Species-specific molecular target yclQ for detecting Campylobacter jejuni and its detection method and kit
By combining the CRISPR/Cas12a system and the yclQ molecular target, the problems of long detection time, high cost and low sensitivity of Campylobacter jejuni were solved, and rapid and accurate food safety detection was achieved.
Patent Information
- Application Number
- CN202410462119.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-17
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2044-04-17
AI Technical Summary
The existing technology for detecting Campylobacter jejuni takes a long time, is costly, complex to operate, and has low sensitivity. The detection target is not specific enough, making it difficult to meet the needs of rapid food safety detection.
A detection method based on the CRISPR/Cas12a system was adopted, which utilized the yclQ molecular target and specific crRNA design, combined with PCR/RAA amplification and fluorescent reporter probes to achieve rapid and simple detection of Campylobacter jejuni.
It achieves rapid and accurate Campylobacter jejuni detection with a sensitivity of 5.3×100 CFU/g, simplifies the detection process, reduces costs, and shortens detection time.
Smart Images

Figure CN118374614B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of microbial testing technology, and specifically relates to species-specific molecular targets yclQ, crRNA, CRISPR / Cas12a system, detection method and kit for detecting Campylobacter jejuni. Background Art
[0002] Campylobacter jejuni is a Gram-negative, microaerophilic zoonosis, considered one of the leading causes of bacterial diarrhea in humans worldwide. Some strains can even cause the serious sequelae of Guillain-Barré syndrome. Among foods, Campylobacter jejuni has a relatively high contamination rate in meat and meat products, with poultry meat being the most contaminated. Studies have found that the colonization rate of Campylobacter jejuni in the cecum of broiler chickens is as high as 2.55×10 8 CFU / g. During slaughter and processing, intestinal contents can easily contaminate poultry food. Consuming contaminated poultry food is the primary route of human infection. Campylobacteriosis is highly prevalent and, in the EU and US, is the most common zoonosis, surpassing Salmonella. Therefore, rapid detection of Campylobacter contamination in food is crucial for food safety.
[0003] Currently, Campylobacter jejuni is detected and identified using the national standard GB 4789.9-2014. This method is relatively accurate, but the procedures are complex (pre-enrichment, selective culture, chromogenic culture, and biochemical identification), costly, and identification results can take eight days or even longer. This is extremely detrimental to food safety risk management, especially for ready-to-eat foods. Nucleic acid-based molecular biology detection methods, with their rapidity, accuracy, and simplicity, are becoming one of the most promising technologies to replace traditional detection methods. Literature searches of existing technologies generally use conserved housekeeping genes such as hipO, 16S rDNA, and mapA as detection genes, but these methods lack sensitivity and specificity for some targets. With the development of whole-genome technologies, pan-genome and genome-wide association analyses can now analyze the relationship between phenotypes and genes. Similarly, the classification of different species is also a form of phenotype, and genome-wide association analyses can be used to screen for species-specific targets. The CRISPR-Cas (clustered regularly interspaced short palindromicrepeats, CRISPR-associated proteins) detection system developed based on the Cas12a protein is a new detection method. Using the Cas12a protein under the guidance of crRNA, it will initiate indiscriminate sequence cleavage activity after identifying the matching target sequence, thereby playing a signal enhancement role. After amplifying the target based on conventional PCR or RAA, CRISPR / Cas12a is used to enhance the signal, and the gel electrophoresis step is also avoided. It can be observed with the naked eye under a simple blue light without the need for complex instruments and equipment. Summary of the Invention
[0004] The present invention aims to address the problems in the prior art of Campylobacter jejuni detection, such as long detection time, high detection cost, complicated operation, low detection sensitivity, and few detection targets, and to provide a specific detection target for identifying Campylobacter jejuni and its corresponding kit and detection method.
[0005] To achieve the above purpose, the present invention adopts the following technical solutions:
[0006] A method for detecting a species-specific molecular target yclQ of Campylobacter jejuni, wherein the molecular detection target is a DNA fragment encoding a nucleotide sequence as shown in SEQ ID NO.1.
