAAAGGCCAACAGCGGCCACCCAGGTGCCCCCATGGGCATGGCGGATATCGCCGAAGTGCTTTGGCGCGACTACCTGAAGCACAACCCGAGCAACCCGAGCTTCGCCGACCGTGACCGCTTCGTGCTGTCCAACGGCCACGGCTCGATGCTGATCTACTCGCTGCTGCACCTGACCGGCTACGACGTCACCATCGATGACATCAAAGGCTTCCGCCAACTGCACAGCCG

[0139] CACCCCGGGCCACCCGGAATACGGCTACACCCCAGGCGTTGAAACCAC

[0140] CACCGGCCCGCTCGGCCAGGGTATCGCCAACGCCGTGGGCTTCGCCCT

[0141] GGCCGAAAAAGTACTGGCTGCCCAGTTCAACCGTGACGGCCACAATAT

[0142] CGTCGACCACAACACCTATGTGTTCCTCGGCGACGGCTGCATGATGGA

[0143] AGGCATCTCCCATGAAGTCGCCTCGCTGGCCGGCACCCTGGGCCTGAA

[0144] CAAGCTGATCGCCTTCTACGATGACAATGGCATCTCCATCGACGGCGAA

[0145] GTGCACGGCTGGTTCACCGACAACACCCCGGCGCGCTTCGAAGCCTAC

[0146] AACTGGCAGGTGATCCGCAACGTCGACGGCCACGATGCCGAAGAAATC

[0147] AAGATGGCCATCGAGACCGCCCGCAAGAGCGATCGCCCGACCCTGATC

[0148] TGCTGCAAGACCACCATCGGTTTCGGTTCGCCGAACAAGCAGGGCAAG

[0149] GAAGACTGCCACGGTGCCCCGCTGGGCAACGACGAAATCGCCCTGACC

[0150] CGCCAGGCCCTGAACTGGAACCACGGCCCGTTCGAAATCCCGGCCGAC

[0151] ATCTACGCCGAGTGGGATGCCAAGGCCGCCGGTGCCAAGGTTGAAGCC

[0152] GAGTGGAACCAGCGCTTCGACGCCTACGCCAAGGCCTACCCGGAGCTG

[0153] GCTGCCGAGTTCAAGCGCCGTGCCAGCGGCGAGCTGCCGGCCGACTTC

[0154] AGCGAAAAGGCCCAGGCCTACATCAACGAAGTGGCTGCCAAAGGCGA

[0155] AACCATCGCCAGCCGCAAGGCCAGCCAGAACGCCCTGAACGCCTTCG

[0156] GCCCGCTGCTGCCCGAGTTCCTCGGCGGTTCGGCGGACCTGGCCGGCT

[0157] CCAACCTGACCCTGTGGAAAGGTTGCAAGGGCGTCGAAGCCAATGAC

[0158] GCCAGCGGCAACTACGTGTTCTACGGCGTGCGCGAGTTCGGCATGACC

[0159] GCCATCATGAACGGCGTTGCCCTGCACGGTGGCCTGGTGCCTTACGGC

[0160] GCGACCTTCCTGATGTTCATGGAATACGCCCGCAACGCCGTGCGCATGT

[0161] CGGCCCTGATGAAGCAGCGCGTGATCCACGTGTACACCCACGACTCCA

[0162] TCGGTCTGGGCGAAGACGGCCCGACGCACCAGCCGATCGAGCAGCTG

[0163] ACCAGCCTGCGCAGCACCCCGAACCTGGACACCTGGCGCCCGGCCGA

[0164] CGCGGTGGAATCCGCCGTGTCCTGGAAAACGCCCTGGAGCGCAAGG

[0165] ACGGCCCATCGGCGCTGATCTTCTCGCGCCAGAACCTGCAGCACCAGG

[0166] ATCGCGATGCCCAGCAGATCGCCGACATCAGCCGCGGTGGTTATGTGCT

[0167] CAAGGACTGCGCCGGCGAGCCTGAACTGATTCTGATCGCCACCGGTTC

[0168] CGAAGTGGGCCTGGCTGTTCAGGCCTTCGACAAGCTGACCGAGCAAG

[0169] GCCGCAAGGTGCGCGTGGTTCCATGCCATGCACCAGCGTGTTCGATGC

[0170] CCAGGACGCTGCCTACAAGCAGTCCGTGCTGCCGCTGGAAGTCGGTGC

[0171] GCGCATCGCCATCGAAGCTGCCCACGCCGACTTCTGGTACAAGTACGT

[0172] CGGCCTGGAAGGTCGTATCATCGGCATGACCACCTACGGTGAGTCGGC

[0173] GCCGGCTTCGGCATTGTTCGAAGAGTTTGGCTTCACCCTGGAGAACATC

[0174] CTCGGTACTGCCGAAGAGCTGCTGGAAGACTGA

[0175] Gene tal nucleotide sequence (SEQ ID NO.20):

