Detection agent for nucleic acid markers for diagnosing mycobacterium tuberculosis infection and its application

Abstract

The present disclosure generally relates to the field of clinical detection technology, and more specifically, to a detection agent for nucleic acid markers for diagnosing Mycobacterium tuberculosis infection and its application. The present invention unexpectedly discovered that the nucleic acid segments shown in SEQ ID NO: 1 and SEQ ID NO: 2 can be used as novel molecular markers for isothermal amplification reaction detection and diagnosis of Mycobacterium tuberculosis infection. Compared with the commonly used detection segments disclosed in the traditional technology, these two segments have very good adaptability to the isothermal amplification reaction technology and can be used in the preparation of preparations for diagnosing Mycobacterium tuberculosis infection.

Description

Technical Field

[0001] The present disclosure generally relates to the field of clinical detection technology, and in particular, to a detection agent for nucleic acid markers for diagnosing Mycobacterium tuberculosis infection and applications thereof. Background Art

[0002] The pathogen of tuberculosis is Mycobacterium tuberculosis, which mainly includes human Mycobacterium tuberculosis, bovine Mycobacterium tuberculosis, Mycobacterium African tuberculosis and Mycobacterium tuberculosis of mice; it can enter the body through the respiratory tract, digestive tract and damaged skin and mucous membranes, invade multiple tissues and organs, and cause tuberculosis of the corresponding organs, especially pulmonary tuberculosis, which is the most common.

[0003] The research and development momentum of tuberculosis diagnostic technology is strong, mainly covering the fields of tuberculosis screening, latent tuberculosis infection detection and drug-resistant tuberculosis diagnosis. Tuberculosis diagnosis can be divided into four categories according to its intended use: Mycobacterium tuberculosis (MTB) detection reagents, drug sensitivity detection reagents, MTB+drug sensitivity detection reagents (dual function), and strain identification reagents. At present, there are many technology platforms for pulmonary tuberculosis diagnosis, such as enzyme-linked immunosorbent assay, fluorescent PCR method, colloidal gold method, mycobacterium culture, etc. From the perspective of detection technology, the bacteriological and immunological detection technologies of tuberculosis have long detection time, poor sensitivity or specificity, and cannot distinguish between active tuberculosis and latent infection of Mycobacterium tuberculosis, which to a certain extent restrict the early diagnosis and treatment of tuberculosis. With the continuous development of medical science and technology, molecular biology detection technology has been widely valued and applied in assisting the early diagnosis of tuberculosis.

[0004] At present, the molecular biology detection products for Mycobacterium tuberculosis approved at home and abroad are mainly based on fluorescent quantitative PCR technology, such as Cepei's Xpert MTB / RIF series and other products. However, these molecular biology detection technologies have limitations such as high platform requirements, complex operations, and expensive equipment, which hinder their popularization in primary medical institutions. In view of the above shortcomings, it is necessary to establish a Mycobacterium tuberculosis detection technology that is more suitable for primary and on-site detection.

[0005] Isothermal amplification is combined with CRISPR detection technology that can accurately identify single-base differences to ensure high specificity of detection, realize the forward and downward shift of tuberculosis nucleic acid detection, and make detection more convenient and quick. This scheme will greatly improve the efficiency of early diagnosis and monitoring of tuberculosis, and is expected to become an important technical support for grassroots and on-site tuberculosis prevention and control. At present, the molecular detection method used to detect the Mycobacterium tuberculosis complex is mainly based on PCR, including three steps of denaturation, annealing and extension. However, isothermal amplification is a method of achieving template amplification through the action of specific enzymes at a constant temperature. It is worth noting that not all amplification segments and markers suitable for PCR detection are suitable for isothermal amplification. Therefore, the research disclosed in this disclosure is mainly to find markers suitable for high-sensitivity Mycobacterium tuberculosis complex detection, which are not only suitable for PCR detection systems, but also more suitable for isothermal amplification systems. The present disclosure hopes to upgrade and promote Mycobacterium tuberculosis detection technology by developing relevant kits, thereby contributing to the development of disease detection technology. Summary of the invention

[0006] This disclosure covers the following technical solutions:

[0007] The first aspect of the present disclosure relates to the use of a detection agent for a nucleic acid marker in the preparation of a reagent or a kit for diagnosing Mycobacterium tuberculosis infection;

[0008] Wherein, the sequence of the nucleic acid marker is as shown in SEQ ID NO: 1 and / or SEQ ID NO: 2, and the detection agent is used to detect the nucleic acid marker in a biological sample through an isothermal amplification reaction.

[0009] Optionally, in the application described above, the detection agent includes primers and / or probes targeting the nucleic acid marker.

[0010] Optionally, in the application described above, the isothermal amplification reaction is one or more of recombinase polymerase isothermal amplification, loop-mediated isothermal amplification, rolling circle amplification technology, multiple displacement amplification, cross primer amplification, recombinase-mediated amplification, novel recombinase-dependent amplification, chain displacement amplification, and helicase-dependent amplification.

[0011] Optionally, as described above, the reagent or kit comprises a strand displacement DNA polymerase and / or a recombinase system.

[0012] Optionally, in the application described above, the reagent or kit further comprises an isothermal amplification reaction product detection agent to determine the presence or absence of Mycobacterium tuberculosis

[0013] Optionally, as described above, the isothermal amplification reaction product detection agent includes at least one of a CRISPR-Cas detection system, a dye and / or auxiliary agent for detecting double-stranded DNA, a fluorescent probe for hybridizing with the isothermal amplification reaction product, and a pH color development reagent.

[0014] Optionally, as described above, the CRISPR-Cas includes one or more of the following: a CRISPR-Cas12 detection system, a CRISPR-Cas13 detection system, and a Cas detection system having a bypass cleavage activity similar to that of Cas12 and / or Cas13.

[0015] Optionally, as described above, at least one component in the reagent or kit is solid, and the solid includes at least one of lyophilized microspheres, lyophilized cakes, lyophilized powders, and spots that rely on the presence of a solid medium.

[0016] Optionally, as described above, the biological sample is selected from one or more of tongue swab, sputum, saliva, serum, plasma, blood, urine, mucus, sweat, tears or other eye fluid, ear fluid, blisters, sores, gastric juice, gastric juice, alveolar lavage fluid, feces, pancreatic juice or juice, throat swab, nasal swab, conjunctival swab, semen, milk, cerebrospinal fluid, liquid bone marrow and lymph fluid.

[0017] A second aspect of the present disclosure relates to a reagent or a kit as defined in the first aspect.

[0018] A third aspect of the present disclosure relates to a method for detecting Mycobacterium tuberculosis in a sample, comprising:

[0019] a) obtaining isolated nucleic acid from a sample; b) amplifying potential nucleic acid markers in the nucleic acid using an isothermal amplification reaction; wherein the sequence of the nucleic acid marker is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2; and c) detecting the presence of the nucleic acid marker.

[0020] Optionally, in the method described above, the isothermal amplification reaction includes one or more of recombinase polymerase isothermal amplification, loop-mediated isothermal amplification, rolling circle amplification technology, multiple displacement amplification, cross primer amplification, recombinase-mediated amplification, novel recombinase-dependent amplification, chain displacement amplification, and helicase-dependent amplification.

[0021] Optionally, in the method described above, the detection method in c) is selected from at least one of CRISPR-Cas method, fluorescence method, and lateral flow immunochromatography.

[0022] The fourth aspect of the present disclosure relates to the use of a nucleic acid marker in the preparation of a reagent or a kit for diagnosing Mycobacterium tuberculosis infection, characterized in that the sequence of the nucleic acid marker is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2.