[0007] The present invention also provides a PCR / RAA primer for detecting Campylobacter jejuni. The PCR / RAA primer comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.3.
[0008] The present invention also provides a kit for detecting Campylobacter jejuni, which includes PCR / RAA primers, PCR amplification reaction Mix1, RAA amplification reaction Mix2, crRNA, 10×Buffer, a fluorescent reporter probe and Cas12a enzyme.
[0009] Furthermore, the fluorescent reporter probe is HOLMES ssRNA reporter (FAM), and its composition is FAM-TTTTT-BHQ1.
[0010] Furthermore, the CRISPR / Cas12a system utilizes Cas12a and crRNA for CRISPR detection, and the crRNA is designed with the target site as the target sequence.
[0011] The crRNA design principle is: when selecting the crRNA targeting sequence, the 5' end of the targeting sequence should have a 5'-TTTN-3' sequence, and the crRNA sequence itself should not form a stable secondary structure with the targeting sequence and the primer. The crRNA sequence is shown in SEQ ID NO.4.
[0012] The present invention also provides a qPCR detection kit using a chimeric fluorescence method, the kit comprising qPCR primers, a chimeric fluorescence qPCR mix, and a positive control DNA. The forward primer sequence of the qPCR primer is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.3.
[0013] The present invention also provides a qPCR detection kit using a probe method, the kit comprising qPCR primers, a fluorescent probe, a probe method qPCR mix, and a positive control DNA. The forward primer sequence of the qPCR primer is shown in SEQ ID NO.7, the reverse primer sequence is shown in SEQ ID NO.8, the nucleotide sequence of the fluorescent probe is shown in SEQ ID NO.9, the 5' end of the probe is modified with VIC, and the 3' end is modified with TAMRA.
[0014] The present invention also provides the use of the above-mentioned specific molecular target yclQ, PCR / RAA primers or kit in detecting Campylobacter jejuni for purposes other than disease diagnosis and treatment.
[0015] The present invention also provides a method for detecting Campylobacter jejuni for purposes other than disease diagnosis and treatment, comprising the following steps:
[0016] (a) extracting genomic DNA of the sample to be tested;
[0017] (b) using genomic DNA as a template, performing PCR / RAA amplification using PCR / RAA primers to obtain an amplified product;
[0018] (c) adding the amplified product to a reaction system containing crRNA, fluorescent reporter probe, 10× Buffer, and Cas12a enzyme to perform a CRISPR / Cas12a reaction;
[0019] (d) Determine the test results using a fluorescence detection instrument or a blue light detector.
[0020] Preferably, in step (b), the PCR amplification reaction system is 10 μL, which includes: 5 μL of Mix1, 0.25 μL of forward and reverse primers, 0.5 μL of DNA template, and 4 μL of sterile double-distilled water.
[0021] Preferably, the PCR reaction conditions are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; and finally extension at 72°C for 5 min.
[0022] Preferably, in step (b), the RAA amplification reaction system is 12.5 μL, which includes: 6.25 μL of Mix2, 0.75 μL of forward and reverse primers, 1 μL of DNA template, 2.5 μL of sterile double-distilled water, and 1.25 μL of magnesium acetate.
[0023] Preferably, the RAA reaction conditions are: 37° C. for 20 min.
[0024] Preferably, in step (c), the CRISPR / Cas12a reaction system is 10 μL, which includes: 0.4 μL fluorescent reporter probe (HOLMES ssRNA reporter), 0.1 μL Cas12a protein, 0.1 μL crRNA, 1 μL 10×Buffer, 1 μL PCR or RAA amplification product, and ddH2O is used to supplement to 10 μL.
[0025] Preferably, the CRISPR / Cas12a reaction conditions are: 37°C for 20-30 minutes.