[0176] ATGACCTCCAAGCTGGAACAACTCAAGCAGTTCACCACCGTGGTCGCCGACACCGGGGACCTGGACGCCATCACCCGCCTGAAGCCGGTCGATGCCACCACCAACCCGTCGCTGCTGCTCAAGGCTGCTGCCATCCCGGGCTACGCCGACCTGCTTAAACAGGTGAAGGCCGACGCCAAGGGTAATGTCGACCTGGCCTGCGACAAGTTTGCAGTGGCGGTAGGCTCGGGCATTCTCAAGGTCATCCCGGGGCGTATCTCCACCGAGGTGGATGCACGCCTGTCGTTCGATGAGCCAGCCCTGCTGAACAAGGCTCGTCAGCTGATCGCCCTGTACGAGGCGGCCGGAGTGGCAAAAGAGCGTGTACTGATCAAGCTGGCCTCCACCTGGGAAGGCATTCGCGCCGCCGAGCAGCTGGAGAAGGAAGGTATCCAGACCAACCTGACCCTGCTGTTCTCCTTCGCCCAGGCCCAGGCTTGTGCCGATGCCGGGGTGTTTTTGATTTCGCCGTTCGTGGGCCGTATCTACGACTGGTACAAGAAGAGCACCGGCCAGGAATACGTGGGCGCCGAGGACCCAGGCGTGCAGTCGGTCACCCGCATCTACAACTACTACAAGGCCAATGGTTACAACACCGTGGTCATGGGCGCCAGCTTCCGCAATATCGGCCAGATCGAACAACTGGCCGGCTGTGACCGCCTGACCATCAGCCCCGAACTGCTGCAGCAGTTGAGTGATGACCAGGGTGAATTGCCGCAGGTGCTGAAACCGGGCAACGCCGGTGAAGCCAAGCAGCACCTGAACGAAAGCCAGTTCCGCTGGGCGATGAACGAAGACGCCATGGGCACCGAGAAACTGGCCGAAGGTATCCGTCAGTTTGCACGGGACCAGGAAAAGCTTGAGAAGTTGATAGCTGAAAAGGCCTGA

[0177] Nucleotide sequence of gene ppsA (SEQ ID NO.21):

[0178] ATGAAACGAACCGCGTTCTTCATCTCCGACGGCACCGGTATCACTGCCGAAACCCTGGGCCAGAGTTTGCTCGCGCAATTCGAGAGCATTCCCTTCAACAAATTCACCCGCCCTTACATCGACTCGCCGGACAAAGCGCGGGTCATGGTCCAGCAAATCAACGCTGCGGCCGAGCGGGATGGGGTCCGCCCGATCATCTTCGACACCATTGTCAACCAGGACATCCGCGAGATCCTGGCGACGTCGAATGGCTTCATGATCGACATCTTTTCTTCGTTTTTATCCCCACTTGAGCAGGAATTGATTGCCCATTCGTCGTATTCCGTGGGCAAATCCCACTCGATTGGTGGCAATTCCAACTACATGGAACGCATCGAGGCGGTGAATTTCGCCCTGGATAACGACGATGGTGCACGCACCCACTACTACGACAAAGCCGACCTGATTCTGGTTGGCGTGTCGCGTTGCGGCAAAACCCCAACCTGCCTGTACATGGCCATGCAGTTCGGCATCCGTGCCGCCAATTACCCGCTGACCGAGGATGACATGGAGCGCCTGCAGCTGCCGGCGGTGCTGAAAAAGCACCACAGCAAGCTGTTCGGCCTGACCATCGACCCCGACCGCCTCACCGCCATCCGCCACGAACGCAAGCCCAACAGCCGTTATTCCAGCTTTGCCCAGTGCGAATTCGAAGTGCGTGAAGTGGAAAGCCTGTTCCGCAGGGAGAACATTCCCAATATCAATTCCACGCATTTTTCGGTGGAAGAGATTTCCGCCAAGATCCTGGTCGAAAAAGGCGTGGAGAGACGGTTCAAGTAA Promoter P rpsj12 Nucleotide sequence (SEQ ID NO.22):

[0179] TCACTCGACCGATTGAAAAAACCCCCGTTCAGCGGGAGTTTTTTTTATTGGGTTGACACTATCTGGGGGCGTCTATAGAATCACGCCATCTTTCAGCGAGCGTAGTGCGTCCACAGGGAACAGCCTGGAGTCTGAAATCCA

