Engineered Streptomyces strains for tacrolimus production, their construction methods and applications
By modifying Streptomyces using synthetic biology techniques, knocking out specific genes and overexpressing SARP family regulatory proteins, and optimizing the fermentation medium, the problems of low yield and insufficient stability in tacrolimus production have been solved, achieving high-yield and stable large-scale production.
Patent Information
- Application Number
- CN202410714796.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-04
- Publication Date
- 2026-01-06
- Estimated Expiration
- 2044-06-04
AI Technical Summary
Current tacrolimus production processes suffer from low yields and insufficient stability. Traditional mutagenesis breeding methods are labor-intensive and difficult to promote. Genetic engineering modifications pose safety risks, and the effects of fermentation process optimization are limited.
By using synthetic biotechnology, the tdha and tcdh genes of Streptomyces were knocked out, and the tulz gene, a regulatory protein of the SARP family, was overexpressed to construct the engineered Streptomyces strain QZ004. The fermentation medium formula was optimized to increase the yield of tacrolimus.
It significantly improves tacrolimus fermentation levels to 2067 mg/L, possesses stable genetic characteristics and a simplified fermentation process, making it suitable for large-scale production and applicable to a wide range of fields.
Smart Images

Figure CN118460433B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of synthetic biology and microbial fermentation technology, and relates to a strain that produces high tacrolimus through synthetic biology, its construction method, and its application. Background Technology
[0002] Streptomyces are a widely distributed group of Gram-positive bacteria, known for their abundant secondary metabolites. These metabolites include a variety of antibiotics, antifungals, anticancer agents, and other bioactive compounds. Tacrolimus, also known as FK506, is a macrolide antibiotic with potent immunosuppressive activity. It was initially isolated from soil microorganisms of the genus Streptomyces, particularly abundant in *Streptomyces tsukuba* found in Japan. Tacrolimus works by binding to the intracellular FK506-binding protein to form a complex that inhibits the activity of calcium-dependent phosphatases, thereby blocking key signaling pathways in T-cell activation and achieving an immunosuppressive effect.
[0003] Tacrolimus is primarily used clinically to prevent and treat organ transplant rejection, especially in liver, kidney, heart, and pancreas transplants. Besides its applications in transplant medicine, tacrolimus is also used to treat certain autoimmune diseases, such as myasthenia gravis, rheumatoid arthritis, lupus, and psoriasis. Despite its significant clinical efficacy, tacrolimus production presents several challenges. Tacrolimus production mainly relies on Streptomyces fermentation. However, the yield of tacrolimus during fermentation is typically low, limiting its large-scale production and cost-effectiveness. Furthermore, fermentation may generate other metabolic byproducts, increasing the complexity and cost of subsequent purification processes.
[0004] Not only tacrolimus, but also the screening and optimization of strains to maximize yield and raw material utilization are common problems faced by microbial fermentation engineering in my country. Currently, methods for increasing antibiotic yield from Streptomyces mainly fall into two categories: one is the traditional mutagenesis breeding method, which uses physicochemical methods to mutate strains and then screens high-yielding strains from the mutagenic progeny; for example, the Streptomyces mutagenesis strain provided by Chinese patent CN113717892A. Streptomyces tsukubaensisAfter being mutated using plasma mutagenesis breeding technology, FIM-Z-A36 produced 3138 mg / L of tacrolimus in a 1-ton fermenter. Although the fermentation level of the strain was significantly improved, its stability still needs to be verified. While physicochemical methods can yield high-yielding strains, they also have significant drawbacks. These include the high cost in manpower, resources, and time; complex and somewhat unpredictable screening processes; and the potential for introducing harmful mutations alongside beneficial ones, which can hinder the optimization and scale-up of the fermentation process. Furthermore, these traditional strain selection methods are difficult to apply to other strains due to a lack of understanding of the biological basis causing functional changes. Another approach involves using genetic methods to modify strains through traditional genetic engineering to increase antibiotic production. For example, the genetically engineered bacteria provided in Chinese patent CN114045249A... Streptomyces tsukubaensis L199, this strain was obtained by introducing an exogenous transporter gene, knocking out some metabolic competitive pathways, and replacing specific promoter elements in the tacrolimus gene cluster. Adding L-isoleucine to its fermentation medium stabilized the tacrolimus fermentation level at approximately 980 mg / L. Furthermore, improving and optimizing the fermentation process in actual production is also an effective means to increase antibiotic yield. For example, the natural strain provided by Chinese patent CN101481662A... Streptomyces sp. YN06-1593 achieved a tacrolimus yield of 520 mg / L in a 10-ton fermenter through optimization of the culture medium and improvement of the feeding process. Another example is a method for increasing tacrolimus yield disclosed in Chinese patent CN112159826A, which involves adding allelochemicals psoralen and safrole to the fermentation medium, increasing the tacrolimus yield from 190 mg / L to 1980 mg / L. However, safrole is a carcinogen and is strictly prohibited from being added to food or drugs.
