Engineered strains of Zymomonas mobilis, preparation methods and applications

Abstract

This application relates to the technical field of *Zymomonas mobilis*, specifically to an engineered strain of *Zymomonas mobilis*, a preparation method thereof, and an application thereof. The engineered strain uses *Zymomonas mobilis* as the starting strain, and an exogenous 3-hydroxybutyric acid (3HB) synthesis pathway is introduced to obtain a strain with the ability to produce 3HB. Furthermore, by screening for highly efficient thioesterases in the 3HB synthesis pathway, increasing the copy number of 3HB synthesis genes, overexpressing genes related to cofactor supply, introducing an exogenous ethanol utilization pathway, constructing a penicillin-binding protein (PBPs)-deficient strain, optimizing the culture medium, and other systems of metabolic engineering and fermentation condition optimization, the 3HB yield is further increased to obtain a recombinant strain with high 3HB production and a 3HB preparation method. This *Zymomonas mobilis* has application prospects such as highly efficient biosynthesis of 3HB and biodegradable polymers.

Description

Technical Field

[0001] This application relates to the technical field of Zymomonas mobilis, specifically to an engineered strain of Zymomonas mobilis, a preparation method thereof, and applications thereof. Background Art

[0002] Zymomonas mobilis, as a facultative anaerobic Gram-negative bacterium that naturally produces ethanol, has a unique Entner-Doudoroff (ED) metabolic pathway and a high sugar fermentation efficiency. It also has characteristics of an ideal industrial cell factory, such as high ethanol production, low biomass generation, strong ethanol tolerance, high osmotic pressure tolerance, and no need for additional oxygen during the fermentation process. Currently, the production fermentations of products such as polyhydroxybutyrate (PHB), 2,3-butanediol, isobutanol, and lactic acid have been achieved in Zymomonas mobilis. In addition, through synthetic biology and metabolic engineering means, Zymomonas mobilis can be transformed into a chassis cell for utilizing various carbon sources to produce different platform compounds. Summary of the Invention

[0003] This application discloses an engineered strain of Zymomonas mobilis, a preparation method thereof, and applications thereof. This engineered strain can completely consume glucose and convert it into 3-hydroxybutyric acid (3HB), and has application prospects in the biosynthesis of 3HB, biodegradable bioplastics, pharmaceutical intermediates, etc.

[0004] Based on this, at least the following technical solutions are disclosed in the embodiments of this application:

[0005] In the first aspect, the embodiment discloses an engineered strain of Zymomonas mobilis. The engineered strain is Zymomonas mobilis ZMNPΔ0038 containing the acetyl-CoA transferase gene, acetoacetyl-CoA reductase gene, and thioesterase gene in the 3-hydroxybutyric acid synthesis pathway. Among them, the Zymomonas mobilis ZMNPΔ0038 is Zymomonas mobilis ZMNP-Cas12a with Cas12a knocked out. The acetyl-CoA transferase gene and the acetoacetyl-CoA reductase gene both originate from Alcaligenes eutrophus H16; the thioesterase gene originates from FadM, YciA, or TesB of Escherichia coli K-12.

[0006] In the second aspect, the embodiment discloses an engineered strain of Zymomonas mobilis. The engineered strain is Zymomonas mobilis ZMNPΔ0038 containing the acetyl-CoA transferase gene, acetoacetyl-CoA reductase gene, thioesterase gene; and containing the overexpressed phosphodehydrogenase gene. Among them, the Zymomonas mobilis ZMNPΔ0038 is Zymomonas mobilis ZMNP-Cas12a with Cas12a knocked out. The acetyl-CoA transferase gene and the acetoacetyl-CoA reductase gene both originate from Alcaligenes eutrophus H16. The thioesterase gene originates from TesB of Escherichia coli K-12.

[0007] In a third aspect, the embodiments disclose an engineered strain of Zymomonas mobilis. The engineered strain is Zymomonas mobilis ZMNPΔ0038 containing the acetyl-CoA transferase gene, acetoacetyl-CoA reductase gene, and thioesterase gene in the 3-hydroxybutyric acid synthesis pathway; containing the overexpressed phosphodehydrogenase gene; and containing the adh2 gene and ada gene in the ethanol utilization pathway. Among them, the Zymomonas mobilis ZMNPΔ0038 is Zymomonas mobilis ZMNP-Cas12a with Cas12a knocked out. The acetyl-CoA transferase gene and the acetoacetyl-CoA reductase gene both originate from Alcaligenes eutrophus H16. The thioesterase gene originates from TesB of Escherichia coli K-12.