[0023] The inventors of the present disclosure unexpectedly discovered that the nucleic acid segments shown in SEQ ID NO: 1 and SEQ ID NO: 2 can be used as new molecular markers for isothermal amplification reaction detection and diagnosis of Mycobacterium tuberculosis infection. These two segments are from the IS6110 gene of Mycobacterium tuberculosis. Compared with the commonly used detection segments disclosed by traditional technology, they have very good adaptability to isothermal amplification reaction technology and can be used in the preparation of preparations for diagnosing Mycobacterium tuberculosis infection. The preparations for diagnosing Mycobacterium tuberculosis infection developed using the molecular markers of the present invention are used for diagnosing Mycobacterium tuberculosis infection, which are more sensitive, convenient, fast, highly specific and inexpensive. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the specific embodiments of the present disclosure or the technical solutions in the prior art, the drawings required for use in the specific embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present disclosure. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0025] Figure 1 The detection sensitivity (chromatographic method) test results of different detection sections in a sputum sample provided by one embodiment of the present disclosure;

[0026] Figure 2 The detection sensitivity (chromatographic method) test results of different detection sections in a tongue swab sample provided by one embodiment of the present disclosure;

[0027] Figure 3 The detection sensitivity (fluorescence method) test results of different detection sections in a sputum sample provided by one embodiment of the present disclosure;

[0028] Figure 4 The detection sensitivity (fluorescence method) test results of different detection sections in a tongue swab sample provided by one embodiment of the present disclosure;

[0029] Figure 5 The detection sensitivity (RAA fluorescence method) test results of different detection sections in sputum samples provided by one embodiment of the present disclosure;

[0030] Figure 6 The detection sensitivity (RAA fluorescence method) test results of different detection sections in the tongue swab sample provided by one embodiment of the present disclosure;

[0031] Figure 7 The detection sensitivity (LAMP fluorescence method) test results of different detection sections in sputum samples provided by one embodiment of the present disclosure;

[0032] Figure 8 The detection sensitivity (LAMP fluorescence method) test results of different detection sections in the tongue swab sample provided by one embodiment of the present disclosure. DETAILED DESCRIPTION

[0033] References to embodiments of the present disclosure will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present disclosure. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present disclosure without departing from the scope or spirit of the present disclosure. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0034] Unless otherwise specified, the meanings of all terms (including technical and scientific terms) used to disclose the present disclosure are the same as those commonly understood by those of ordinary skill in the art to which the present disclosure belongs. By way of further guidance, the following definitions are used to better understand the teachings of the present disclosure. The terms used in the present disclosure in the specification of the present disclosure are only for the purpose of describing specific embodiments and are not intended to limit the present disclosure.

[0035] In the present disclosure, unless otherwise specified, the scientific and technical terms used in the present disclosure have the meanings commonly understood by those skilled in the art. In addition, the protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology and laboratory operation procedures used in the present disclosure are terms and conventional procedures widely used in the corresponding fields. At the same time, in order to better understand the present disclosure, the definitions and explanations of the relevant terms are provided below.

[0036] The terms "and / or", "or / and", and "and / or" used in the present disclosure have a selection range that includes any one of two or more related listed items, and also includes any and all combinations of the related listed items, wherein the any and all combinations include any combination of two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in the present disclosure, the technical solution undoubtedly includes technical solutions that are all connected by "logical and", and undoubtedly includes technical solutions that are all connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution that is all connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the combination of four of A, B, C, and D (that is, the technical solution that is all connected by "logical AND").

[0037] As used in this disclosure, the terms "comprising," "including," and "including" are synonymous and are inclusive or open-ended and do not exclude additional, unrecited members, elements, or method steps.

[0038]

[0013] Numerical ranges recited in this disclosure as endpoints include all numbers and fractions subsumed within that range, as well as the recited endpoints.

[0039] As used in this disclosure, "about" a value or parameter includes (and describes) embodiments directed to the value or parameter itself. For example, description referring to "about X" includes description of "X".

[0040] The present disclosure relates to concentration values, and the meaning includes fluctuations within a certain range. For example, fluctuations can be allowed within a corresponding precision range. For example, 2%, fluctuations within a range of ±0.1% can be allowed. For values ​​that are large or do not require too fine control, the meaning is also allowed to include greater fluctuations. For example, 100mM, fluctuations within a range of ±1%, ±2%, ±5%, etc. can be allowed. In relation to molecular weight, fluctuations within a range of ±10% are allowed.

[0041] As used in this disclosure, the singular articles "a," "an," and "the" include plural referents unless otherwise indicated.

[0042] In the present disclosure, descriptions such as "plurality" and "multiple" refer to quantities greater than or equal to 2 unless otherwise specified.

[0043] In the present disclosure, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0044] In the present disclosure, "preferred", "better", "more preferred", and "suitable" are only used to describe implementation methods or examples with better effects, and it should be understood that they do not constitute a limitation on the scope of protection of the present disclosure. In the present disclosure, "optionally", "optional", and "optional" mean optional, that is, any one of the two parallel schemes of "yes" or "no". If multiple "options" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" is independent.

[0045] The “water” referred to in the present disclosure may be distilled water, purified water, filtered water, deionized water, etc., each independently being preferably nucleic acid-free water, and more independently being preferably nuclease-free water.

[0046] The term "primer" or "primer sequence" used in the present disclosure refers to a linear oligonucleotide that hybridizes to a target DNA template to produce a target DNA: primer hybrid and initiate a DNA synthesis reaction. The upper and lower limits of the primer length are determined empirically. The lower limit of the primer length is the minimum length required to form a stable duplex when hybridizing with the target nucleic acid under nucleic acid amplification reaction conditions. Very short primers (usually less than 3 nucleotides long) do not form thermodynamically stable duplexes with the target nucleic acid under such hybridization conditions. The upper limit is often determined by the possibility of duplex formation in regions other than the predetermined nucleic acid sequence in the target nucleic acid. Typically, suitable primer lengths are in the range of about 3 nucleotides to about 40 nucleotides. The primers may be RNA oligonucleotides, DNA oligonucleotides or chimeric sequences. The primers used in the present invention are preferably primers suitable for isothermal amplification reactions.

[0047] The dNTP mixture used in the present disclosure refers to a mixture of deoxyribonucleoside triphosphates, wherein N is a random nucleotide comprising any one of A, C, G or T / U.

[0048] The term "reaction temperature" used in the present disclosure refers to the temperature maintained during the amplification reaction. Embodiments of the present disclosure include isothermal amplification reactions, wherein the temperature of the reaction is constant. The entire isothermal amplification reaction is achieved at a reaction temperature, for example, the reaction temperature for an isothermal amplification reaction using GenomiPhi is about 30°C. The reaction temperature varies with varying conditions, including but not limited to the use of different polymerases, primers or template sizes, the use of additional salts or stabilizers. For RPA / RAA / RDA techniques, a suitable reaction temperature is preferably about 25°C to 40°C, preferably 35°C to 40°C, and more preferably 37°C; for LAMP technology, a suitable reaction temperature is preferably about 60°C to 65°C.

[0049] All documents mentioned in the present disclosure are cited as references in the present disclosure, just as each document is cited as a reference individually. Unless they conflict with the invention objectives and / or technical solutions of the present disclosure, the cited documents involved in the present disclosure are cited with all their contents and all their purposes. When the present disclosure involves cited documents, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited documents are also cited. When the present disclosure involves cited documents, the examples and preferred methods of the cited relevant technical features may also be incorporated into the present disclosure as references, but are limited to the implementation of the present disclosure. It should be understood that when the cited content conflicts with the description in the present disclosure, the present disclosure shall prevail or be modified adaptively according to the description of the present disclosure.

[0050] The first aspect of the present disclosure first relates to the use of a nucleic acid marker detection agent in the preparation of a reagent or a kit for diagnosing Mycobacterium tuberculosis infection;

[0051] Wherein, the sequence of the nucleic acid marker is as shown in SEQ ID NO: 1 and / or SEQ ID NO: 2, and the detection agent is used to detect the nucleic acid marker in a biological sample through an isothermal amplification reaction.

[0052] After rigorous experiments, the present invention randomly designed a variety of primers and / or probes suitable for isothermal amplification reactions while meeting relevant design principles. These primers and / or probes cover the nucleic acid sequences shown in SEQ ID NO: 1 and / or SEQ ID NO: 2 to verify their reliability as markers for diagnosing Mycobacterium tuberculosis infection.

[0053] In the present disclosure, unless otherwise stated, according to the general understanding of those skilled in the art, "nucleic acid marker", "targeted nucleic acid", "marker", "marker gene", "biochemical marker", "tuberculosis marker" or "Mycobacterium tuberculosis marker" refers to the full-length nucleotide sequence of "nucleic acid shown in SEQ ID NO: 1 and / or SEQ ID NO: 2", or naturally occurring variants, or fragments of the full-length sequence and variants, especially fragments that can be detected and determine the specific sequence; their meanings can be interchangeable according to the context. It specifically refers to a targeted nucleic acid to be used for analyzing a subject's biological sample.

[0054] The length of the targeted DNA amplified by the detection agent preferably includes at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120 consecutive nucleotides of the sequence of SEQ ID NO: 1; and / or, preferably includes at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180 or 181 consecutive nucleotides of the sequence of SEQ ID NO: 2.