[0005] It is evident that current tacrolimus production still suffers from insufficient performance stability, narrow application range, and low output. Summary of the Invention
[0006] To address the shortcomings of existing technologies, this invention proposes an engineered Streptomyces strain for tacrolimus production, its construction method, and its applications. This invention utilizes synthetic biotechnology to modify the starting Streptomyces strain and optimizes the fermentation broth to increase tacrolimus yield.
[0007] The specific technical solution adopted in this invention is as follows:
[0008] I. Streptomyces
[0009] The Streptomyces species mentioned are named: Streptomyces tsukuba ( Streptomyces tsukubaensisQZ001, deposited on May 16, 2024, deposited by China General Microbiological Culture Collection Center, accession number: CGMCC30637, deposited at Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.
[0010] II. Engineered Streptomyces
[0011] The starting strain of the engineered Streptomyces strain is Streptomyces, and the genome of the engineered Streptomyces strain is knocked out tdha Genes and tcdh The gene includes a gene expression cassette, which overexpresses SARP family regulatory proteins; tdha The gene sequence is shown in SEQ ID NO.1. tcdh The gene sequence is shown in SEQ ID NO.2.
[0012] The SARP family regulatory proteins are composed of tulz Gene encoding, the tulz The gene sequence is shown in SEQ ID NO.3.
[0013] The starting strain of the engineered Streptomyces strain is Streptomyces tsukuba ( Streptomyces tsukubaensis The engineered Streptomyces strain QZ001 is named: *Streptomyces tsukuba*. Streptomyces tsukubaensis QZ004, deposited on May 16, 2024, deposited by China General Microbiological Culture Collection Center, accession number: CGMCC30638, deposited at Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.
[0014] III. Construction Methods of Engineered Streptomyces
[0015] The construction method includes the following steps:
[0016] (a) Knockout of the starting strain using homologous recombination technology tdha Genes were used to obtain strain QZ002;
[0017] (b) Knockout of strain QZ002 using homologous recombination technology tcdh Genes were used to obtain strain QZ003;
[0018] (c) Using homologous recombination technology to extract the coding gene of tacrolimus SARP family regulatory proteins tulz The gene was integrated into the genome of the QZ003 strain to obtain the engineered Streptomyces strain QZ004.
[0019] The preferred method of homologous recombination technology is the conjugation transformation method.
[0020] Specifically, step (c) involves: obtaining... tulz The target gene is inserted into a shuttle plasmid to construct an overexpression vector. This overexpression vector is then conjugated and transferred into the QZ003 strain to obtain the engineered Streptomyces. Preferably, the target gene— tulz The gene is inserted between the NdeI and XbaI restriction sites of the shuttle plasmid, which can be the Escherichia coli-Streptomyces shuttle plasmid pIJ8660.
[0021] Specifically, step (c) includes the following steps:
[0022] (c1) Construction of the overexpression vector: Using QZ001 genomic DNA as a template and pCE-tulz-F / R as primers, the expression vector was amplified by PCR. tulz Genes, and then the target gene fragment tulz Genes were inserted into shuttle plasmids to construct overexpression vectors;
[0023] (c2) The overexpression vector is transformed into competent cells, and donor cells are obtained after screening. Then, the spore suspension of the QZ003 strain is used as recipient cells after heat shock germination. The donor cells and recipient cells are mixed and spread on a plate. After cultivation and screening, the engineered Streptomyces strain QZ004 is obtained. The preferred concentration ratio of donor cells to recipient cells is 1:2.
[0024] IV. Methods for producing tacrolimus
[0025] The method specifically involves: culturing the engineered Streptomyces strain using a fermentation medium, obtaining a fermentation product after the culture is completed, and then isolating tacrolimus from the fermentation product.
[0026] The fermentation medium comprises the following components at the following concentrations: glucose 10 g / L, maltodextrin 50 g / L, yeast extract 15 g / L, cottonseed meal 30 g / L, K2HPO4 2 g / L, isoleucine 6 g / L, and calcium carbonate 2 g / L.
[0027] Preferably, the pH of the fermentation medium containing the added ingredients is 7.0.
[0028] Preferably, the fermentation level of the engineered Streptomyces strain is as high as approximately 2067 mg / L.
[0029] The culture conditions are: fermentation culture at 200~220 rpm and 28~30℃ for 144~192 hours.
[0030] V. Application of Streptomyces and engineered Streptomyces in the production of tacrolimus, tacrolimus derivatives or other anti-rejection drugs.
[0031] VI. The application of methods for constructing engineered Streptomyces strains or methods for producing tacrolimus in the production of tacrolimus, tacrolimus derivatives, or other anti-rejection drugs.
[0032] The beneficial effects of this invention are as follows:
[0033] 1. Increased yield: The tacrolimus fermentation level of the engineered Streptomyces strain QZ004 provided by this invention is significantly improved, reaching 2067 mg / L.
[0034] 2. Strain characteristics: The Streptomyces engineered strain QZ004 provided by this invention has stable genetic characteristics, a simplified fermentation process, and abundant fermentation output, making it suitable for the large-scale production of tacrolimus.