[0026] The present invention has the following beneficial effects: the present invention is based on whole genome sequencing data, and the species-specific targets of Campylobacter jejuni are obtained through pan-gene analysis, and the detection results are more reliable; at the same time, the present invention has high sensitivity, with a minimum detection limit of 5.3×10 0The CRISPR / Cas12a-based detection method only requires ultraviolet light or blue light to accurately determine the contamination status of Campylobacter jejuni in the sample, shortening the detection time. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 Screening of Molecular Detection Targets for Campylobacter jejuni
[0028] Figure 2 This is for molecular detection target validation. 1-75 represents Campylobacter jejuni DNA, and B represents a blank control. All strains are maintained in our laboratory.
[0029] Figure 3 Validation of molecular detection target specificity. 1: Bacillus cereus CMCC63001, 2: Bacillus subtilis ATCC 6633, 3: Staphylococcus aureus 29213, 4: Vibrio parahaemolyticus 23846, 5: Salmonella Enteritidis 60335, 6: Yersinia enterocolitica CMCC52204, 7: Escherichia coli 25922, 8: Cronobacter 29544, 9: Salmonella Typhimurium 14028, 10: Pseudomonas aeruginosa 1544, 11: Listeria monocytogenes ATCC 19114, +: Campylobacter jejuni ATCC 33291. B is a blank control.
[0030] Figure 4 For crRNA design and secondary structure prediction. Figure a: Target region crRNA secondary structure prediction; Figure b: Completed crRNA secondary structure prediction.
[0031] Figure 5 This is a feasibility analysis of the CRISPR / Cas12a detection system. Figure a: Real-time fluorescence detection of the CRISPR / Cas12a fluorescence detection system; Figure b: Fluorescence intensity graph of the CRISPR / Cas12a fluorescence detection system; Figure c: Visualization of the CRISPR / Cas12a fluorescence detection system.
[0032] Figure 6 Figure 1: Sensitivity analysis of pure bacteria using PCR / RAA-CRISPR / Cas12a. Figure a: Gel electrophoresis of PCR-CRISPR / Cas12a; Figure b: Gel electrophoresis of RAA-CRISPR / Cas12a; Figure c: Naked-eye observation of PCR-CRISPR / Cas12a under a blue light microscope; Figure d: Naked-eye observation of RAA-CRISPR / Cas12a under a blue light microscope; Figure e: Real-time fluorescence detection of PCR-CRISPR / Cas12a; Figure f: Real-time fluorescence detection of RAA-CRISPR / Cas12a.
[0033] Figure 7 This is a sensitive test for artificially contaminated poultry meat. Figure a: Gel electrophoresis of PCR-CRISPR / Cas12a; Figure b: Gel electrophoresis of RAA-CRISPR / Cas12a; Figure c: Naked-eye observation of PCR-CRISPR / Cas12a under a blue light analyzer; Figure d: Naked-eye observation of RAA-CRISPR / Cas12a under a blue light analyzer; Figure e: Real-time fluorescence detection of PCR-CRISPR / Cas12a; Figure f: Real-time fluorescence detection of RAA-CRISPR / Cas12a.
[0034] Figure 8 Validation of market poultry samples. Figure a: Gel electrophoresis of PCR-CRISPR / Cas12a; Figure b: Gel electrophoresis of RAA-CRISPR / Cas12a; Figure c: Naked-eye observation of PCR-CRISPR / Cas12a under a blue light analyzer; Figure d: Naked-eye observation of RAA-CRISPR / Cas12a under a blue light analyzer; Figure e: Real-time fluorescence detection of PCR-CRISPR / Cas12a; Figure f: Real-time fluorescence detection of RAA-CRISPR / Cas12a.
[0035] Figure 9 To test the sensitivity of the chimeric fluorescence assay kit, the template DNA was diluted 10 0 -10 7 The blank was detected using ddH2O as a blank control.
[0036] Figure 10 For the sensitivity test of probe-based qPCR, the template DNA was diluted 10 1 -10 7 The blank was detected using ddH2O as a blank control. DETAILED DESCRIPTION
[0037] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention.