[0055] In the present disclosure, the terms "biological sample", "sample", etc. refer to animal samples; tissues or organs, tissue lysates, which may be from animals (preferably at least including mammals, such as primates, including humans); cells (in the subject, directly taken from the subject, or maintained in culture or from cultured cell lines), cell lysates (or lysate portions) or cell extracts; solutions containing one or more molecules derived from cells, cell materials or viral materials (such as polypeptides or nucleic acids); or solutions containing naturally or non-naturally occurring nucleic acids, which are or can be measured as described in the present disclosure. In some embodiments, the sample contains nucleic acids. The sample may also be any body fluid or excreta containing one or more cells, cell components or nucleic acids, including but not limited to cellular, nuclear or cell-free nucleic acids. In particular, the biological sample of the present disclosure is preferably from a body fluid, which includes liquids, semi-solids, aerated liquids, liquid-gas mixtures, etc. from animals. Such body fluids may include, but are not limited to, one or more of tongue swabs, sputum, saliva, serum, plasma, blood, urine, mucus, sweat, tears or other eye fluids, ear fluids, blisters, sores, gastric juice, gastric juice, alveolar lavage fluid, feces, pancreatic juice or juice, throat swabs, nasal swabs, conjunctival swabs, semen, breast milk, cerebrospinal fluid, liquid bone marrow and lymph. The biological sample may also be a forensic sample or an ancient sample. The preferred biological sample of the present disclosure is selected from tongue swabs and sputum.

[0056] In some embodiments, the detection agent includes primers and / or probes targeting the nucleic acid marker.

[0057] "Primers and / or probes targeting the nucleic acid marker" refer to primers capable of targeted amplification of the nucleic acid marker, and / or probes that target and bind to the nucleic acid marker. The term "targeted amplification" used in the present disclosure refers to the process of amplifying a targeted nucleic acid. The targeted nucleic acid acts as a template in a DNA amplification reaction. A portion of a nucleic acid marker or the entire region of a targeted nucleic acid can be amplified by a DNA polymerase in a DNA amplification reaction to generate an amplification product or an amplicon. The amplicon may include multiple copies of the targeted nucleic acid or multiple copies of a sequence complementary to the targeted nucleic acid. The targeted nucleic acid may be from a biological sample. The isolated nucleic acid marker may be dispersed in a solution or may be fixed on a solid support such as a stain, an array, a slide, a microtiter plate, a bead, or an ELISA plate.

[0058] The primers and probes may be modified, and the modification may be performed by known methods. Modified versions of these primer and / or probe sequences may include, by way of non-limiting example, adding one or more nucleotides to the 5' end, adding one or more nucleotides to the 3' end, adding one or more nucleotides to both the 5' end and the 3' end, adding a tail, shortening the sequence, lengthening the sequence, moving the sequence up or downstream by a few bases, or any combination thereof.

[0059] Base modifications such as 3'P, 5'P, 5-nitroindole, 2-aminopurine, 8-amino-2'-deoxyadenosine, C-5 propynyl-deoxycytidine, C-5 propynyl-deoxyuridine, 2-amino-2'-deoxyadenosine-5'-triphosphate, 2,6-diaminopurine (2-amino-dA), reverse dT, reverse dideoxy-T, hydroxymethyl dC, iso-dC, 5-methyl dC, aminoethyl-phenoxazine-deoxycytidine, and locked nucleic acids (LNA's), and include at least one mismatched base at one of the bases, or replace at least one of the bases with an RNA base, to achieve, for example, increased nucleic acid interactions at the 3' end of the mutant-specific primer to increase Tm. The addition of double-stranded stabilizing base modifications has a positive effect on PCR, allowing it to be performed at higher temperatures, within which Taq polymerase is known to show maximum activity. The modified probe should retain the ability to distinguish between the mutant site to be detected and the wild-type site.

[0060] In some embodiments, the probe is labeled with a detectable signal substance. In some embodiments, the signal substance is a fluorophore, a colorimetric marker, colloidal gold, a quantum dot, biotin, and other label molecules that can be used for detection (such as an alkyne group for Raman diffraction imaging, a cyclic olefin for a click reaction, and an initiator group for polymer labeling), and can also be selected from polypeptide / protein molecules, LNA / PNA, non-natural amino acids and their analogs (such as peptoids), non-natural nucleic acids and their analogs (nucleotide mimics) and nanostructures (including inorganic nanoparticles, NV-centers, aggregation / assembly-induced luminescent molecules, rare earth ion ligand molecules, polymetallic oxygen clusters, etc.).

[0061] Lewis (1992, Genetic Engineering News 12: 1-9) and Abramson and Myers (1993, Curr. Opin. Biotechnol. 4: 41-47) provide good comprehensive reviews of amplification techniques. The techniques are primarily based on either techniques that require multiple cycles in the amplification process or techniques that are performed at a single temperature. The key aspect of the amplification process in techniques that are performed at a single temperature (referred to as isothermal techniques) is that it is performed at a single temperature. Unlike the PCR process (where the reaction product is heated to separate the two strands so that other primers can bind to the template to repeat the process), isothermal techniques rely on strand displacement polymerases to separate / displace the two strands of the duplex and recopy the template. The key point that distinguishes isothermal techniques is the method used to initiate the repeated process.

[0062] Broadly speaking, isothermal techniques can be subdivided into the following methods: methods that rely on primer displacement to initiate repeated template copies (exemplified below, HDA (helicase-dependent amplification), exonuclease-dependent amplification (EP1866434), recombinase polymerase amplification (RPA), recombinase-mediated amplification (RAA), novel recombinase-dependent amplification (RDA, see Chinese patent CN202010344702.7), loop-mediated amplification (LAMP), rolling circle amplification technology (RCA), multiple displacement amplification (MDA), cross-primer amplification technology (CPA)) and methods that rely on the continuous reuse of single primer molecules or de novo synthesis (exemplified below, SDA (strand displacement amplification and nucleic acid-based amplification (NASBA and TMA)).

[0063] As a more preferred scheme, in the present disclosure, the isothermal amplification reaction is one or more of recombinase polymerase isothermal amplification, loop-mediated isothermal amplification, rolling circle amplification technology, multiple displacement amplification, cross primer amplification, recombinase-mediated amplification, novel recombinase-dependent amplification, strand displacement amplification, and helicase-dependent amplification.

[0064] In some embodiments, the reagents or kits comprise a strand displacement DNA polymerase and / or a recombinase system.

[0065] The polymerases used in the disclosed method are preferably those having strand displacement activity. This activity is a well-known property of some DNA polymerases (Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, 2nd edition). The properties of DNA polymerases, especially the strand displacement activity of some of them, are given in detail by Kornberg and Baker et al., DNA Replication, 2nd edition, pages 113-225, Freeman, NY (1992). Strand displacement is not a common property of all DNA polymerases, because some of them (e.g., T4 DNA polymerase) cannot achieve strand displacement alone. In these cases, strand displacement can be achieved by adding polymerase auxiliary proteins. Initially, the Klenow fragment of Escherichia coli DNA polymerase I showed strand displacement activity (Masamune and Richardson, 1971, J. Biol. Chem. 246: 2692-2701), which gave the enzyme the ability to initiate nucleic acid replication from the 3' OH end of the double-stranded DNA cleavage site. This strand displacement activity has also been shown for thermostable DNA polymerases such as Tli DNA polymerase (Kong et al., 1993. J. Biol. Chem. 268: 1965-1975). In this case, it was also shown that a mutant form of the enzyme had no exonuclease 5'-3' activity, which had a higher strand displacement capacity. This strand displacement activity was also shown for T7 DNA polymerase (Lechner et al., 1983. J. Biol. Chem. 258: 11174-11184) and HIV reverse transcriptase (Huber et al., 1989, J. Biol. Chem. 264: 4669-4678). Exemplary strand displacement DNA polymerases are selected from phi29 DNA polymerase, Bsu DNA polymerase and Sau At least one DNA polymerase.

[0066] Suitable polymerases include pol I or pol I fragments or variants, such as those from E. coli, Bacillus bubtilis, Bacilus stearothermophilus or T7 polymerase. Polymerase holoenzyme complexes such as those described for bacteriophage T4 may also be used. Preferred polymerases are klenow, exo-, T7 polymerase or BST phi29 or pol-I or holoenzyme of Bacillus subtilis. Bsu DNA polymerase or SauDNA polymerase. In some embodiments, especially when using downstream elements or reverse complementation, the preferred polymerase does not have strong strand displacement activity like the Klenow fragment of E. coli pol I. In other embodiments, the strong strand displacement activity of the polymerase may be an advantage.

[0067] In the case where a recombinase is used for the chain insertion step, the system may require an energy source. Most of these enzymes utilize ATP as an energy source, but because ATP collates the magnesium ions necessary for enzyme activity, it is advantageous to provide an additional ATP regeneration system rather than increasing the concentration of ATP. The ATP regeneration system preferably comprises ATP and reagents used in the ATP regeneration system. In some embodiments, the reagents used in the ATP regeneration system are selected from one or more of magnesium ions, creatine phosphate and its counter ion, creatine kinase, myokinase, pyrophosphatase, sucrose and sucrose phosphorylase.