[0035] 3. Wide range of applications: The strains and production methods provided by this invention are suitable for the production of high-yield tacrolimus and its derivatives or anti-rejection drugs, and have broad application prospects.
[0036] 4. This invention further improves the fermentation level of the strain by improving the formulation of the fermentation medium.
[0037] 5. This invention uses synthetic biology methods to modify genes with known functions, which enhances the specificity of the operation, greatly reduces the workload, and shortens the screening time. Attached Figure Description
[0038] Figure 1 Morphological diagram of Streptomyces QZ001; 1]Figure 1 (a) is a morphological diagram of the strain; Figure 1 (b) is a diagram of the morphology of the spore chain;
[0039] Figure 2 A schematic diagram of the gene knockout plasmid pKC1139-ΔtA;
[0040] Figure 3 A schematic diagram of the overexpression vector pIJ8660-tuIZ;
[0041] Figure 4 A schematic diagram showing the change in tacrolimus fermentation yield of Streptomyces engineered strain QZ004 over time, as provided in Example 2 of the present invention.
[0042] Figure 5 This is a schematic diagram comparing the fermentation yield of Streptomyces QZ001 provided in Example 1 of the present invention with the fermentation yield of engineered Streptomyces QZ004 provided in Example 2, with a fermentation time of 216 hours. Detailed Implementation
[0043] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.
[0044] This invention discloses a high-tacrolimus-producing *Streptomyces* strain, and also develops an engineered *Streptomyces* strain that significantly improves tacrolimus production through synthetic biotechnology, along with its construction method and applications. The specific steps and features of this invention are as follows:
[0045] 1. The present invention obtained the original strain QZ001 from soil.
[0046] 2. This invention uses synthetic biology technology to modify a recombinant bacterium that produces tacrolimus, including knocking out and overexpressing specific genes.
[0047] 3. This invention provides a method for constructing the above-mentioned recombinant bacteria, the steps of which are as follows:
[0048] (a) Knockout tcdh Genes that increase NADPH levels and promote precursor accumulation, thereby increasing tacrolimus production;
[0049] (b) Knockout tdha Genes reduce the competition between tacrolimus and FK520 for precursors, further increasing yield.
[0050] (c) Overexpression tulz The gene encodes a SARP family regulatory protein that positively regulates tacrolimus production.
[0051] 4. The present invention also provides a method for producing tacrolimus by fermentation of the above-mentioned recombinant bacteria. This method improves the fermentation medium formulation by optimizing the response surface methodology, thereby further improving the fermentation level of the strain.
[0052] The present invention will be further described below with reference to specific embodiments. The embodiments of the present invention provide specific operational steps for strain construction, detailed culture medium formulations, and methods for detecting tacrolimus yield, but the present invention is not limited to the following embodiments.
[0053] Example 1
[0054] (I) Isolation and Identification of Streptomyces Strains
[0055] Sample source: isolated from soil
[0056] (1) Soil sample collection
[0057] Soil samples were collected from a soil sample collection site (28°39′N 121°25′E). Soil samples were dug from different locations at a depth of 5–10 cm using a spatula and placed in sterile sampling tubes for preservation. A total of 100 samples were collected. The sampling tubes were brought back to the laboratory, and the soil samples were placed in a ventilated area for seven days to allow the moisture in them to evaporate as much as possible.
[0058] (2) Preparation of soil suspension
[0059] Select a small clump of soil from the dried soil sample, accurately weigh 5g, and grind it into powder. Pour the powder into a 250mL Erlenmeyer flask containing 50mL of sterile water and small glass beads, and sonicate for 30 minutes to obtain the stock solution. Use a sterile pipette to transfer 100µL of the soil sample stock solution into an EP tube containing 900µL of sterile water, and mix thoroughly to obtain a concentration of 10. -1 Soil suspension. Diluted as described above, successively obtaining concentrations of 10... -2 10 -3 10 -4 10 -5 The suspensions were used to isolate actinomycetes on isolation medium using these four concentrations of dilution.
[0060] (3) Isolation of actinomycetes
[0061] ISP4 solid medium was selected as the isolation medium, dispensed in 200 mL portions, and sterilized at 115°C for 30 min. After sterilization, the medium was cooled to approximately 80°C, and nalidixic acid was added to a final concentration of 25 μg / mL to inhibit the growth of Gram-negative bacteria, and nystatin was added to a final concentration of 50 μg / mL to inhibit fungal growth. From the colonies that grew, Streptomyces samples with spore-producing colonies were selected for preservation, resulting in the collection of 80 strains.