[0180] Expression vector pBR1 nucleotide sequence (SEQ ID NO.23):

[0181]

[0182] TCGAGGGCAGCAAGGCACGTCACACGCGCATTCAGGCGTTCTACGAGG

[0183] CCCTGGAGCGGCCACCAGTGGGCCACGTCACCATCAGCCCGCAAGCG

[0184] GTCGAGCCACGCGCCTATGCACCGCAGGGATTGGCCGAAAAGCTGGGA

[0185] ATCTCAAAGCGCGTTGAGACGCCGGAAGCCGTGGCCGACCGGCTGAC

[0186] AAAAGCGGTTCGGCAGGGGTATGAGCCTGCCCTACAGGCCGCCGCAGG

[0187] AGCGCGTGAGATGCGCAAGAAGGCCGATCAAGCCCAAGAGACGGCCC

[0188] GAGACCTTCGGGAGCGCCTGAAGCCCGTTCTGGACGCCCTGGGGCCGT

[0189] TGAATCGGGATATGCAGGCCAAGGCCGCCGCGATCATCAAGGCCGTGG

[0190] GCGAAAAGCTGCTGACGGAACAGCGGGAAGTCCAGCGCCAGAAACAG

[0191] GCCCAGCGCCAGCAGGAACGCGGGCGCGCACATTTCCCCGAAAAGTG

[0192] CCACCTGGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAAC

[0193] GCAAGCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCG

[0194] ATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCC

[0195] AGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTG

[0196] GATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCT

[0197] GATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGA

[0198] TTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATG

[0199] ACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGC

[0200] TGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCG

[0201] GTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGG

[0202] CCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAG

[0203] CGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCC

[0204] TGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGC

[0205] AATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCAC

[0206] CAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGT

[0207] CTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCA

[0208] GCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGAT

[0209] CTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAA

[0210] ATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGA

[0211] CCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTT

[0212] GGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTC

[0213] CCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGA

[0214] GCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGC

[0215] CATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTT

[0216] CGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGA

[0217] TCTCATGCTGGAGTTCTTCGCCCACCCCCATGGGCAAATATTATACGCAA

[0218] GGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTTT

[0219] GTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTTTTTA

[0220] TGCATGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTC

[0221] ATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTG

[0222] AGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGC

[0223] TTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGAT

[0224] AACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCG

[0225] CAATTAACCCTCACTAAAGGGAACAAAAGCTGGGTACCGGGCCCCCCC

[0226] TCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGG

[0227] GGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAATT

[0228] CGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACA

[0229] ACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGC

[0230] AGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCAC

[0231] CGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGAAATT

[0232] GTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAG

[0233] CTCATTTTTTAACCAATAGGCCGTACTGCGATGAGTGGCAGGGCGGGGC

[0234] GTAATTTTTTTAAGGCAGTTATTGGTGCCCTTAAACGCCTGGTTGCTACG

[0235] CCTGAATAAGTGATAATAAGCGGATGAATGGCAGAAATTCGAAAGCAA

[0236] ATTCGACCCGGTCGTCGGTTCAGGGCAGGGTCGTTAAATAGCCGCTTAT

[0237] GTCTATTGCTGGTTTACCGGTTTATTGACTACCGGAAGCAGTGTGACCG

[0238] TGTGCTTCTCAAATGCCTGAGGCCAGTTTGCTCAGGCTCTCCCCGTGGA

[0239] GGTAATAATTGACGATATGATCATTTATTCTGCCTCCCAGAGCCTGATAA

[0240] AAACGGTGAATCCGTTAGCGAGGTGCCGCCGGCTTCCATTCAGGTCGA