[0068] In some embodiments, the strand displacement DNA polymerase is a strand displacement DNA polymerase suitable for loop-mediated isothermal amplification technology. Strand displacement DNA polymerases suitable for LAMP are well known in the art, and common ones include EquiPhi29, Bst DNA polymerase, and Bsm DNA polymerase. The LAMP reaction system can also contain dNTP, Mg 2+ , betaine and the like.

[0069] Various recombinase systems are known to those skilled in the art and have been extensively reviewed (e.g., Piero R. Bianco et al. Frontiers in Bioscience 3, d570-603, 1998, 570). Any recombinase system can be used in the method disclosed herein, and the detailed application of recombinases for double-stranded insertion of nucleic acids is known to those skilled in the art (Kodadek T et. Al., JBC 264, 1989; and Liu J, JBC Na Qian1, 281, 26308-26319, 2006).

[0070] The recombinase system can include components derived from yeast, bacterial phage or mammals or other eukaryotic organisms. The recombinase system can be mesophilic or thermophilic. For example, the recombinase can be derived from a myoviridae phage. The myoviridae phage can be, for example, T4, T2, T6, Rb69, Aehl, KVP40, acinetobacter phage 133, Aeromonas phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rbl4, Rb32, Aeromonas phage 25, Vibrio phage nt-1, phi-1, Rbl6, Rb43, phage 31, phage 44RR2.8t, Rb49, phage Rb3, or phage LZ2. In a preferred embodiment, the T4 recombinase UvsX can be used. The eukaryotic Rad system or the recA-Reco system of Escherichia coli or other prokaryotic systems may also be used. Generally, the recombinase of RPA is derived from T4 phage, such as Escherichia phage phT4A phage; the recombinase of RAA is derived from bacteria or fungi.

[0071] Typically recombinases will polymerize on a single stranded oligonucleotide in a 5'-3' direction. The present disclosure as described herein relates to such recombinases. However, recombinases can polymerize in a 3'-5' direction and such recombinases can also be used in the methods of the present disclosure. In this case and with reference to the directionality of the components, the reverse direction applies.

[0072] Recombinase auxiliary proteins can be included in the system. In some embodiments, the recombinase system comprises a recombinase capable of binding to single-stranded nucleic acids, a single-stranded DNA binding protein (e.g., gp32) and a recombinase loader (e.g., UvsY). In a preferred embodiment, the recombinase system comprises T4 gp32, UvsX and UvsY. The recombinase loader is used to change the reversible reaction process of the dissociation and rebinding of the recombinase-primer complex, so that the reaction is more conducive to isothermal nucleic acid amplification.

[0073] Recombinase (e.g., UvsX), as well as recombinase loading agents (e.g., UvsY) and single-stranded DNA binding proteins (e.g., gp32), can each be a natural, hybrid or mutant protein from the same or different Myoviridae phage sources. A natural protein can be a wild type or natural variant of a protein. A mutant protein (also referred to as a genetically engineered protein) is a natural protein with a natural or artificial mutation such as an insertion, deletion, substitution, or a combination thereof at the N-terminus, C-terminus, or internally (between the N-terminus and the C-terminus). A hybrid protein (also referred to as a chimeric protein) includes sequences from at least two different organisms. For example, a hybrid UvsX protein can include amino acids from one species (e.g., T4), but also includes a DNA binding loop from another species (e.g., T6). A hybrid protein can include improved properties compared to a natural protein. The improved properties can be an increased or faster amplification rate, or a reduced or more controllable amplification rate.

[0074] Other components for enhancing the efficiency of the recombinase system may also be included in the reagents or kits of the present disclosure, such as one or more of a pH adjuster, dNTP, a molecular crowding agent, DTT, DMSO, betaine, proline, a detergent, and water.

[0075] The term "molecular crowding agent" as used in the present disclosure refers to an agent or molecule that changes the properties of other molecules in a solution. Examples of molecular crowding agents include, but are not limited to, at least one of serum albumin (such as BSA and / or HSA), dextran, and polyethylene glycol (PEG). Typically, the molecular crowding agent has a high molecular weight or a bulky structure that creates a crowded environment in a solution containing other molecules. The molecular crowding agent reduces the volume of solvent available to other molecules in the solution, which causes molecular crowding. The molecular crowding can change the rate or equilibrium constant of a reaction. In one or more embodiments, the molecular crowding agent used in the amplification reaction is selected from serum albumin, PEG, Ficoll, colloid, trehalose, and combinations thereof. In one embodiment, the molecular crowding agent includes BSA and / or PEG of various molecular weight distributions. In one embodiment, the molecular crowding agent is selected from PEG 400, PEG 2000, PEG 6000, PEG 8000, and combinations thereof.

[0076] In some embodiments, the kit further comprises an isothermal amplification reaction product detection agent to determine the presence or absence of Mycobacterium tuberculosis.

[0077] The detection method of isothermal amplification reaction product may or may not rely on nucleic acid amplification. As used in the present disclosure, the term "isothermal amplification reaction product detection agent" refers to further detecting the amplification product based on the isothermal amplification product generated by the detection agent of the nucleic acid shown in SEQ ID NO: 1 and / or SEQ ID NO: 2 provided in the present disclosure to increase the accuracy, specificity and / or convenience of Mycobacterium tuberculosis diagnosis.

[0078] Isothermal amplification reaction product detectors can be based on any method for determining the nucleotide composition of the target nucleic acid, including but not limited to DNA sequencing methods, probe hybridization methods, detection after transcription of DNA into RNA, structure-specific cleavage assays (e.g., INVADER assay, (Hologic, Inc.) and described in, for example, U.S. Pat. Nos. 5,846,717, 5,985,557, 5,994,069, 6,001,567, 6,090,543, and 6,872,816; Lyamichev et al., Nat. Biotech., 17:292 (1999), Hall et al., PNAS, USA, 97:8272 (2000), and US 2009 / 0253142, each of which is incorporated herein by reference in its entirety for all purposes); enzymatic mismatch cleavage methods (e.g., Variagenics, U.S. Pat. Nos. 6,110,684, 5,958,692, 5,851,770, which are incorporated herein by reference in their entirety); polymerase chain reaction (PCR) as described above; branched hybridization methods (e.g., Chiron, U.S. Pat. Nos. 5,849,481, 5,710,264, 5,124,246 and 5,624,802, which are incorporated herein by reference in their entirety); rolling circle replication (e.g., U.S. Pat. Nos. 6,210,884, 6,183,960 and 6,235,502, which are incorporated herein by reference in their entirety); NASBA (e.g., U.S. Pat. No. 5,409,818, which is incorporated herein by reference in its entirety) ; molecular beacon technology (e.g., U.S. Pat. No. 6,150,097, which is incorporated herein by reference in its entirety); E-sensor technology (Motorola, U.S. Pat. Nos. 6,248,229, 6,221,583, 6,013,170 and 6,063,573, which are incorporated herein by reference in their entirety); circular probe technology (e.g., U.S. Pat. Nos. 5,403,711, 5,011,769 and 5,660,988, which are incorporated herein by reference in their entirety); Dade Behring signal amplification method (e.g., U.S. Pat. Nos. 6,121,001, 6,110,677, 5,914,230, 5,882,867 and 5,792,614, which are incorporated herein by reference in their entirety); ligase chain reaction (e.g., Baranay Proc. Natl. Acad. Sci. USA 88,189-93 (1991)); sandwich hybridization method (e.g., U.S. Pat. No. 5,288,609, which is incorporated herein by reference in its entirety); and the CRISPR-Cas12 detection system preferred in the present disclosure.

[0079] In some preferred embodiments, the isothermal amplification reaction product detection agent includes at least one of a CRISPR-Cas detection system, a dye and / or auxiliary agent for detecting double-stranded DNA, a fluorescent probe for hybridizing with the isothermal amplification reaction product, and a pH color development reagent.

[0080] According to the type of nucleic acid molecule detected, CRISPR / Cas technology nucleic acid detection can be divided into DNA (CRISPR / Cas9, CRISPR / Cas12 and CRISPR / Cas12 recognize DNA sequences) and RNA (CRISPR / Cas13 recognizes RNA sequences) detection. Furthermore, the CRISPR-Cas includes one or more of the following: CRISPR-Cas12 detection system, CRISPR-Cas13 detection system, and Cas detection system with bypass cleavage activity similar to Cas12 and / or Cas13. Among them, the CRISPR-Cas12 detection system is preferably a CRISPR-Cas12a detection system, and the CRISPR-Cas13 detection system is preferably a CRISPR-Cas13a detection system.