[0062] (4) Fermentation of actinomycetes
[0063] Select strains with good colony morphology (e.g., size, wrinkles, color, etc.), scrape off purified single-colony spores or hyphae, and inoculate them into TSB medium. The inoculation volume is 30 mL / 250 mL Erlenmeyer flasks, with one colony per flask. Incubate at 220 rpm and 28°C for 7 days. Once the hyphae are mature and microscopic examination shows no contamination, transfer 3 mL of the bacterial culture from the TSB medium to fermentation medium. Perform three replicates per strain, using 30 mL / 250 mL Erlenmeyer flasks and incubating at 220 rpm and 28°C for 7 days. Mix 250 μL of fermentation broth with 1 mL of methanol, sonicate for 30 min, centrifuge at 12000 rpm for 10 min, collect the supernatant, and filter through a 0.22 μm sterile microporous membrane. Use the filtrate for HPLC analysis. Based on the HPLC results, the strain with the highest yield, QZ001, was identified. Strain QZ001 was cultured on ISP4 medium at 28°C for about 7 days, and the bacterial cells were preserved at -80°C with 20% glycerol.
[0064] (5) Strain identification
[0065] Morphological observation
[0066] Strain QZ001 was cultured at 28°C for 7 days on ISP2 and ISP4 culture plates. Figure 1 (a) in the figure is a morphological diagram of Streptomyces QZ001 strain, as shown in the figure. Figure 1 As shown in (a), the colonies exhibit different colors from white and gray to orange-red, with well-grown, unbroken, and non-aerial mycelia.
[0067] Culture characteristics
[0068] Strain QZ001 was cultured on ISP4 medium at 28°C for 7 days and then transferred to TSB medium for 30 hours before being observed under an optical microscope. Figure 1 (b) in the diagram is a morphological diagram of the spore chain of Streptomyces QZ001, as shown below. Figure 1 As shown in (b), the spores are elliptical, measuring 0.64~0.99 μm × 1.02~1.24 μm, forming a sporophytic chain ( Figure 1 (b) Two culture media, ISP2 and ISP4, were used. After incubation at 30℃ for 7 days, the color and pigmentation of the mycelium were observed. The results are shown in Table 1. The colonies growing on ISP4 medium were grayish-white, while those growing on ISP2 medium were orange-red.
[0069] Table 1. Epigenetic characteristics of the strains
[0070] Culture medium Growth condition Colony back pigment Aerial mycelium color Soluble pigment ISP2 7 Orange red Dark gray None ISP4 7 Grayish brown Grayish white None
[0071] The culture medium used in this embodiment:
[0072] ISP4 solid medium: 37 g / L (BD ISP4 Medium, USA), 20 mM MgCl2, 50 mM CaCl2;
[0073] ISP2 solid medium: yeast extract 4 g / L, malt extract 10 g / L, glucose 4 g / L, agar 20 g / L;
[0074] 2×YT medium: tryptone 16 g / L, yeast extract 10 g / L, NaCl 5 g / L. Wash Streptomyces mycelium during conjugation transfer;
[0075] TSB medium: 2% TSB, 5% PEG 6000 Sterilize at 115℃ for 25 minutes;
[0076] Fermentation medium: glucose 10 g / L, maltodextrin 50 g / L, yeast powder 15 g / L, cottonseed meal powder 30 g / L, K2HPO4 2 g / L, isoleucine 6 g / L, calcium carbonate 2 g / L, pH adjusted to 7.0, sterilized at 121℃ for 30 min.
[0077] LB liquid medium: 1% sodium chloride, 0.5% yeast extract, 1% peptone.
[0078] (II) Method for producing tacrolimus using Streptomyces QZ001 tacrolimus production strain
[0079] (1) Solid culture: Inoculate the production bacteria on ISP4 plates and culture at 28℃ for about 7 to 10 days until dense gray spores grow. Store for later use.
[0080] (2) Liquid culture: Spores that grow well on solid culture medium are inoculated into TSB culture medium and cultured for 30 h (220 rpm, 28 ℃); TSB culture medium is inoculated into fermentation medium at a ratio of 3%, and fermented at 220 rpm, 28 ℃ for 168 h. The yield of tacrolimus is then detected.
[0081] (3) The parameters for HPLC detection of tacrolimus yield are as follows:
[0082] Chromatographic column: Welchrom C18, 5um, 4.6mm x 250mm, Agilent;
[0083] Instrument: SHIMADZU FVC-11AL;
[0084] Mobile phase: Phase A is ultrapure water + 1% phosphoric acid; Phase B is acetonitrile.
[0085] Elution program: Phase A: Phase B = 30:70;
[0086] Flow rate: 1.0 mL / min;
[0087] Detection wavelength: 210nm.
[0088] (III) Tacrolimus Purification Process
[0089] Fermentation broth was filtered to obtain bacterial cells, which were then extracted and concentrated with ethanol. The cells were then adsorbed and desorbed through macroporous adsorption resins (HP-20, XAD1600, X-5, etc.). The eluent was concentrated again, and ethyl acetate and water were added for washing. The organic phase liquid was concentrated, and hexane was added for stirring and crystallization. The mixture was filtered and dried to obtain a solid crude product. The crude product was then purified by one or two resin chromatography columns, dissolved in ethanol, and crystallized with water to obtain the tacrolimus product.