[0241] GGTGGCCCGGCTCCATGCACCGCGACGCAACGCGGGGAGGCAGACAA

[0242] GGTATAGGGCGGCGAGGCGGCTACAGCCGATAGTCTGGAACAGCGCAC

[0243] TTACGGGTTGCTGCGCAACCCAAGTGCTACCGGCGCGGCAGCGTGACC

[0244] CGTGTCGGCGGCTCCAACGGCTCGCCATCGTCCAGAAAACACGGCTCA

[0245] TCGGGCATCGGCAGGCGCTGCTGCCCGCGCCGTTCCCATTCCTCCGTTT

[0246] CGGTCAAGGCTGGCAGGTCTGGTTCCATGCCCGGAATGCCGGGCTGGC

[0247] TGGGCGGCTCCTCGCCGGGGCCGGTCGGTAGTTGCTGCTCGCCCGGAT

[0248] ACAGGGTCGGGATGCGGCGCAGGTCGCCATGCCCCAACAGCGATTCGT

[0249] CCTGGTCGTCGTGATCAACCACCACGGCGGCACTGAACACCGACAGGC

[0250] GCAACTGGTCGCGGGGCTGGCCCCACGCCACGCGGTCATTGACCACGT

[0251] AGGCCGACACGGTGCCGGGGCCGTTGAGCTTCACGACGGAGATCCAG

[0252] CGCTCGGCCACCAAGTCCTTGACTGCGTATTGGACCGTCCGCAAAGAA

[0253] CGTCCGATGAGCTTGGAAAGTGTCTTCTGGCTGACCACCACGGCGTTC

[0254] TGGTGGCCCATCTGCGCCACGAGGTGATGCAGCAGCATTGCCGCCGTG

[0255] GGTTTCCTCGCAATAAGCCCGGCCCACGCCTCATGCGCTTTGCGTTCCG

[0256] TTTGCACCCAGTGACCGGGCTTGTTCTTGGCTTGAATGCCGATTTCTCT

[0257] GGACTGCGTGGCCATGCTTATCTCCATGCGGTAGGGGTGCCGCACGGTT

[0258] GCGGCACCATGCGCAATCAGCTGCAACTTTTCGGCAGCGCGACAACAA

[0259] TTATGCGTTGCGTAAAAGTGGCAGTCAATTACAGATTTTCTTTAACCTAC

[0260] GCAATGAGCTATTGCGGGGGGTGCCGCAATGAGCTGTTGCGTACCCCC

[0261] CTTTTTTAAGTTGTTGATTTTTAAGTCTTTCGCATTTCGCCCTATATCTAG

[0262] TTCTTTGGTGCCCAAAGAAGGGCACCCCTGCGGGGTTCCCCCACGCCT

[0263] TCGGCGCGGCTCCCCCTCCGGCAAAAAGTGGCCCCTCCGGGGCTTGTT

[0264] GATCGACTGCGCGGCCTTCGGCCTTGCCCAAGGTGGCGCTGCCCCCTT

[0265] GGAACCCCCGCACTCGCCGCCGTGAGGCTCGGGGGGCA

[0266] Example 1 Recombinant genetically engineered bacteria for efficient biosynthesis of gallic acid and preparation method thereof The recombinant genetically engineered bacteria provided in this example were prepared according to the following method:

[0267] 1) Pseudomonas putida KT2440 was taken, and the endogenous pyruvate kinase gene pykA (SEQ ID NO.9), pyk (SEQ ID NO.10), protocatechuate 3,4-dioxygenase gene pcaGH (SEQ ID NO.11), gallate dioxygenase gene galA (SEQ ID NO.12), gallate transporter gene galP (SEQ ID NO.13), gallate transporter gene galT (SEQ ID NO.14), DNA transcription repressor gene hexR (SEQ ID NO.15), gluconate-2-dehydrogenase gene PP3382-PP3384 (SEQ ID NO.16), gluconate-2-dehydrogenase gene PP3623 (SEQ ID NO.17), and gluconate-2-dehydrogenase gene PP4232 (SEQ ID NO.18) were knocked out by two-step homologous recombination.

[0268] 2) Take the transketolase gene tktA (SEQ ID NO.19), the transaldolase gene tal (SEQ ID NO.20), the phosphoenolpyruvate synthase gene ppsA (SEQ ID NO.21) and the promoter P rpsj12(SEQ ID NO.22) and integrated into the knockout strain obtained in step 1) by two-step homologous recombination technology to obtain a recombinant strain.

[0269] 3) Take the 3-deoxy-7-phosphoheptanoate synthase gene aroG (SEQ ID NO.1), the 3-dehydroshikimate dehydratase gene quiC (SEQ ID NO.2) and the 4-hydroxybenzoate monooxygenase gene pobA (SEQ ID NO.4) and respectively combine them with the promoter P rpsj12 (SEQ ID NO.22) was constructed on the pBR1 (SEQ ID NO.23) vector, and the open reading frame and site homology arms were constructed on the plasmid pk18mobsacB, which was transferred into the recombinant strain obtained in step 2) by electroporation, and the engineered strain was obtained by two-step homologous recombination screening.

[0270] Example 2 Method for Efficient Biosynthesis of Gallic Acid

[0271] The recombinant genetically engineered bacteria constructed in Example 1 were inoculated into a shake flask culture medium at a culture temperature of 30° C., a pH of 6, and a rotation speed of 150-250 rpm to obtain the product;

[0272] Wherein, the above shake flask culture medium components are:

[0273] 20-40g / L glucose, 4-10g / L (NH4)2SO4, 5-20g / L yeast extract, 5-10g / LMgSO4·7H2O, 4-8g / L Na2HPO4, 2-4g / L K2HPO4, 0.01-0.1mg / L H3BO3, 0.1-1mg / L CuCl2, 0.1-1mg / L Na2EDTA, 0.1-1mg / L CoCl2, 0.5-2mg / L ZnCl2, 1-3mg / L MnCl2, and the rest is water.