[0038] Example 1: Mining species-specific molecular targets of Campylobacter jejuni
[0039] The molecular targets specific to Campylobacter jejuni were obtained mainly based on the results of pan-genomic analysis. Using the NCBI database, the common Campylobacter genomes were downloaded and the genomes of common Campylobacter jejuni (232), Campylobacter coli (48), and Campylobacter concise (16) were analyzed ( Figure 1jejuni-specific core genes were screened, resulting in 421 candidate genes for the next step. Further screening using a localized Perl script identified the yclQ molecular detection target.
[0040] Example 2 Verification of Campylobacter jejuni Species-Specific Targets
[0041] Based on the nucleotide sequence of the Campylobacter jejuni species-specific target shown in SEQ ID NO.1, primers SEQ ID NO.5 and SEQ ID NO.6 were designed, and PCR was performed using DNA from Campylobacter jejuni and non-Campylobacter jejuni to verify the specificity of the target. The PCR amplification reaction system was 10 μL, including: 5 μL Taq mix, 0.25 μL each of forward and reverse primers, 0.5 μL DNA template; and 4 μL of sterile double-distilled water. The PCR reaction conditions were: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds, for a total of 35 cycles; and finally extension at 72°C for 5 minutes. The results are shown in Figure 2. Figure 2 and 3 As shown, all Campylobacter jejuni can amplify the target band, while all non-Campylobacter jejuni cannot amplify the target band. That is, the nucleotide sequence shown in SEQ ID NO. 1 can be used as a target for Campylobacter jejuni detection.
[0042] >SEQ ID NO.1
[0043] ATGAAAAAATCTTTAGTTTTTGCATTTTTTGCATTTTTTTTAAGTCTAATCTTAACAGCTT
[0044] GTAATTCAAACTCAAATGAAAACAACGCAAGTTCTACAACAAAAACCAACACTGCTA
[0045] CGGTGAAAGTTTTGCCTATTAGTATGAGCGATGAGGGTGATAGTTTTTTAGTGAAGGAT
[0046] AGTCTAGGAGAAAATAAAATCCCTAAAAATCCTTCTAAGGTAGTGATCTTAGATCTTGG
[0047] AATTTTAGATACTTTTGATGCTTTAAAATTAAATGATAAAGTCGTTGGCGTTCCTGCTAA
[0048] AATTTACCAAAATACCTACAACAATTTAAAAACAAACCTAGTGTAGGTGGAGTACAA
[0049] CAAGTTGATTTTGAAGCCATTAATGCTTTAACCTGATTCTTATCATCATTTCTGGACGC
[0050] CAAAGTAAATTTTATGACAAATTAAAAGAAATAGCTCCAACTTTATTTGTAGGTCTTGA
[0051] TAATGCAAATTTTTTAAGCTCTTTTGAAAACAATGTCTTAAGCGTTGCAAAACTTTATG
[0052] GTTTAGAAAAAGAAGCTTTAGAAAAAAATTTCAGATATTAAAAATGAAATTGAAAAAGC
[0053] CAAAAGTATAGTTGATGAAGATAAAAAAAGCTCTTATCATTCTTACAAATTCTAACAAAA
[0054] TTTCAGCCTTTGGTCCTCAATCTCGCTTTGGGATTATTCACGATGTTTTAGGGATTAACG
[0055] CGGTAGATGAGAATATAAAAGTAGGCACACACGGAAAAAGTATCAATTCTGAATTTATA
[0056] TTAGAAAAAAATCCTGATTATATTTTTGTTGTTGATAGAAATGTCATCTTAGGCAACAAA
[0057] GAACGTGCTCAAGGCATACTCGATAATGCACTTGTCGCTAAAACCAAAGCAGCGCAAA
[0058] ACAAAAAAATCATCTATCTTGATCCAGAATACTGGTATTTAGCAAGTGGAAATGGACTAGAGTCTTTAAAAACTATGATTTTAGAATCAAAAACGCTGTAAAATAA。
[0059] SEQ ID NO. 5
[0060] TTTCAGCCTTTGGTCCTCA.
[0061] >SEQ ID NO.6
[0062] ATGCCTTGAGCACGTTCTTT.