[0081] The dye and / or auxiliary agent used to detect double-stranded DNA is a component commonly used in conjunction with LAMP technology. The dye can be selected from at least one of SYBR Green I, EvaGreen, PicoGreen, Peko Green, propidium iodide, calcein or hydroxynaphthol blue. The auxiliary agent can be selected from at least one of betaine, L-proline, DTT, DMSO, soil temperature 20, and NP40.

[0082] The components in the reagent or kit can be packaged in the form of a solution, a solid or a test strip. In some preferred embodiments, at least one component in the reagent or kit is a solid, and the solid includes at least one of freeze-dried microspheres, freeze-dried cakes, freeze-dried powders, and spots that depend on the presence of a solid medium. Therefore, the components required for nucleic acid amplification (and preferably nucleic acid detection) can be provided in a freeze-dried form, particularly various enzymes, nucleic acid components, and reaction buffer components, etc. In this way, the nucleic acid amplification (and preferably nucleic acid detection) process can be directly started in a very user-friendly manner by adding the sample to be quantified and optionally other required components.

[0083] The present disclosure also provides a kit, which is the reagent or kit mentioned in the above application.

[0084] The kit disclosed herein comprises a detection agent, which is used to detect a nucleic acid marker in a biological sample by an isothermal amplification reaction, wherein the sequence of the nucleic acid marker is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2. In particular, it comprises at least one of a detection agent (primer and / or probe) for a nucleic acid marker, and a detection agent for an isothermal amplification reaction product (particularly a CRISPR-Cas detection system).

[0085] The term "kit" in the present disclosure may refer to any article (e.g., package or container) comprising at least one device, which includes a detection agent as described in the present disclosure. The kit may further include instructions for use, supplementary reagents and / or components or components used in the methods or steps thereof described in the present disclosure.

[0086] The present disclosure also provides a Mycobacterium tuberculosis diagnostic device, which includes one or more independent modules, at least one of which contains the reagents or kits described above, or components thereof.

[0087] Among them, the modules and the kit in the diagnostic device can be packaged separately, or at least some of the components (primers, probes, reaction buffers, enzymes, etc.) in the kit are pre-filled in the nucleic acid detection device. The nucleic acid detection device is usually conducive to nucleic acid detection, such as preventing contamination during the detection process, speeding up the detection speed (such as detecting multiple samples at the same time), facilitating the preservation of the components in the kit during the detection process, or improving the convenience and / or accuracy of the detection in other ways. The use of these diagnostic devices is generally used by those skilled in the art, and exemplary diagnostic devices include any one or more of the devices described in CN202010571470.9, CN202021162806.8, CN202010769972.2, CN202021585862.2 and CN202210062076.1.

[0088] In some embodiments, the independent module includes one or more containing units, and the containing unit is provided with a nucleic acid marker amplification system and / or a detection system.

[0089] In some embodiments, at least one containing unit comprises at least some of the components of the reagents or kits.

[0090] According to yet another aspect of the present disclosure, there is also provided a method for detecting Mycobacterium tuberculosis in a sample, comprising:

[0091] a) obtaining isolated nucleic acid from a sample; b) amplifying potential nucleic acid markers in the nucleic acid using an isothermal amplification reaction; wherein the sequence of the nucleic acid marker is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2; and c) detecting the presence of the nucleic acid marker.

[0092] In some embodiments, the isothermal amplification reaction includes one or more of recombinase polymerase isothermal amplification, loop-mediated isothermal amplification, rolling circle amplification technology, multiple displacement amplification, cross primer amplification, recombinase-mediated amplification, novel recombinase-dependent amplification, strand displacement amplification, and helicase-dependent amplification.

[0093] In some embodiments, the detection method in c) is selected from at least one of CRISPR-Cas method, fluorescence method, and lateral flow immunochromatography.

[0094] In some embodiments, step c) is detected by an isothermal amplification reaction product detection agent.

[0095] In some embodiments, the target nucleic acid is an environmental sample or a biological sample.

[0096] Environmental samples can be samples from public or private places, indoor or outdoor (such as air, soil, water, etc.). Public places include hospitals, schools, bus stations, railway stations, airports, etc.

[0097] In some embodiments, the method is used to diagnose Mycobacterium tuberculosis infection.

[0098] In some embodiments, at least one of the nucleic acid marker, isothermal amplification reaction, and isothermal amplification reaction product detection agent has the same meaning as described in the first aspect.

[0099] The embodiments of the present disclosure will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present disclosure and are not intended to limit the scope of the present disclosure. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance given in the present disclosure, and can also be based on the experimental manuals or conventional conditions in the art, and can also be based on other experimental methods known in the art, or according to the conditions recommended by the manufacturer.

[0100] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0101] Example 1 Novel molecular markers for diagnosing Mycobacterium tuberculosis infection

[0102] IS6110 is a commonly used Mycobacterium tuberculosis detection gene. The present disclosure provides two novel molecular markers for diagnosing Mycobacterium tuberculosis infection. The molecular marker sequences correspond to segments 1 and 2, respectively:

[0103] Segment 1 starts from base 544 of the IS6110 gene and extends to base 663. The specific sequence is as follows:

[0104] GCGATGGCGAACTCAAGGAGCACATCAGCCGCGTCCACGCCGCCAACTACGGTGTTTACGGTGCCCGCAAAGTGTGGCTAACCCTGAACCGTGAGGGCATCGAGGTGGCCAGATGCACCG (SEQ ID NO: 1)

[0105] Segment 2 starts from base 1090 of the IS6110 gene and extends to base 1270. The specific sequence is as follows:

[0106] AAGCTCCTATGACAATGCACTAGCCGAGACGATCAACGGCCTATACAAGACCGAGCTGATCAAACCCGGCAAGCCCTGGCGGTCCATCGAGGATGTCGAGTTGGCCACCGCGCGCTGGGTCGACTGGTTCAACCATCGCCGCCTCTACCAGTACTGCGGCGACGTCCCGCCGGTCGAACTC (SEQ ID NO: 2)

[0107] For comparison, the molecular markers of IS6110 commonly used in the prior art are listed as segment 3 and segment 4:

[0108] Segment 3 is found in the Chinese patents CN202311778526.8 and CN201310009018.3 of Shengxiang Biotechnology. It is a middle segment, starting from the 665th base of the IS6110 gene and extending to the 870th base. The specific sequence is as follows:

[0109] CGAACGGCTGATGACCAAAACTCGGCCTGTCCGGGACCACCCGCGGCAAAGCCCGCAGGACCACGATCGCTGATCCGGCCACAGCCCGTCCCGCCGATCTCGTCCAGCGCCGCTTCGGACCACCAGCACCTAACCGGCTGTGGGTAGCAGACCTCACCTATGTGTCGACCTGGGCAGGGTTCGCCTACGTGGCCTTTGTCACCGACG (SEQ ID NO: 3)

[0110] Segment 4 is a detection segment found in the Cepei literature (The New Xpert MTB / RIF Ultra: Improving Detection of Mycobacterium tuberculosis and Resistance to Rifampin in an Assay Suitable for Point-of-Care Testing. mBio. 2017 Aug 29;8(4):e00812-17. doi: 10.1128 / mBio.00812-17. PMID: 28851844; PMCID: PMC5574709.). It starts from the 1010th base of the IS6110 gene and extends to the 1120th base. The specific sequence is as follows:

[0111] AGGGGATCTCAGTACACATCGATCCGGTTCAGCGAGCGGCTCGCCGAGGCAGGCATCCAACCGTCGGTCGGAGCGGTCGGAAGCTCCTATGACAATGCACTAGCCGAGACG (SEQ ID NO: 4)

[0112] Example 2 Diagnostic effect of new molecular markers - based on PCR detection technology

[0113] This example uses PCR detection technology and is based on different sample types (plasma samples, tongue swab samples, sputum samples, and bronchoalveolar lavage fluid) to compare the diagnostic effects of the markers provided by the present disclosure with common existing markers in Mycobacterium tuberculosis infection.

[0114] The experimental process and method of this embodiment are specifically shown below.

[0115] 1. Sample collection

[0116] 1.1 Plasma collection: Collect whole blood using EDTA blood collection tubes and centrifuge at room temperature for 1 hour to obtain plasma. Centrifugation conditions: 1500g, 10 minutes, aspirate the supernatant, centrifuge again: 12000g, centrifuge for 10 minutes, aspirate the supernatant, which is the separated plasma, sample volume 2mL.