[0274] A preferred culture medium composition in this embodiment is:

[0275] 20g / L glucose, 4g / L (NH4)2SO4, 5g / L yeast extract, 2g / L MgSO4·7H2O, 7g / L Na2HPO4, 3g / L KH2PO4, 0.05mg / L H3BO3, 0.5mg / L CuCl2, 0.5mg / LNa2EDTA, 0.4mg / L CoCl2, 1mg / LZnCl2, 1mg / L MnCl2, and the rest is water.

[0276] Example 3 Method for Efficient Biosynthesis of Gallic Acid

[0277] 1) The recombinant genetically engineered bacteria constructed in Example 1 were inoculated into LB shake flask medium and cultured at 30°C, pH 6, and 200-250 rpm for 6 h to form a first-stage seed solution;

[0278] 2) The first-stage seed solution is inoculated into the second-stage seed bottle in LB medium and cultured under the above conditions for 18 hours to obtain the second-stage seed solution. The second-stage seed solution is inoculated into a fermentation tank containing fermentation medium at a temperature of 28-30°C, an initial pH of 6, and an initial dissolved oxygen of 30%;

[0279] 3) During the fermentation process, the pH was maintained at 6 ± 0.2, and glucose was fed at a rate of 4-8 g / L / h.

[0280] 4) After 24 hours of fermentation, the dissolved oxygen is adjusted from 30% to 10%;

[0281] The LB medium components are:

[0282] 5g / L yeast extract, 10g / L peptone, 10g / L sodium chloride.

[0283] The technical solution of the present invention is further illustrated by experiments below.

[0284] In the following experimental examples, the concentrations of gallic acid and protocatechuic acid were determined by HPLC. Specifically, reversed-phase chromatography with UV detection was used on a Diamonsil I 5μm column, 250×4.6mm. Mobile phase A: 0.1% formic acid; mobile phase B: methanol. Elution conditions were: B 10%-50% (0-15 min), 50%-10% (15-16 min), and 10% (16-22 min), flow rate 1 mL / min, column temperature 40°C, detection wavelength 270 nm. Samples were diluted to within the range of the standard curve, centrifuged at 12,000 rpm for 10 min, and filtered through a 0.22μm nylon 66 filter.

[0285] Experimental Example 1 Construction process of recombinant genetically engineered bacteria for efficient biosynthesis of gallic acid

[0286] 1. Construction of protocatechuic acid biosynthesis strain

[0287] Pseudomonas putida KT2440 was selected as the production host. First, the endogenous protocatechuate 3,4-dioxygenase gene pcaGH was knocked out by two-step homologous recombination technology to block the oxidative degradation of the key product protocatechuic acid.

[0288] In the present invention, both gene knockout and gene integration in Pseudomonas are performed using two-step homologous recombination technology. Taking the knockout of the protocatechuate 3,4-dioxygenase gene pcaGH in P. putida KT2440 as an example, the specific process is as follows:

[0289] Using the P. putida KT2440 genome as a template, PCR amplified the upstream and downstream homology arms of the pcaGH gene (UppcaGH and DnpcaGH fragments, each 1000 bp in length). After purification, the fragments were cloned into the suicide plasmid pk18mobsacB between the BamHI and HindIII sites using a one-step method, generating the derivative plasmid pk18-pcaGH. These plasmids were electroporated into P. putida KT2440. Under antibiotic selection, only strains that successfully underwent a single crossover were able to grow normally. Single-crossover strains were verified using colony PCR. Positive strains were inoculated into LB tubes containing Kan overnight, then streaked onto antibiotic-free LB plates containing 25% sucrose. Single colonies that grew were spotted onto LB plates containing Kan. Colonies that successfully underwent a double crossover were screened using the sucrose-lethal gene sacB and antibiotics. Positive colonies were then verified by PCR, resulting in the P. putida KT2440ΔpcaGH strain.