[0008] In a fourth aspect, the embodiments disclose an engineered strain of Zymomonas mobilis. The engineered strain is Zymomonas mobilis ZMNPΔ0038 containing the acetyl-CoA transferase gene, acetoacetyl-CoA reductase gene, and thioesterase gene in the 3-hydroxybutyric acid synthesis pathway; and with the ZMO0959 gene knocked out. Among them, the Zymomonas mobilis ZMNPΔ0038 is Zymomonas mobilis ZMNP-Cas12a with Cas12a knocked out. The acetyl-CoA transferase gene and the acetoacetyl-CoA reductase gene both originate from Alcaligenes eutrophus H16. The thioesterase gene originates from TesB of Escherichia coli K-12.

[0009] In a fifth aspect, the embodiments disclose an engineered strain of Zymomonas mobilis. The engineered strain is Zymomonas mobilis ZMNPΔ0038 containing the acetyl-CoA transferase gene, acetoacetyl-CoA reductase gene, and thioesterase gene in the 3-hydroxybutyric acid synthesis pathway; and with the ZMO1089 gene knocked out. Among them, the Zymomonas mobilis ZMNPΔ0038 is Zymomonas mobilis ZMNP-Cas12a with Cas12a knocked out. The acetyl-CoA transferase gene and the acetoacetyl-CoA reductase gene both originate from Alcaligenes eutrophus H16. The thioesterase gene originates from TesB of Escherichia coli K-12.

[0010] Sixth aspect, the embodiments disclose an engineered strain of *Zymomonas mobilis*. The engineered strain contains the acetyl-CoA transferase gene, acetoacetyl-CoA reductase gene, and thioesterase gene in the 3-hydroxybutyric acid synthesis pathway; contains the overexpressed phosphodehydrogenase gene; contains the adh2 gene and ada gene in the ethanol utilization pathway; and *Zymomonas mobilis* ZMNPΔ0038 with the ZMO1089 gene knocked out. Among them, the *Zymomonas mobilis* ZMNPΔ0038 is *Zymomonas mobilis* ZMNP-Cas12a with Cas12a knocked out. The acetyl-CoA transferase gene and the acetoacetyl-CoA reductase gene both originate from *Ralstonia eutropha* H16. The thioesterase gene originates from TesB of Escherichia coli K-12.

[0011] Seventh aspect, the embodiments disclose a method for preparing an engineered strain of *Zymomonas mobilis*. The preparation method includes: obtaining *Zymomonas mobilis* ZMNPΔ0038 as the starting strain; preparing a recombinant plasmid, the recombinant plasmid carrying the acetyl-CoA transferase gene, acetoacetyl-CoA reductase gene, and thioesterase gene in the 3-hydroxybutyric acid synthesis pathway; and transferring the recombinant plasmid into the *Zymomonas mobilis* to obtain the engineered strain.

[0012] Eighth aspect, the embodiments disclose a method for preparing 3HB. The method includes: obtaining the engineered strain described in any one of the first to sixth aspects or the engineered strain prepared by the preparation method described in the seventh aspect; inoculating the engineered strain into a medium containing glucose for fermentation; and harvesting the 3HB from the fermentation product.

[0013] Ninth aspect, the embodiments disclose the application of the engineered strain described in any one of the first to sixth aspects or the engineered strain prepared by the preparation method described in the seventh aspect. The application is selected from at least one of the following: synthesizing 3HB; synthesizing ethanol; synthesizing polyhydroxybutyrate; synthesizing polyhydroxyalkanoate; synthesizing antibiotics; synthesizing pheromones or synthesizing amino acids. Description of the Drawings

[0014] Figure 1 Schematic diagram of the construction process of *Zymomonas mobilis* ZMNP-Cas12a provided in the examples.

[0015] Figure 2 Schematic diagram of the engineered strains NP-PtF, NP-PtY, NP-PtT1, NPTΔ1-PtT1, NPTΔ1-PtZT1, NPTΔ1-PtZT1 EUP 、NPΔ0959-PtZT1、NPΔ1089-PtZT1、NPTΔ3-PtZT1 EUP obtained by genome modification using the ZMNPΔ0038 strain as the starting strain in the examples.

[0016] Figure 3 Schematic diagrams of the recombinant plasmids pEZ-PtF, pEZ-PtY, pEZ-PtT1, pEZ-PtZT1, and pE39p-Pe provided for the examples EUP .