[0090] Example 2
[0091] (I) Methods for constructing synthetic biology-engineered strains that produce high levels of tacrolimus, i.e., methods for constructing engineered Streptomyces strains.
[0092] (1) Primers pCE-tA-Up-F / R and pCE-tA-Dn-F / R were designed using the whole genome sequence of Streptomyces QZ001 as a template, and the 1.6 kb gene was obtained by PCR using a KOD high-fidelity enzyme system. tdha The left-hand sequence tdha-up and the right-hand sequence tdha-down of the 1.0 kb tdha gene are shown in SEQ ID NO.4~SEQ ID NO.5. The two target fragments were cloned in one step with the linearized plasmid pCE-Zero to obtain the recombinant plasmid pCE-tdha. The recombinant plasmid was then double-digested with EcoRI and HindIII, and the resulting recombinant target fragment was ligated into the *E. coli*-Streptomyces shuttle plasmid pKC1139, which had also been digested with EcoRI and HindIII, using T4 ligase to construct the gene knockout plasmid pKC1139-ΔtA. Sequencing confirmed its correctness. The vector diagram is shown below. Figure 2 As shown.
[0093] (2) Subsequently, the knockout plasmid pKC1139-ΔtA was transformed into E. coli ET12567 containing plasmid pUZ8002. The E. coli containing the corresponding recombinant plasmid was inoculated into 5 mL of LB broth containing the corresponding antibiotics (chloramphenicol, kanamycin, and apopramycin) and cultured overnight on a shaker (37 ℃, 220 rpm). The next day, 1% of the bacterial culture was inoculated into 50 mL of LB broth containing the corresponding antibiotics and cultured under the same conditions until the OD600 reached 0.3–0.4. After centrifugation (3500 rpm, 6 min) to collect the bacterial cells, the cells were washed twice with 25 mL of LB broth and finally resuspended in 1 mL of LB broth for later use.
[0094] (3) Take 1 mL of a suitable amount of 20% glycerol spore suspension frozen at -80℃, centrifuge to collect the bacterial cells (9000 rpm, 2 min), wash twice with 500 μL of TES buffer, resuspend in 500 mL of TES buffer, and heat shock at 50℃ for 10 min to induce spore germination. Add 500 μL of TSB and incubate at 37℃ in a shaker for 3 h. Centrifuge and resuspend in 500 μL of LB for use as recipient cells. Recipient cells and E. coli donor cells containing the knockout plasmid pKC1139-ΔtA were mixed in different volume ratios and spread on ISP4 plates, divided into four groups with donor-recipient cell volume ratios of 50:50, 50:100, 50:150, and 50:200. After incubation at 28 °C upside down for 16–20 h, nalidixic acid (final concentration 45 mg / L) and Am antibiotic (80 mg / L) were added, and the cells were incubated at 28 °C for another 6–8 days to obtain the corresponding conjugates.
[0095] (4) Select single colonies from the above conjugates and transfer them to ISP4 plates (4*4) containing Am antibiotic. Incubate at 37℃ for 8-10 days. Theoretically, all the resulting strains will be single-crossover mutants. Scrape spores and inoculate them into antibiotic-free TSB medium for 4-6 generations of relaxation culture. For each generation starting from the second generation, cut single colonies onto ISP4 or ISP2 plates. Divide each single colony in half with a sterile toothpick and spread them onto antibiotic-free ISP2 plates (7*7) and ISP2 plates containing Am antibiotic (7*7) respectively. Incubate at 28℃ for 3-5 days and observe the results. Inoculate colonies sensitive to the corresponding antibiotics from the copy screening into 15 mL of TSB medium and incubate at 28℃ with shaking at 220 rpm for 24-30 h until the mycelium is dense. Take 1.5 mL of mycelium to extract the genome and identify the DNA sequence of SEQ ID NO.1 in the genome by PCR. tdha The strain was knocked out, resulting in strain QZ002.
[0096] (5) Using the whole genome sequence of strain QZ001 as a template and CH-Up-F / R and CH-Dn-F / R as primers, the left and right homologous arm fragments containing the gene tcdh were obtained, as shown in SEQ ID NO.6 and SEQ ID NO.7, respectively. These two fragments were cloned into the EcoRI and HindIII double-digested vector pKC1139 using the ClonExpress Ultra One Step Cloning kit to obtain the knockout plasmid pKC1139-cH. Following the same method as steps (2) to (4), the knockout plasmid pKC1139-cH and the spore suspension of QZ002 were conjugated and transferred. The knockout plasmid pKC1139-cH was introduced into strain QZ002, and the DNA sequence tcdh of SEQ ID NO.2 was verified by PCR to be knocked out, thus obtaining strain QZ003.