[0290] At the same time, this experimental example selects the 3-deoxy-7-phosphoheptanoate synthase gene aroG (nucleotide sequence SEQ ID NO.1) from Escherichia coli that relieves feedback inhibition and the Pseudomonas 3-dehydroshikimate dehydratase gene quiC (nucleotide sequence SEQ ID NO.2) as examples, and the specific process is as follows:

[0291] To enhance the flux of protocatechuate synthesis from simple carbon sources, the 3-deoxy-7-phosphoheptanoate synthase gene aroG and the Pseudomonas 3-dehydroshikimate dehydratase gene quiC were co-constructed into a promoter with P rpsj12 The plasmid pBBR1 was used to obtain the plasmid pBBR1-aroGquiC, which was then transformed into the strains P. putida KT2440 and P. putida KT2440ΔpcaGH by electrochemical transformation to obtain the engineered strains GA0 and GA1, respectively. The plasmid construction process specifically includes: PCR (polymerase chain reaction), restriction endonuclease digestion, ligase ligation (or one-step cloning and recombination), chemical transformation, plasmid extraction, PCR and enzyme verification, and electrochemical transformation. DNA polymerase, DNA restriction endonuclease, T4 ligase or homologous recombination enzyme was used for plasmid construction and purchased from Takara Bio and Thermo Fisher Scientific, respectively. Recombinant construction, plasmid extraction, and gel recovery kits were all purchased from Novozymes.

[0292] The strains GA0 and GA1 were activated on LB plates, and single colonies were picked and placed in LB tube culture medium. The culture conditions were 30°C, 220 rpm, and the culture time was 16-20 hours. Subsequently, 2% of the culture solution was transferred to 50 mL of fermentation medium. The culture conditions were 30°C, 220 rpm, and samples were taken every 24 hours. The optical density (OD) at a wavelength of 600 nm was measured. 600 ) were used to detect cell growth, and high performance liquid chromatography (HPLC) was used to analyze metabolites in the fermentation broth.

[0293] The culture medium recipe is as follows: LB medium (5 g / L yeast extract, 10 g / L peptone, 10 g / L NaCl) was used for plasmid construction and as a fermentation seed medium. Fermentation medium (20 g / L glucose, 4 g / L (NH₄)₂SO₄, 5 g / L yeast extract, 2 g / L MgSO₄·7H₂O, 7 g / L Na₂HPO₄, 3 g / L KH₂PO₄, 0.05 mg / L H₃BO₃, 0.5 mg / L CuCl₂, 0.5 mg / L Na₂EDTA, 0.4 mg / L CoCl₂, 1 mg / L ZnCl₂, 1 mg / L MnCl₂, and the remainder is water) was used for all shake flask fermentation experiments. All reagents were purchased from MacLean Biotechnology.

[0294] Table 1 Effect of protocatechuic acid degradation pathway on protocatechuic acid production by engineered strains

[0295]

[0296] Fermentation results are shown in Table 1. These results demonstrate that enhancing the protocatechuic acid biosynthesis pathway in wild-type Pseudomonas putida resulted in protocatechuic acid accumulation of 0.02 g / L. The native protocatechuic acid utilization pathway in wild-type Pseudomonas strains is detrimental to protocatechuic acid accumulation. However, by further enhancing the protocatechuic acid biosynthesis pathway in Pseudomonas putida strains with the degradation pathway gene pcaGH knocked out, the engineered strain achieved protocatechuic acid production of 1.38 g / L.

[0297] 2. Effects of different PobA strains on gallic acid production

[0298] To achieve de novo synthesis of gallic acid, an additional monooxygenase must be introduced to convert protocatechuate to gallic acid. Most naturally occurring PobA strains possess high 4-hydroxybenzoate monooxygenase activity, while their protocatechuate monooxygenase activity is relatively low. Therefore, this experiment screened and introduced 4-hydroxybenzoate monooxygenase PobA and its mutants from various sources to obtain a strain engineered for gallic acid production.

[0299] First, the P with a complete open reading frame rpsj12 -aroGquiC (promoter Prpsj12 The complete fragment connected to the genes aroG and quiC) was integrated into the pykA site of the P.putida KT2440ΔpcaGH strain by two-step homologous recombination technology to obtain strain GA3. Further, PobA and various mutants (SEQ ID NO.3-8) from P.putida and Pseudomonas aeruginosa were respectively introduced into the pyk site in the engineered strain GA3 to generate a series of strains GA4-GA9. The fermentation results are shown in Table 2. Different sources and different mutants have a greater impact on the production of gallic acid. Among them, the accumulation of gallic acid was not detected in the fermentation broth of GA4 and GA7, indicating that natural PpPobA and PaPobA cannot hydroxylate protocatechuic acid to produce gallic acid. The PobA mutants reported to have protocatechuic acid monooxygenase activity (corresponding strains GA5, GA6, GA8, GA9) all showed different gallic acid synthesis capabilities. Among them, the strain carrying the PppobA mutant T294AY386F (SEQ ID NO. 4) had the highest gallic acid production, reaching 0.81 g / L.