[0117] 1.2 Tongue swab sample collection: Stick out your tongue and hold it, place the swab on the back of the tongue, press and roll the swab along the cheek for about 10 seconds (roll and collect 7-8 times), and store the swab in a storage tube.

[0118] 1.3 Sputum sample collection: After getting up in the morning, the patient rinses his mouth repeatedly with clean water to reduce the contamination of normal flora, and coughs the first mouthful of sputum from the trachea into a sterile sampling tube. The sputum sample volume is 2 mL.

[0119] 1.4 Bronchoalveolar lavage collection method: According to the operating procedures, sterile saline is injected into the local alveoli with a bronchoscope.

[0120] Water, negative pressure recovery lavage fluid in a sterile sampling tube. Alveolar lavage fluid sample volume 2mL.

[0121] 2. Sample Processing

[0122] 2.1 Plasma / tongue swab / alveolar lavage fluid / sputum sample processing: Use Jiangsu Weizhen nucleic acid extraction and purification reagent to extract the samples.

[0123] 3. Nucleic acid testing

[0124] (1) PCR primers and probes

[0125] The following are the detailed information of the detection primers and probes designed for each detection segment as shown in Table 1:

[0126] Table 1 Different detection primers and probe sequences

[0127]

[0128] (2) PCR reaction system

[0129] Table 2 PCR reaction system

[0130]

[0131] (3) PCR reaction procedure

[0132] Pre-denaturation at 95°C for 5 min, 50 cycles of 95°C for 10 s, 60°C for 30 s, and 40°C for 20 s.

[0133] 4. Clinical sample testing

[0134] A total of 60 tuberculosis patients / non-tuberculosis patients with clinical diagnosis information were collected, and 4 different types of samples (plasma samples, tongue swab samples, sputum samples and bronchoalveolar lavage fluid) were collected.

[0135] 5. PCR test results of different segments

[0136] Table 3 Detection results of different detection sections

[0137]

[0138]

[0139] Table 4 Analysis of PCR test results in different detection sections

[0140]

[0141] According to the test data analysis results in Table 4, the PCR detection effect of IS6110 in segment 1 and segment 2 is consistent with the PCR detection effect of segment 3 and segment 4 reported in the prior art on different sample types.

[0142] Example 3 Diagnostic effect of new molecular markers - based on isothermal amplification + CRISPR detection technology

[0143] In this example, the analytical performance (using quality control products) and clinical performance (using clinical samples) of segments 1 to 4 were evaluated based on isothermal amplification combined with CRISPR-Cas12a or CRISPR-Cas13a detection technology.

[0144] 1. Pre-treatment

[0145] Quality control product: Chinese ginseng S2-S4 were extracted using the extraction kit described in 2.1 in Example 2;

[0146] Among them, Guoshen is a national reference product for Mycobacterium tuberculosis PCR detection kit purchased from the China Food and Drug Inspection Institute. The approval number of this Guoshen is (2010) Guoshengshenzi No. 0042, batch number: 230030-202205, and the minimum detection amount reference product for testing Guoshen. The specific specifications are as follows:

[0147] Detection object: Mycobacterium tuberculosis (CMCC 93009) single cell suspension;

[0148] S2 specification: 100 bacteria / mL;

[0149] S3 specification: 10 bacteria / mL;

[0150] S4 specification: 1 bacterium / mL.

[0151] Clinical samples: sputum specimens and tongue swab specimens were collected from 20 patients with pulmonary tuberculosis and 20 patients without pulmonary tuberculosis. The samples were extracted using the steps 1.2-1.3 in Example 2.

[0152] 2. Marker detection

[0153] The four segments were designed according to the principles of primer design and crRNA design, and each segment used 10 pairs of RAA reaction systems for RAA and CRISPR fluorescence and chromatography detection. The primer positions were randomized so that each group of 10 pairs of primers could cover the entire segment.

[0154] (1) Reaction system

[0155] The CRISPR detection system is shown in Table 5-1 and Table 5-2 below.

[0156] Table 5-1 CRISPR-Cas12a detection system

[0157]

[0158] Table 5-2 CRISPR-Cas13a detection system

[0159]

[0160] CRISPR detection primers are shown in Tables 5-3 to 5-10 below

[0161] Table 5-3 CRISPR-Cas12a detection primers (segment 1)

[0162]

[0163] Table 5-4 CRISPR-Cas12a detection primers (segment 2)

[0164]

[0165] Table 5-5CRISPR-Cas12a detection primers (segment 3)

[0166]

[0167] Table 5-6 CRISPR-Cas12a detection primers (segment 4)

[0168]

[0169] Table 5-7 CRISPR-Cas13a detection primers (segment 1)

[0170]

[0171]

[0172] Table 5-8 CRISPR-Cas13a detection primers (segment 2)

[0173]

[0174]

[0175] Table 5-9 CRISPR-Cas13a detection primers (segment 3)

[0176]

[0177] Table 5-10 CRISPR-Cas13a detection primers (segment 4)

[0178]

[0179]

[0180] (2) Reaction procedure:

[0181] The above products were mixed and centrifuged, then placed in a 37°C water bath for reaction, and 50 μL was taken for fluorescent CRISPR detection and line elimination test strip detection. The test strips and isothermal amplification reagents were purchased from Shanghai Liangrun.

[0182] 3. Test results

[0183] Table 6. Test results of RAA-CRISPR-Cas13a quality control and samples in different segments of IS6110 (chromatographic method)

[0184]

[0185] Table 7. Test results of RAA-CRISPR-Cas12a quality control and samples in different segments of IS6110 (fluorescence method)

[0186]

[0187] 4. Results Analysis

[0188] Table 8 Comparison of analytical performance of four detection segments based on RAA-CRISPR chromatography and fluorescence methods

[0189]

[0190] According to the test results of TB-CRISPR-Cas12a fluorescence method and TB-CRISPR-Cas13a chromatography method, the detection rates of detection segments 1 and 2 in tuberculosis sputum and tongue swab samples were stable at 75%-95%, which was significantly better than other detection segments. Figure 1-Figure 4 This indicates that detection segments 1 and 2 are better markers for isothermal amplification detection, with better detection performance and accuracy.

[0191] Example 4 Diagnostic effect of new molecular markers - based on RAA fluorescence technology

[0192] In this example, an IS6110 detection system based on the RAA fluorescence method was constructed. Ten detection systems were designed for each of the four segments in Example 1 according to the primer design principles, and the system performance was tested.

[0193] 1. Test methods

[0194] 25 sputum samples and tongue swab samples of pulmonary tuberculosis with clinically confirmed information, 25 tongue swabs of healthy people and 25 sputum samples of non-pulmonary tuberculosis patients were collected. Samples were extracted according to the method of Example 2 and detected by RAA fluorescence method.

[0195] 2. Detection Method

[0196] (1) Reaction system and primer sequences

[0197] The reaction system is shown in Table 9-1

[0198] Table 9-1 RAA-fluorescence reaction system

[0199]

[0200] The primer sequences are shown in Table 9-2 to

[0201] Table 9-2 RAA-fluorescence primers (segment 1)

[0202]

[0203] Table 9-3 RAA-fluorescence primers (segment 2)

[0204]

[0205] Table 9-4 RAA-fluorescence primers (segment 3)

[0206]

[0207] Table 9-5 RAA-fluorescence primers (segment 4)

[0208]

[0209] (2) Reaction procedure: 42°C for 1 min for 30 cycles, followed by cooling at 4°C for 2 min.

[0210] 3. Test results

[0211] The test results are shown in Table 10. Figure 5-Figure 6 As shown. Figure 5-Figure 6 The test results show that RAA fluorescence detection has better detection effects in sections 1 and 2 in 25 tongue swab and sputum samples.

[0212] (1) Comparison of analytical performance in four detection sections

[0213] Table 10 Comparison of analytical performance of four detection sections based on RAA fluorescence method

[0214]

[0215] (2) Comparison results of clinical performance of the four test sections are as follows Figure 5-Figure 6 shown.

[0216] Example 5 Diagnostic effect of new molecular markers - based on LAMP technology

[0217] In this example, a fluorescence detection system for IS6110 based on LAMP amplification was constructed, and the specific process is as follows.

[0218] 1. The primer sequences required for LAMP amplification were designed for four different segments based on the primer design principles.

[0219] Table 11-1 Primers for LAMP reaction (Section 1)

[0220]

[0221]

[0222] Table 11-2 Primers for LAMP reaction (Section 2)

[0223]

[0224]

[0225] Table 11-3 Primers for LAMP reaction (Section 3)

[0226]

[0227]

[0228] Table 11-4 Primers for LAMP reaction (Section 4)

[0229]

[0230]

[0231] 2. Detection Method

[0232] (1) The LAMP reaction mixture is prepared as shown in Table 11-5.