[0097] (6) Using QZ001 genomic DNA as a template and pCE-tulz-F / R as primers, the gene tulz was amplified by PCR. The target fragment tulz was then digested with NdeI+XbaI enzymes and ligated into the NdeI+XbaI-digested E. coli-Streptomyces shuttle plasmid pIJ8660 to construct the overexpression vector pIJ8660-tuIZ. Figure 3 As shown. After the sequencing verification was correct, the overexpression vector pIJ8660-tuIZ was introduced into strain QZ003 by conjugation transfer in the same way as steps (2) to (3). PCR verification showed that the DNA sequence of SEQ ID NO.3 had been completely integrated into the genome, and strain QZ004 was obtained.
[0098] (II) Method for producing tacrolimus using the engineered strain QZ004 of Streptomyces simulans.
[0099] (a) The engineered strain of Streptomyces was cultured in a fermentation medium containing additives, and the fermentation product was obtained after the culture was completed;
[0100] The fermentation medium containing additives used in the fermentation process includes the following components at the following concentrations: glucose 10 g / L, maltodextrin 50 g / L, yeast extract 15 g / L, cottonseed meal 30 g / L, K₂HPO₄ 2 g / L, isoleucine 6 g / L, and calcium carbonate 2 g / L. The pH of the fermentation medium is 7.0.
[0101] The culture conditions were: 28℃ and 220 rpm.
[0102] (b) Tacrolimus is isolated from the fermentation product obtained in step (a).
[0103] Figure 4 This is a schematic diagram illustrating the change in tacrolimus fermentation yield over time of the *Streptomyces* engineered strain QZ004 provided in Example 2 of the present invention, as shown below. Figure 4 As shown, strain QZ004, fermented in a 15 L fermenter for 216 h, can produce tacrolimus at a yield of 2067 mg / L.
[0104] Figure 5 This is a schematic diagram comparing the fermentation yield of the *Streptomyces* strain QZ001 provided in Example 1 of the present invention with the fermentation yield of the engineered *Streptomyces* strain QZ004 provided in Example 2, with a fermentation time of 216 hours. Figure 5 As shown, after 216 hours of fermentation, the tacrolimus production of the engineered Streptomyces strain QZ004 was 2.5 times that of the starting strain (WT) Streptomyces strain QZ001.
[0105] The primer sequences used in this embodiment of the invention are as follows:
[0106] Primer name Sequence ID Sequence pCE-tA-Up-F SEQ ID NO.8 ggatcttccagagataagcttccgtcgcctcctaccgcgga pCE-tA-Up-R SEQ ID NO.9 ccctccgcgcgcatctgctcgcggccggtggtcaggaagc pCE-tA-Dn-F SEQ ID NO.10 gcttcctgaccaccggccgcgagcagatgcgcgcggaggg pCE-tA-Dn-R SEQ ID NO.11 gctatgacatgattacgaattcgtcgaccagctccggggcct CH-Up-F SEQ ID NO.12 agataagcttcatgccggccacgctctccg CH-Up-R SEQ ID NO.13 gctctagacgcgcccgtacagccgtagc CH-Dn-F SEQ ID NO.14 gctctagatggtcgctgcgggccagtgtc CH-Dn-R SEQ ID NO.15 cggaattcacgccgagagccccgagacc pCE-tulz-F SEQ ID NO.16 ggatcttccagagatcatatggtgagaattcaggttctggggc pCE-tulz-R SEQ ID NO.17 ctgccgttcgacgattctagatcaggcggcgaagaggtcga
[0107] The above description represents the preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
[0108] The nucleotide sequence of the gene involved in this invention is as follows:
[0109] SEQ ID NO.1
[0110] Sequence type: DNA
[0111] DNA type: genomic DNA
[0112] Name: Gene tdha DNA sequence
[0113] Source: Synthetic Construct
[0114] gagcagatgcgcgcggagggcaccaagttccgcaccgaggtggagatcggcgtggacgtcgacgcggcccagctgcgccgccgctacgacgccgtcgtcatcgccgccggggcgaccgtctcccgcgatctgcccgtccccggccgggagctgaacggcatccacttcgcgatggagtacctgccgctcgccaacaaggtgcaggagggcgacttcgtcgccccgccgatcaccgccgagggcaagcacgtcgtcgtcatcggcggcggcgacaccggcgcggactgcgtcggcaccgcccaccggcagggcgcggcctccgtcacccagctggagatcatgccccggccgggcgaggagcgcagcgccggccagccgtggccgacgttcccgatgctctacaaggtgacctcggcccacgaggagggcggcgagcgcgtgtacgccgtctcgaccacccgcttcgagggcgacgaggacggcaatgtggccgccctgcacctggtggaggtcgacttcgtcgacgggaagctcaccccgagggccggcaccgagcgccggatcccggcccagctggtgacgctggcgatgggcttcaccggcaccgaccggtccaacgggctcgtcgaccagttcggcctggagctggacgaccgcggcaatgtcgcccgcgacgccgatttcgcgaccaacgtcgacggggtattcgtcgccggtgacgccggccgcggccagtcgctgatcgtctgggcgatcgccgagggccgttcggcggcgcgcggcgtcgaccgcttcctgaccggcgcgagcgaactgcccgccccgatccgcccgacggaccgtgctctgacggtctga