[0300] Table 2 Effects of different pobA on gallic acid production

[0301]

[0302] 3. Strengthening shikimic acid precursors to promote efficient production of gallic acid

[0303] Furthermore, to achieve efficient gallic acid synthesis, the present invention strengthens the shikimate pathway to ensure an adequate supply of the precursor protocatechuic acid. Specifically, first, to achieve efficient gallic acid accumulation, the present invention blocks the degradation and internalization pathways of gallic acid in Pseudomonas, knocking out the galA, galP, and galT genes in strain GA5 to generate strain GA10. Subsequently, based on strain GA10, the expression of genes in the pentose phosphate pathway is further enhanced to increase the level of erythrose 4-phosphate in the cell. These genes include the transketolase genes tktA and tal, and the phosphoenolpyruvate synthase gene ppsA.

[0304] The results are shown in Table 3. In the series of strains that enhance the production of shikimic acid precursors, the fluxes of protocatechuic acid and gallic acid were improved to varying degrees, with the highest yield reaching 1.92 g / L.

[0305] Table 3 Effects of enhancing the expression of different genes on gallic acid production

[0306]

[0307]

[0308] 4. Improve glucose utilization and promote efficient production of gallic acid

[0309] Furthermore, in order to improve the carbon yield of the gallic acid production process, the present invention blocks multiple glucose utilization pathways in Pseudomonas and rewires them into one main pathway to improve the efficiency of Pseudomonas in converting glucose into 2-keto-3-deoxy-6-phosphogluconate. Figure 1 As shown, glucose can be converted into gluconic acid and 2-ketogluconic acid by Pseudomonas. During the fermentation process, 2-ketogluconic acid easily accumulates in large quantities, resulting in a decrease in pH during the fermentation process, which affects cell growth and the efficiency of glucose conversion to gallic acid.

[0310] Based on the engineered strain GA17, the gluconate-2-dehydrogenase genes PP3382-PP3384, PP3623, and PP4232, which convert gluconic acid into 2-ketogluconic acid, were knocked out respectively through two-step homologous recombination technology. Furthermore, the present invention also knocked out the repressor factor hexR in the glucose utilization pathway to enhance the utilization efficiency of gluconic acid, generating a series of strains GA18-GA23.

[0311] The results are shown in Table 4. After the glucose utilization pathway was reconstructed, the gallic acid production of the series of strains increased to varying degrees. Among them, the engineered strain GA23, which completely blocked the 2-ketogluconic acid synthesis pathway, had the highest yield, reaching 3.14 g / L.

[0312] Table 4 Effect of enhancing glucose utilization efficiency on gallic acid production

[0313]

[0314] Through this experimental example, it can be seen that the present invention combines the metabolic pathway of Pseudomonas itself, introduces exogenous genes, blocks competitive pathways, enhances the shikimate pathway flux, and improves the supply of the key precursor protocatechuic acid. Knocking out the degradation genes of key intermediates and products greatly promotes the stability of metabolic flow and the accumulation of products. And screening highly active and highly specific 4-hydroxybenzoate oxygenase PobA, drives the synthesis of gallic acid from simple carbon sources to the greatest extent. Thus, a genetically engineered bacterium that efficiently produces gallic acid is obtained.

[0315] Experimental Example 2: Synthesis of Gallic Acid by Fed-Batch Fermentation in a 5 L Fermenter

[0316] The above-mentioned high-gallic acid-producing Pseudomonas engineered strain GA23 was used to biosynthesize gallic acid in a 5L fermenter, with an initial liquid volume of 2L (using the LB medium in Experimental Example 1), a fermentation temperature of 30°C, a pH of 5.8-6.4, an initial dissolved oxygen setting of 30%, and a tank pressure of 0-5Pa. The OD value of the first-stage seed solution was 0. 600When the concentration is in the range of 2-4, 10% is inoculated into the second-level seed bottle (using the LB medium in Experimental Example 1), and the OD of the second-level seed liquid is 600 Between 4 and 8 hours, 5% to 20% of the fermentation medium was inoculated into the fermenter (using the fermentation medium in Experimental Example 1), and glucose was added during the fermentation process to maintain the concentration at 3 to 5 g / L. After 48 hours of fermentation, the dissolved oxygen was adjusted to 8 to 15%.

[0317] As shown in Table 5, during the 72 h fermentation in a 5 L fermentor, the engineered strain GA23 cells grew to 36.6, and the yield of de novo gallic acid synthesis reached 22.7 g / L. At the same time, the precursor protocatechuic acid accumulated at 4.6 g / L.