[0063] Example 3 Construction of CRISPR / Cas12a detection system
[0064] According to the amplified fragment, the crRNA required for the CRISPR / Cas12a reaction process is designed, such as Figure 4 As shown, the crRNA sequence itself does not form a stable secondary structure with the target sequence and primer. The CRISPR / Cas12a reaction system is used to amplify and visualize the amplification reaction products. CRISPR / Cas12a reaction system: includes: 0.4μL FAM probe (HOLMES ssRNA reporter); 0.1μL Cas12a protein; 0.1μL crRNA; 1μL 10×Buffer; 1μL nucleic acid amplification product, ddH2O is added to 10μL. The CRISPR / Cas12a reaction conditions are 37℃ for 20-30min. During the reaction, a fluorescent quantitative PCR instrument can be used for real-time detection, or a blue light instrument can be used for naked eye observation. The results are shown in Figure 5 As shown in the figure, the system will generate luminescence only when the fluorescent reporter probe, crRNA, Cas12a protein, 10× Buffer, and target DNA are present. If any of the components are missing, the system will not emit light. This means that the system was successfully constructed.
[0065] Example 4 Preparation of Kit
[0066] A kit was prepared according to the conditions described in Examples 2 and 3. The kit included PCR amplification reaction Mix 1 and RAA amplification reaction Mix 2, PCR / RAA primers, crRNA, 10× Buffer, a fluorescent reporter probe (HOLMES ssRNA reporter), and Cas12a enzyme. PCR reaction tubes were individually packaged, each containing 5 μL of Mix 1, 0.25 μL each of forward and reverse primers, and 4 μL of sterile double-distilled water. RAA reaction tubes were individually packaged, each containing 6.25 μL of Mix 2, 0.75 μL each of forward and reverse primers, and 2.5 μL of sterile double-distilled water. Magnesium acetate was also individually packaged. CRISPR / Cas12a reaction tubes were individually packaged, each containing 0.4 μL of fluorescent reporter probe, 0.1 μL of Cas12a protein, 0.1 μL of crRNA, 1 μL of 10× Buffer, and 7.4 μL of ddH2O.
[0067] Instructions: Add 1 μL of extracted DNA to a PCR or RAA reaction tube and mix thoroughly. PCR reaction conditions are: 94°C pre-denaturation for 5 minutes; 35 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds; and a final extension at 72°C for 5 minutes. RAA reaction conditions are: 37°C for 20 minutes. After the reaction is complete, add 1 μL of the amplified product to a CRISPR / Cas12a reaction tube and mix thoroughly. The reaction is at 37°C for 20-30 minutes. The reaction can be monitored using a fluorescent quantitative PCR instrument during the reaction or detected using a blue light analyzer after the reaction is complete.
[0068] The forward primer sequence of the PCR / RAA primer is shown in SEQ ID NO.2, the reverse primer sequence is shown in SEQ ID NO.3, and the crRNA sequence is shown in SEQ ID NO.4.
[0069] >SEQ ID NO.2
[0070] AAATGATAAAGTCGTTGGCGTTCCTGCTAA.
[0071] >SEQ ID NO.3
[0072] GAGCTATTTCTTTTAATTTGTCATAAAATTTACTT.
[0073] >SEQ ID NO.4
[0074] UAAUUUCUACUAAGUGUAGAUCCAAAAUACCUACAACAAUU.
[0075] Example 5: Identification of kit detection sensitivity
[0076] The sensitivity of the system was tested using pure bacterial solution of Campylobacter jejuni, with an initial concentration of 1.8×10 9 The bacterial solution with a CFU / mL was diluted in a gradient manner, DNA was extracted, and the test was performed using the kit and method described in Example 4. The results are as follows: Figure 6 As shown, pure bacteria were diluted to 10 0 CFU / mL, the signal can still be detected, that is, its sensitivity reaches 1.8×10 0 At the CFU / mL level, it can be detected in real time using an instrument or observed with the naked eye under a blue light analyzer.