[0115] SEQ ID NO.2
[0116] Sequence Type: DNA
[0117] DNA Type: genomic DNA
[0118] Name: Gene tcdh DNA sequence
[0119] Source: Synthetic Construct
[0120] atgaccgtccccgcgaagcccgcgcccttcgacccggacgaccccctgggcctcgacgaactgctcgcccccgacgaactgggcgtccgggacaccatgcgggagtgggcggccgcgcggatcctgccgcatatcgccgagtggtacgagcaggggcggctgcccggcatccgcgaactggcccgggagctgggttcgatcggcgctctcgggatgaccctcaccggctacggctgtacgggcgcgTCTAGAtggtcgctgcgggccagtgtcaccagcgagctggtgctcgacggggtgcgactgcccgccgatgcggtgctgccgggggcggacgggctgcgcgcaccgctgggctgtctcaaccacgcccgctacggcatcgtctggggctcgatgggcgcggcccggtcgagtttcgccgccgcgctcgcgtactcccgtacccgggagcagttcggccggcccatcggcggcttccagctcacccaggccaagctggccgatatggcggtggagctgcacaaggggctcctgctcgcccatcatctggggcgccggatggacgcgggacggctccggcccgagcaggtcagcttcgggaagctcaacaacgtccgcgaggccatcgagatctgccgcaccgcgcgcacgatcctcggggcgaacggcatctcgctggagtatccggtgatgcggcacgcgaccaatctggagtccgtgctcacctacgagggcacggtggagatgcaccagctcgtgctggggaaggcgctcaccgggcaggacgccttccggtga
[0121] SEQ ID NO.3
[0122] Sequence Type: DNA
[0123] DNA Type: genomic DNA
[0124] Name: Gene tulz DNA sequence of
[0125] Source: Synthetic Construct
[0126] Gtgagaatacaggttctggggccgttgagtgccgaggtcaacgggggatccatcgttcccaccgcggccaagccgcggcagatcctgtccctgatggcgctctatccggggcgtgtcctgcccgtcccgatgctcatggaagagatctgggggaccgcgccgccgcagagcgccctcaccaccctgcagacctacatcctccagctccgcagaagactggacaccgcgatgggcccgagcgcaccgggcggagccaaggaggtactggccacccggcacgggggatatctgctgcagatccccgaagccagcgtcgacgtccacgagtacgagcgtctggcacgccagggacagaccgctttcgaaacgggggacaacgaggtgtcggcgcggcggctgcgggccgctctcgacctgtggaagggaccggccctcgtcgacatacgcgtcggaccgatcctcgacatcgaggtcagacgcctggaggagagccggctggccgtcgtcgaacgccgtatcgacgccgacctcaaactcggccggcacaccgaactcatccccgaactgaccgacctgacggcccgccacccccagcacgagggcctgcacgcgcagatgatggtggcgctgtaccggtcggggcggcaggccggggccctggaggcctaccgcaggctgcggatgcgcctgatcgacgaactcggcgtggagccctcgccgcagctgcagcggctgcaccaggccatgctctccgtcgacccgcagctggacgtggtggcgggagcgcggcgcacctcgaccttcgacctcttcgccgcctga
[0127] SEQ ID NO.4
[0128] Sequence type: DNA
[0129] DNA type: genomic DNA
[0130] Name: Gene tdha left homologous arm sequence
[0131] Source: Synthetic Construct
[0132]
[0133] SEQ ID NO.5
[0134] Sequence type: DNA
[0135] DNA type: genomic DNA
[0136] Name: Gene tdha right homologous arm sequence
[0137] Source: Synthetic Construct
[0138]
[0139] SEQ ID NO.6
[0140] Sequence type: DNA
[0141] DNA type: genomic DNA
[0142] Name: Gene tcdh left homologous arm sequence
[0143] Source: Synthetic Construct
[0144]
[0145] SEQ ID NO.7
[0146] Sequence type: DNA
[0147] DNA type: genomic DNA
[0148] Name: Gene tcdh right homologous arm sequence
[0149] Source: Synthetic Construct
[0150]
[0151] SEQ ID NO.8
[0152] Sequence type: DNA
[0153] DNA type: other DNA
[0154] Name: pCE-tA-Up-F
[0155] Source: Synthetic Construct
[0156] ggatcttccagagataagcttccgtcgcctcctaccgcgga
[0157] SEQ ID NO.9
[0158] Sequence type: DNA
[0159] DNA type: other DNA
[0160] Name: pCE-tA-Up-R
[0161] Source: Synthetic Construct
[0162] ccctccgcgcgcatctgctcgcggccggtggtcaggaagc
[0163] SEQ ID NO.10
[0164] Sequence type: DNA
[0165] DNA type: other DNA
[0166] Name: pCE-tA-Dn-F
[0167] Source: Synthetic Construct
[0168] gcttcctgaccaccggccgcgagcagatgcgcgcggaggg
[0169] SEQ ID NO.11
[0170] Sequence type: DNA
[0171] DNA type: other DNA
[0172] Name: pCE-tA-Dn-R
[0173] Source: Synthetic Construct
[0174] gctatgacatgattacgaattcgtcgaccagctccggggcct
[0175] SEQ ID NO.12
[0176] Sequence type: DNA
[0177] DNA type: other DNA
[0178] Name: CH-Up-F
[0179] Source: Synthetic Construct
[0180] agataagcttcatgccggccacgctctccg
[0181] SEQ ID NO.13
[0182] Sequence type: DNA
[0183] DNA type: other DNA
[0184] Name: CH-Up-R
[0185] Source: Synthetic Construct
[0186] gctctagacgcgcccgtacagccgtagc
[0187] SEQ ID NO.14
[0188] Sequence type: DNA
[0189] DNA type: other DNA
[0190] Name: CH-Dn-F
[0191] Source: Synthetic Construct
[0192] gctctagatggtcgctgcgggccagtgtc
[0193] SEQ ID NO.15