[0233] Table 11-5 LAMP reaction system

[0234]

[0235] (2) After the preparation is completed, place it at 65°C for 30 minutes.

[0236] 3. Test results

[0237] (1) LAMP fluorescence detection results are shown in Tables 12 and 13. Figure 7-Figure 8 shown.

[0238] Table 12 LAMP fluorescence quality control and sample test results

[0239]

[0240] Table 13 Comparison of analytical performance of four detection sections based on LAMP fluorescence method

[0241]

[0242] According to Table 12-Table 13 and Figure 7-Figure 8 From the test results, it can be seen that the detection effect of LAMP amplification fluorescence detection section 1 and detection section 2 is better and the sensitivity of detecting Chinese ginseng is better. The detection sensitivity in sputum and tongue swab samples is ≥87%, which is far better than detection section 3 and detection section 4.

[0243] In Examples 2-5 above, the present disclosure found that in the detection of quality control products and paired sputum and tongue swab samples, the detection segments 1 and 2 of the IS6110 gene showed significantly higher detection sensitivity, which was much better than the detection segments 3 and 4 reported by the traditional technology. This shows that our detection method has significant advantages in accuracy and reliability, and provides a more reliable option for TB diagnosis.

[0244] Example 6 A kit for diagnosing Mycobacterium tuberculosis infection (isothermal amplification-CRISPR)

[0245] 1. New molecular marker kit

[0246] The novel molecular markers - segment 1 and segment 2 were used in accordance with the isothermal amplification and CRISPR detection system constructed in Example 3 to establish a kit for diagnosing Mycobacterium tuberculosis infection (CRISPR fluorescence method); combined with an integrated sealing device and freeze-drying technology (CN 114058489 A / CN 116103377 B / CN 116496869 A), a kit for diagnosing Mycobacterium tuberculosis infection (CRISPR chromatography method) was established.

[0247] According to the results of Example 3, the detection limits of 9 of the 10 systems in Sections 1 and 2 were as low as S4 (1 bacterium / ml), and the positive detection rates of clinical sputum samples and tongue swab samples were ≥75%. Therefore, each section randomly selected a system to prepare a kit for comparison with the commercial one.

[0248] 2. Research Methods

[0249] Collect the following specimens with clinical diagnosis results:

[0250] (1) Tongue swab samples from 20 patients with pulmonary tuberculosis and 10 patients without pulmonary tuberculosis. The above 30 samples were tested using the RAA-CRISPR fluorescence detection kit constructed in the above-mentioned section 1 (using system 3 in Table 5-3) and section 2 (using system 5 in Table 5-4), the RAA-CRISPR chromatography detection kit in section 1 (using system 1 in Table 5-3) and section 2 (using system 1 in Table 5-4), as well as the Shengxiang PCR commercial kit (section 3) and the Cepei GeneXpert commercial kit (section 4).

[0251] (2) The sputum samples of 20 patients with pulmonary tuberculosis and 10 patients without pulmonary tuberculosis were tested using the above-mentioned Section 1 (using System 5 in Table 5-3) and Section 2 (using System 6 in Table 5-4), the bronchoalveolar lavage fluid samples of 10 patients with pulmonary tuberculosis were tested using the above-mentioned Section 1 (using System 7 in Table 5-3) and Section 2 (using System 9 in Table 5-4), and the plasma samples of 10 patients with pulmonary tuberculosis were tested using the above-mentioned Section 1 (using System 10 in Table 5-3) and Section 2 (using System 8 in Table 5-4). The above-mentioned 50 samples were tested using different RAA-CRISPR fluorescence detection kits constructed in Sections 1 and 2, as well as the Shengxiang PCR commercial kit (Section 3) and the Cepei GeneXpert commercial kit (Section 4).

[0252] (3) In the present invention, the "clinical diagnosis result" used as a positive control refers to the accurate diagnosis result of pulmonary tuberculosis made by the hospital based on a comprehensive consideration of the patient's symptoms / signs, medical history, other laboratory tests and treatment response (usually including several aspects in AE), combined with the results of the above examinations and the patient's clinical manifestations.

[0253] Specific diagnosis is based on: a. Clinical symptoms and signs: Typical symptoms include persistent cough for more than 3 weeks, expectoration, chest pain, hemoptysis, fever, night sweats (especially at night), weight loss, etc. Physical signs may include lung rales and pleural friction sounds. b. Radiological examination: Lung lesions such as nodules, infiltration shadows, cavities, etc. shown on chest X-ray or CT scan can support the diagnosis. c. Sputum smear and culture: Sputum smears are used to find Mycobacterium tuberculosis acid fast staining, Ziehl-Neelsen staining or acid-fast staining. Sputum culture is to culture Mycobacterium tuberculosis from sputum samples, which is one of the most reliable methods for diagnosing tuberculosis. d. Sputum smear and culture: Sputum smears are used to find Mycobacterium tuberculosis acid fast staining, Ziehl-Neelsen staining or acid-fast staining. Sputum culture is to culture Mycobacterium tuberculosis from sputum samples, which is one of the most reliable methods for diagnosing tuberculosis. e. Molecular biological testing: Such as PCR (polymerase chain reaction) technology, which can quickly detect Mycobacterium tuberculosis DNA, which helps to confirm the diagnosis more quickly.

[0254] 3. Test results

[0255] Table 14 Tongue swab sample test results

[0256]

[0257] Table 15 Sputum sample test results

[0258]

[0259] Table 16 Test results of bronchoalveolar lavage fluid samples

[0260]

[0261] Table 17 Plasma sample test results

[0262]

[0263] 1. Analysis of test results

[0264] Table 18 Comparison of detection rates of tongue swab CRISPR chromatography and fluorescence detection kits and commercial kits

[0265]

[0266] Table 19 Comparison of detection rates of CRISPR fluorescence detection kits and commercial kits in sputum / alveolar lavage fluid / plasma

[0267]

[0268] According to the analysis of Tables 14 to 19, the Mycobacterium tuberculosis complex detection kit (CRISPR immunochromatography, fluorescence method) based on TB-CRISPR detection segments 1 and 2 established in the present invention has a detection sensitivity of 85%-95% in tongue swab samples and a specificity of 100%, which is significantly better than commercially available detection kits. The same is true for the Mycobacterium tuberculosis complex detection kit (CRISPR fluorescence method) in sputum samples / alveolar lavage fluid / plasma.

[0269] Example 7 A kit for diagnosing Mycobacterium tuberculosis infection (isothermal amplification fluorescence method)

[0270] 1. Kit

[0271] The novel molecular markers - segment 1 and segment 2, were used in any of the 10 detection systems of RAA and LAMP fluorescence detection constructed in Examples 4 and 5 to establish a kit for diagnosing Mycobacterium tuberculosis infection.

[0272] Among them, the RAA fluorescence detection section 1 of the national reference S4 adopts system 3 in Table 9-2, and the detection section 2 adopts system 5 in Table 9-3. The RAA fluorescence detection section 1 of the tongue swab sample adopts system 4 in Table 9-2, and the detection section 2 adopts system 7 in Table 9-3.

[0273] Sputum samples RAA fluorescence detection segment 1 uses system 7 in Table 9-2, and detection segment 2 uses system 10 in Table 9-3; alveolar lavage fluid samples and plasma samples RAA fluorescence detection segment 1 uses system 2 in Table 9-2, and detection segment 2 uses system 8 in Table 9-3;

[0274] The LAMP fluorescence detection section 1 of Guoshen S4 adopts system 5 in Table 11-1, and the detection section 2 adopts system 7 in Table 11-2. The LAMP fluorescence detection section 1 of tongue swab samples adopts system 3 in Table 11-1, and the detection section 2 adopts system 9 in Table 11-2; the LAMP fluorescence detection section 1 of sputum samples adopts system 8 in Table 11-1, and the detection section 2 adopts system 3 in Table 11-2; the LAMP fluorescence detection section 1 of alveolar lavage fluid samples and plasma samples adopts system 9 in Table 11-1, and the detection section 2 adopts system 1 in Table 11-2;

[0275] 2. Research Methods

[0276] Analytical performance: Test quality control products (national ginseng S4 and S4 diluted in equal proportions).