[0077] Chicken was artificially contaminated with Campylobacter jejuni pure culture diluted to a concentration of 5.3 × 10 6 -10 0CFU / mL, sterile chicken was added to the diluted bacterial solution and incubated at 42℃ under microaerobic conditions for 12 hours. The chicken sample was taken out and placed in physiological saline. After thorough vortexing, the chicken was taken out and the bacterial DNA in the liquid was extracted. It was used as a template for detection according to the method of Example 4. The results are as follows Figure 7 As shown, the detection limit is 5.3×10 0 CFU / mL.
[0078] Example 6 Detection of Campylobacter jejuni in Food
[0079] Referring to the method described in Example 4, 15 poultry meat samples (Table 1) were tested for Campylobacter jejuni, specifically:
[0080] Take 25 g of sample and add it to 225 mL of Bolton broth containing sheep blood. Vortex thoroughly to release bacteria on the surface of the sample into the broth. At the same time, take out 3 mL of broth from the Bolton broth for bacterial genomic DNA extraction.
[0081] The PCR amplification reaction system was as follows: 0.5 μL of DNA template was added to the PCR reaction tube and shaken well.
[0082] The PCR reaction conditions were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; and final extension at 72°C for 5 min.
[0083] The RAA amplification reaction system was prepared by adding 1 μL DNA template and 1.25 μL magnesium acetate to the RAA reaction tube and shaking well.
[0084] The RAA reaction conditions were: 37°C for 20 min.
[0085] CRISPR / Cas12a reaction system: Add 1 μL of amplified product to the CRISPR / Cas12a reaction tube.
[0086] The CRISPR / Cas12a reaction conditions were 37°C for 20 min.
[0087] Only positive samples will emit fluorescence, and the results will be Figure 8 As shown, one sample was identified as positive, and the result was consistent with the identification result of GB4789.9-2014.
[0088] Table 1 Actual sample test information
[0089]
[0090] Example 7 Chimeric Fluorescence qPCR Sensitivity Test
[0091] The DNA of Campylobacter jejuni bacterial liquid was extracted, and the extracted DNA was used to test the sensitivity of the system. The initial concentration of DNA was 12.5 ng / μL, and gradient dilution was performed. The chimeric fluorescence method was used for detection. The detection system includes 5 μL of chimeric fluorescence qPCR mix, 0.25 μL of upstream and downstream primers, 0.5 μL of template DNA, and ddH2O was used to fill it up to 10 μL; the upstream and downstream primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.3. The reaction conditions are: incubation at 95℃ for 60s; amplification at 95℃ for 10s, 60℃ for 30s, for a total of 45 cycles. The fluorescence signal was detected using qPCR. The results are as follows: Figure 9 As shown, DNA was diluted to 10 7 After that, the signal can still be detected, and its detection sensitivity is high, which can reach the aM level.
[0092] >SEQ ID NO.2
[0093] AAATGATAAAGTCGTTGGCGTTCCTGCTAA.
[0094] >SEQ ID NO.3
[0095] GAGCTATTTCTTTTAATTTGTCATAAAATTTACTT.
[0096] Example 8 Probe-based qPCR sensitivity test
[0097] The DNA of Campylobacter jejuni bacterial liquid was extracted, and the extracted DNA was used to test the sensitivity of the system. The initial concentration of DNA was 12.5 ng / μL, and gradient dilution was performed. The detection was performed using the probe method. The detection system includes 5 μL of probe method qPCR mix, 0.4 μL of upstream and downstream primers, 0.2 μL of probe, 1 μL of template DNA, and ddH2O was used to fill it up to 10 μL; the upstream and downstream primer sequences are shown in SEQ ID NO.7 and SEQ ID NO.8, and the probe sequence is shown in SEQ ID NO.9. The 5' end of the probe is modified with VIC, and the 3' end is modified with TAMRA. The reaction conditions are: incubation at 95°C for 60s; amplification at 95°C for 5s, 65°C for 10s, for a total of 45 cycles. The fluorescence signal was detected using a qPCR instrument. The results are as shown in Figure 10 As shown, DNA was diluted to 10 7 After that, the signal can still be detected, and its detection sensitivity is high, which can reach the aM level.