[0318] Thus, the present invention has achieved a gallic acid yield of 22.7 g / L, which is the highest yield reported so far for de novo synthesis of gallic acid from glucose, and provides a reformation foundation and scientific basis for the industrial production of gallic acid.

[0319] From the above embodiments and experimental examples, it can be seen that the present invention constructs a genetically engineered bacterium for producing gallic acid, which can efficiently produce gallic acid by fermentation, has the advantages of high yield, stable propagation, simple fermentation process, low cost, good tolerance, etc., is suitable for industrial scale-up production, and has good application prospects.

Claims

1. A recombinant genetically engineered bacterium for biosynthesizing gallic acid, characterized in that: It uses Pseudomonas putida KT2440 as a production host and contains a recombinant Pseudomonas strain containing the 3-deoxy-7-phosphoheptanoate synthase gene aroG, the 3-dehydroshikimate dehydratase gene quiC, and the 4-hydroxybenzoate monooxygenase gene pobA. The recombinant Pseudomonas was obtained by two-step homologous recombination, wherein: The recombinant plasmid pBBR1-MCS2 containing the 3-deoxy-7-phosphoheptone synthase gene aroG, the 3-dehydroshikimate dehydratase gene quiC and the 4-hydroxybenzoate monooxygenase gene pobA was constructed. The promoter of the recombinant plasmid pBBR1-MCS2 was P rpsj12 , the promoter P rpsj12 The nucleotide sequence is shown in SEQ ID NO.22; The open reading frame and site homology arms were constructed on the plasmid pk18mobsacB, and transformed into Pseudomonas by electroporation, and the recombinant Pseudomonas was obtained by two-step homologous recombination screening; The nucleotide sequence of the 3-deoxy-7-phosphoheptoneate synthase gene aroG is shown in SEQ ID NO.1, the nucleotide sequence of the 3-dehydroshikimate dehydratase gene quiC is shown in SEQ ID NO.2, and the nucleotide sequence of the 4-hydroxybenzoate monooxygenase gene pobA is shown in SEQ ID NO.4; The recombinant Pseudomonas does not contain the protocatechuate 3,4-dioxygenase gene pcaGH, does not contain the pyruvate kinase gene pykA, does not contain the pyruvate kinase gene pyk, does not contain the gallate dioxygenase gene galA, the gallate transporter gene galP, the gallate transporter gene galT, does not contain the gluconate-2-dehydrogenase gene PP3382-PP3384, the gluconate-2-dehydrogenase gene PP3623, the gluconate-2-dehydrogenase gene PP4232, and the DNA transcription repressor gene hexR; The nucleotide sequence of the pyruvate kinase gene pyk is shown in SEQ ID NO. 10, the nucleotide sequence of the gluconate-2-dehydrogenase gene PP3382-PP3384 is shown in SEQ ID NO. 16, the nucleotide sequence of the gluconate-2-dehydrogenase gene PP3623 is shown in SEQ ID NO. 17, and the nucleotide sequence of the gluconate-2-dehydrogenase gene PP4232 is shown in SEQ ID NO. 18; The recombinant Pseudomonas further comprises a transketolase gene tktA, a transaldolase gene tal, and a phosphoenolpyruvate synthase gene ppsA; The nucleotide sequence of the transketolase gene tktA is shown in SEQ ID NO.19, the nucleotide sequence of the transaldolase gene tal is shown in SEQ ID NO.20, and the nucleotide sequence of the phosphoenolpyruvate synthase gene ppsA is shown in SEQ ID NO.

21.

2. Use of the recombinant genetically engineered bacteria according to claim 1 in the preparation of gallic acid or its preparation.

3. A method for preparing gallic acid, characterized in that: The preparation method comprises: using a carbon source as a substrate and fermenting with the recombinant genetically engineered bacteria according to claim 1, wherein the carbon source is selected from glucose.

4. The preparation method according to claim 3, characterized in that: The fermentation medium comprises: 20-40 g / L glucose, 4-10 g / L (NH4)2SO4, 5-20 g / L yeast extract, 5-10 g / L MgSO4·7H2O, 4-8 g / L Na2HPO4, 2-4 g / L K2HPO4, 0.01-0.1 mg / L H3BO3, 0.1-1 mg / L CuCl2, 0.1-1 mg / L Na2EDTA, 0.1-1 mg / L CoCl2, 0.5-2 mg / L ZnCl2, 1-3 mg / L MnCl2, and the remainder is water; The fermentation conditions are as follows: shake flask fermentation temperature of 27-32°C, initial pH of 6-6.5, and rotation speed of 150-250 rpm; fed batch fermentation temperature of 27-32°C, pH maintained at 6.2±0.2, and dissolved oxygen maintained at 8-30%.

Images