[0194] Sequence type: DNA
[0195] DNA type: other DNA
[0196] Name: CH-Dn-R
[0197] Source: Synthetic Construct
[0198] cggaattcacgccgagagccccgagacc
[0199] SEQ ID NO.16
[0200] Sequence type: DNA
[0201] DNA type: other DNA
[0202] Name: pCE-tulz-F
[0203] Source: Synthetic Construct
[0204] ggatcttccagagatcatatggtgagaattcaggttctggggc
[0205] SEQ ID NO.17
[0206] Sequence type: DNA
[0207] DNA type: other DNA
[0208] Name: pCE-tulz-R
[0209] Source: Synthetic Construct
[0210] ctgccgttcgacgattctagatcaggcggcgaagaggtcga.
Claims
1. An engineered strain of Streptomyces, characterized in that: The starting strain of the engineered Streptomyces strain is Streptomyces tsukuba ( Streptomyces tsukubaensis QZ001, deposit date: May 16, 2024, depositary institution: China General Microbiological Culture Collection Center, accession number: CGMCC 30637; The engineered Streptomyces strain is *Streptomyces tsukuba* (… Streptomyces tsukubaensis QZ001 is the starting strain; knock out the strain in the starting strain. tdha Genes and tcdh Genes and overexpression tulz Gene; The tdha The gene sequence is shown in SEQ ID NO.
1. tcdh The gene sequence is shown in SEQ ID NO.
2. tulz The gene sequence is shown in SEQ ID NO.
3.
2. The engineered Streptomyces bacterium of claim 1, wherein: The engineered Streptomyces strain was named: *Streptomyces tsukuba* ( Streptomyces tsukubaensis QZ004, deposited on May 16, 2024, deposited by China General Microbiological Culture Collection Center, accession number: CGMCC 30638.
3. A method for constructing the engineered Streptomyces strain as described in claim 1, characterized in that: The construction method comprises the following steps: (a) knockout the gene in the starting strain by using homologous recombination technology to obtain the QZ002 strain; tdha (b) knockout the gene in the QZ002 strain by using homologous recombination technology to obtain the QZ003 strain; (b) knocking out the gene in the QZ002 strain by using homologous recombination technology to obtain a QZ003 strain; and tcdh (b) knocking out the gene in the QZ002 strain by using homologous recombination technology to obtain a QZ003 strain; and (c) integrating the gene into the genome of the QZ003 strain using homologous recombination technology to obtain the engineered Streptomyces strain. tulz gene into the genome of the QZ003 strain using homologous recombination technology to obtain the engineered Streptomyces strain.
4. A method for producing tacrolimus by using the engineered Streptomyces bacteria according to any one of claims 1-2 or the engineered Streptomyces bacteria obtained by the construction method according to claim 3, characterized in that: The method is specifically: culturing the engineered Streptomyces bacteria in a fermentation medium, and obtaining a fermentation product after the culturing, and separating tacrolimus from the fermentation product.
5. The method for producing tacrolimus according to claim 4, characterized in that: The fermentation medium comprises the following components at the following concentrations: glucose 10 g / L, malt dextrin 50 g / L, yeast powder 15 g / L, cottonseed cake powder 30 g / L, K2HPO4 2 g / L, isoleucine 6 g / L, and calcium carbonate 2 g / L.
6. The method of producing tacrolimus according to claim 4, characterized by: The culturing condition is: fermentation culturing at 200-220 rpm and 28-30℃ for 144-192 hours.
7. Use of the engineered Streptomyces bacteria according to any one of claims 1-2 in the production of tacrolimus.
Citation Information
Patent Citations
Streptomycete and use thereof
CN101481662A
Method for improving yield of tacrolimus
CN112159826A
Streptomyces tsukukuki strain for producing tacrolimus through fermentation and application thereof
CN113717892A
Genetically engineered bacterium of over-expressed rapX-coded exogenous FK506 transporter, construction method and application thereof
CN114045249A
Culture medium for fermenting tacrolimus and fermentation method of tacrolimus
CN108384819A