[0098] >SEQ ID NO.7
[0099] CAAAGAACGTGCTCAAGGCATA.
[0100] >SEQ ID NO.8
[0101] CCATTTCCACTTGCTAAATACCAGTA.
[0102] >SEQ ID NO.9
[0103] VIC-CACTTGTCGCTAAAACCAAAGCAGCGC-TAMRA.
[0104] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be construed as limiting the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. Persons skilled in the art will appreciate that improvements and modifications may be made without departing from the spirit and scope of the present invention, and such improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A nucleic acid detection target for detecting Campylobacter jejuni yclQ The use of a reagent in detecting Campylobacter jejuni for non-disease diagnosis and treatment purposes, characterized in that: The nucleotide sequence of the nucleic acid detection target is shown in SEQ ID NO.
1.
2. A use of a PCR / RAA primer for detecting Campylobacter jejuni for non-disease diagnosis and treatment purposes, characterized in that: The PCR / RAA primers include an upstream primer whose nucleotide sequence is shown as SEQ ID NO.2 and a downstream primer whose nucleotide sequence is shown as SEQ ID NO.
3.
3. Use of a kit for detecting Campylobacter jejuni for non-disease diagnosis and treatment purposes, characterized in that: The kit includes the PCR / RAA primers as described in claim 2, PCR amplification reaction Mix1, RAA amplification reaction Mix2, crRNA, 10×Buffer, a fluorescent reporter probe and Cas12a enzyme.
4. The use according to claim 3, characterized in that The nucleotide sequence of the crRNA is shown in SEQ ID NO.4; the composition of the fluorescent reporter probe is FAM-TTTTT-BHQ1.
5. A use of a qPCR detection kit using a chimeric fluorescence method in the detection of Campylobacter jejuni for non-disease diagnosis and treatment purposes, characterized in that: The kit includes qPCR primers, a chimeric fluorescence qPCR mix, and a positive control DNA. The nucleotide sequences of the qPCR primers are shown in SEQ ID NOs. 2-3.
6. Use of a qPCR detection kit using a probe method in the detection of Campylobacter jejuni for non-disease diagnosis and treatment purposes, characterized in that: The kit includes qPCR primers, fluorescent probes, probe-based qPCR mix, and positive control DNA. The nucleotide sequences of the qPCR primers are shown in SEQ ID NOs. 7 and 8, and the nucleotide sequence of the fluorescent probe is shown in SEQ ID NO.
9. The 5' end of the probe is modified with VIC, and the 3' end is modified with TAMRA.
7. A method for detecting Campylobacter jejuni for purposes other than disease diagnosis and treatment, characterized in that: The following steps are involved: (a) extracting genomic DNA from the sample to be tested; (b) using the genomic DNA as a template, performing PCR / RAA amplification using the PCR / RAA primers described in claim 2 to obtain an amplified product; (c) Add the amplified product to a reaction system containing crRNA, fluorescent reporter probe, 10× Buffer, and Cas12a enzyme to perform a CRISPR / Cas12a reaction; (d) Determine the test results using a fluorescence detection instrument or a blue light analyzer.
8. The detection method according to claim 7, characterized in that In step (c), the CRISPR / Cas12a reaction system is 10 μL, including: 0.4 μL fluorescent reporter probe, 0.1 μL Cas12a enzyme, 0.1 μL crRNA, 1 μL 10× Buffer, 1 μL amplification product, and ddH2O is used to supplement it to 10 μL.
9. The detection method according to claim 7, characterized in that In step (c), the CRISPR / Cas12a reaction conditions are: 37°C for 20-30 min.
Citation Information
Patent Citations
Primers, probes, methods, and kits for detecting Campylobacter coli.
CN102268479A
Campylobacter jejuni detection kit and method based on CRISPR-Cas12b system
CN112080571A