[0277] Collect the following specimens with clinical diagnosis results:

[0278] (1) Tongue swab samples from 15 patients with pulmonary tuberculosis and 15 patients without pulmonary tuberculosis; (2) Sputum samples from 15 patients with pulmonary tuberculosis and 15 patients without pulmonary tuberculosis; (3) Bronchoalveolar lavage fluid samples from 10 patients with pulmonary tuberculosis; (4) Plasma samples from 10 patients with pulmonary tuberculosis. The above 80 samples were tested using the fluorescence detection kit constructed in the above sections 1 and 2, as well as the Shengxiang PCR commercial kit (section 3) and the Cepei GeneXpert commercial kit (section 4).

[0279] 3. Analysis of test results

[0280] (1) Analytical performance

[0281] Table 20 Test results of National Codonopsis S4

[0282]

[0283] (2) Clinical performance

[0284] Table 21 Test results of RAA and LAMP fluorescence samples in tongue swabs

[0285]

[0286] Table 22 Detection results of RAA and LAMP fluorescence samples in sputum samples

[0287]

[0288] Table 23 Detection results of RAA and LAMP fluorescence samples in bronchoalveolar lavage fluid samples

[0289]

[0290] Table 24 Detection results of RAA and LAMP fluorescence samples in plasma samples

[0291]

[0292] Table 25 Comparison of sensitivity of different detection kits for RAA and LAMP fluorescence samples

[0293]

[0294] According to the results in Tables 20 to 25, based on RAA and LAMP fluorescence detection technology, we compared detection section 1 and detection section 2, and found that both S4 and S4 were detectable after equal dilution in the test, and found that in tongue swabs and sputum / alveolar lavage fluid / plasma samples, our detection method showed significantly better detection sensitivity than commercially available kits.

[0295] Specifically, the results show that the RAA and LAMP fluorescence detection kits in the present invention can also stably detect 0.5 bacteria / ml of the reference material after S4 isoprolonged dilution, while the commercially available kits cannot meet this standard, and their sensitivity is significantly lower than that of our kit. In 15 tongue swab samples, the sensitivity of our kit reached 87%-93%, exceeding the commercially available Cepei GeneXpert test and Shengxiang PCR test kits, which were 67% and 60%, respectively. The same is true for other sample types, such as sputum samples (93% VS 87% VS 80%), alveolar lavage fluid (80% VS 70% VS 70%), and plasma samples (70%-80% VS 60% VS 60%), our kits all showed higher sensitivity and reliability. These results show that our kit provides a powerful tool for the early diagnosis and treatment of tuberculosis.

[0296] Example 8 Verification of the clinical detection usability of segment 1 and segment 2 using other isothermal amplification methods

[0297] 1. Research Methods

[0298] The new molecular markers - segment 1 and segment 2, were detected using high-sensitivity rolling circle amplification (HiRCA), multiple displacement amplification (MDA) and cross-primer amplification (CPA) methods. Different detection systems were designed based on the primer design principles to detect the following samples with clinical diagnostic results:

[0299] (1) Tongue swab samples from 20 patients with pulmonary tuberculosis and 20 patients without pulmonary tuberculosis. (2) Sputum samples from 20 patients with pulmonary tuberculosis and 20 patients without pulmonary tuberculosis. The samples were extracted using the steps 1.2-1.3 of Example 2.

[0300] 2. Analysis of test results

[0301] Table 26 Summary of clinical sample detection performance of different detection methods (HiRCA / MDA / CPA method) in segments 1 and 2

[0302]

[0303] According to Table 26, in 20 tongue swabs and 20 sputum samples, the detection sensitivity of different detection methods (HiRCA / MDA / CPA method) in segments 1 and 2 was 85%-95%, and the specificity was 100%. Our results show that under different isothermal amplification methods, our detection segments 1 and 2 showed high detection sensitivity. This means that no matter which isothermal amplification method is used, we can efficiently detect the target substance, which provides a more reliable and stable basis for our experiment.

[0304] Example 9 Inspection of environmental samples

[0305] 1. Research Methods

[0306] This experiment used the test kits in Examples 6, 7 and 8 to test different environmental samples. The test results were compared with the laboratory test results of the hospital to verify the effectiveness of the test kit composed of Sections 1 and 2 in testing environmental samples.

[0307] 2. Results Analysis

[0308] Table 27 Summary of results of environmental samples tested by different constant temperature testing methods

[0309]

[0310] According to the results in Table 27, the detection kit formed by Section 1 and Section 2 of the constant temperature detection method in this embodiment is not only suitable for the detection of body fluid samples such as human swabs or sputum, but also suitable for the detection of Mycobacterium tuberculosis in different environmental samples, so it has a wider applicability.

[0311] The above-described embodiments only express several implementation methods of the present disclosure, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present disclosure, and these all belong to the protection scope of the present disclosure. Therefore, the protection scope of the patent of the present disclosure shall be based on the attached claims, and the description and drawings may be used to interpret the contents of the claims.

Claims

1. Use of a nucleic acid marker detection agent in the preparation of a reagent or kit for diagnosing Mycobacterium tuberculosis infection; in, The sequence of the nucleic acid marker is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2, and the detection agent is used to detect the nucleic acid marker in a biological sample by an isothermal amplification reaction; The detection agent includes primers and probes targeting the nucleic acid markers; the sequences of the primers and probes are selected from the combinations shown in Table 5-3, Table 5-4, Table 5-7, Table 5-8, Table 9-2, Table 9-3, Table 11-1, and Table 11-2; Among them, Table 5-7 does not include the combination shown in system code 2, and Table 5-8 does not include the combination shown in system code 4.

2. The use according to claim 1, characterized in that: The reagent or kit comprises a strand displacement DNA polymerase and / or a recombinase system.

3. The use according to claim 1 or 2, characterized in that: The reagent or kit further comprises an isothermal amplification reaction product detection agent to determine the presence or absence of Mycobacterium tuberculosis.

4. The use according to claim 3, characterized in that: The sequences of the primers and probes are selected from the combinations shown in Table 5-3 and Table 5-4, and the isothermal amplification reaction product detection agent includes a CRISPR-Cas detection system, and the CRISPR-Cas includes one or more of the following: a CRISPR-Cas12 detection system, and a Cas detection system having a bypass cleavage activity similar to that of Cas12.

5. The use according to claim 3, characterized in that: The sequences of the primers and probes are selected from the combinations shown in Tables 5-7 and 5-8, and the isothermal amplification reaction product detection agent includes a CRISPR-Cas detection system, and the CRISPR-Cas includes one or more of the following: a CRISPR-Cas13 detection system, and a Cas detection system having a bypass cleavage activity similar to that of Cas13.

6. The use according to any one of claims 1, 2, 4 and 5, characterized in that: At least one component of the reagent or kit is solid, and the solid includes at least one of lyophilized microspheres, lyophilized cakes, lyophilized powders, and spots that rely on the presence of a solid medium.

7. The use according to any one of claims 1, 2, 4 and 5, characterized in that: The biological sample is selected from one or more of tongue swab, sputum, saliva, serum, plasma, blood, urine, sweat, tears or other eye fluid, ear fluid, blisters, sores, gastric juice, alveolar lavage fluid, feces, pancreatic juice, throat swab, nasal swab, conjunctival swab, semen, breast milk, cerebrospinal fluid, liquid bone marrow and lymph fluid.

8. A reagent or a kit, characterized in that It is a reagent or a kit as defined in any one of claims 1 to 7.

9. A Mycobacterium tuberculosis diagnostic device, characterized in that: The diagnostic device comprises one or more independent modules, at least one independent module comprising the reagent or kit of claim 8.

10. The diagnostic device according to claim 9, characterized in that The independent module includes one or more accommodating units, and the accommodating units are provided with a nucleic acid marker amplification system and / or a detection system.

11. The diagnostic device according to claim 10, characterized in that At least one containing unit contains at least part of the components in the reagent or kit.

12. A method for detecting Mycobacterium tuberculosis in a sample for non-diagnostic purposes, characterized in that: include: a) obtaining isolated nucleic acid from a sample; b) amplifying potential nucleic acid markers in the nucleic acid using an isothermal amplification reaction; wherein the sequence of the nucleic acid marker is as shown in SEQ ID NO: 1 and / or SEQ ID NO: 2; and c) detecting the presence of the nucleic acid marker; The detection agent used in step b) includes primers and probes targeting the nucleic acid marker; the sequences of the primers and probes are selected from the combinations shown in Table 5-3, Table 5-4, Table 5-7, Table 5-8, Table 9-2, Table 9-3, Table 11-1, and Table 11-2; Among them, Table 5-7 does not include the combination shown in system code 2, and Table 5-8 does not include the combination shown in system code 4.

13. The method according to claim 12, characterized in that The detection method in c) is selected from at least one of CRISPR-Cas method, fluorescence method, and lateral flow immunochromatography.

Images