[0017] Figure 4 Schematic diagrams of the first editing plasmid (pL2R-ZMO1650), second editing plasmid (pL2R-ZMO0959), third editing plasmid (pL2R-ZMO1089), fourth editing plasmid (pL2R-ZMO1094), and fifth editing plasmid (pL2R-Cas12a) provided for the examples

[0018] Figure 5 Schematic diagram of the process of integrating the Pgap-TAB operon fragment into the ZMO1650 locus outside the nucleus of the genome of Zymomonas mobilis ZMNPΔ0038, knocking out the ZMO1089 locus of the genome, introducing the EUP operon into the ZMO1650 locus of the genome, overexpressing the endogenous phosphodehydrogenase (Zwf) of Zymomonas mobilis, and introducing an exogenous ethanol utilization pathway provided for the examples

[0019] Figure 6 Growth curves of the engineered strains NP-PtF, NP-PtY, and NP-PtT1 provided for the examples Figure 6 a shows the glucose consumption curve and the fermentation broth OD curve of the engineered strain NP-PtF Figure 6 b shows the 3HB and ethanol production curves of the engineered strain NP-PtF Figure 6 c shows the glucose consumption curve and the fermentation broth OD curve of the engineered strain NP-PtY Figure 6 d shows the 3HB and ethanol production curves of the engineered strain NP-PtY Figure 6 e shows the glucose consumption curve and the fermentation broth OD curve of the engineered strain NP-PtT1 Figure 6f shows the 3HB and ethanol production curves of the engineered strain NP-PtT1. In the figure, NP-pEZ15Asp is the growth curve of ZMNPΔ0038 transfected with plasmid pEZ15Asp. NP-PtF:Tc0 is the growth curve of the engineered strain NP-PtF without tetracycline induction. NP-PtF:Tc0.4 is the growth curve of the engineered strain NP-PtF induced by 0.4 μg / mL tetracycline. NP-PtF:Tc0.4 is the growth curve of the engineered strain NP-PtF induced by 0.8 μg / mL tetracycline. NP-PtF:Tc1.2 is the growth curve of the engineered strain NP-PtF induced by 1.2 μg / mL tetracycline. NP-PtY:Tc0 is the growth curve of the engineered strain NP-PtF without tetracycline induction. NP-PtY:Tc0.4 is the growth curve of the engineered strain NP-PtF induced by 0.4 μg / mL tetracycline. NP-PtY:Tc0.4 is the growth curve of the engineered strain NP-PtF induced by 0.8 μg / mL tetracycline. NP-PtY:Tc1.2 is the growth curve of the engineered strain NP-PtF induced by 1.2 μg / mL tetracycline. NP-PNP-PtT1:Tc0 is the growth curve of the engineered strain NP-PtF without tetracycline induction. NP-NP-PtT1:Tc0.4 is the growth curve of the engineered strain NP-PtF induced by 0.4 μg / mL tetracycline. NP-NP-PtT1:Tc0.4 is the growth curve of the engineered strain NP-PtF induced by 0.8 μg / mL tetracycline. NP-NP-PtT1:Tc1.2 is the growth curve of the engineered strain NP-PtF induced by 1.2 μg / mL tetracycline.

[0020] Figure 7 Growth curves of the engineered strains NP-PtT1 and NPTΔ1-PtT1 provided in the examples. Figure 7 a shows the glucose consumption curves and the OD curves of the fermentation broth of the engineered strains NP-PtT1 and NPTΔ1-PtT1. Figure 7 b shows the 3HB and ethanol production curves of the engineered strains NP-PtT1 and NPTΔ1-PtT.

[0021] Figure 8 Growth curves of the engineered strains NPTΔ1-PtZT1 and NPTΔ1-PtT1 provided in the examples. Figure 8 a shows the glucose consumption curves and the OD curves of the fermentation broth of the engineered strains NPTΔ1-PtZT1 and NPTΔ1-PtT1. Figure 8 b shows the 3HB and ethanol production curves of the engineered strains NPTΔ1-PtZT1 and NPTΔ1-PtT.

[0022] Figure 9The engineered strains NPTΔ1-PtZT1 and NPTΔ1-PtZT1 provided for the examples EUP growth curves. Figure 9 a shows the glucose consumption curves and the OD curves of the fermentation broth of the engineered strains NPTΔ1-PtZT1 and NPTΔ1-PtZT1 EUP Figure 9 b shows the 3HB and ethanol production curves of the engineered strains NPTΔ1-PtZT1 and NPTΔ1-PtZT1 EUP

[0023] Figure 10 The growth curves of the engineered strains NP-PtZT1, NPΔ0959-PtZT1 and NPΔ1089-PtZT1 provided for the examples Figure 10 a shows the glucose consumption curves and the OD curves of the fermentation broth of the engineered strains NP-PtZT1, NPΔ0959-PtZT1 and NPΔ1089-PtZT1 Figure 10 b shows the 3HB and ethanol production curves of the engineered strains NP-PtZT1, NPΔ0959-PtZT1 and NPΔ1089-PtZT1

[0024] Figure 11 The growth curves of the engineered strains NPTΔ1-PtZT1 EUP and NPTΔ3-PtZT1 EUP Figure 11 a shows the glucose consumption curves and the OD curves of the fermentation broth of the engineered strains NPTΔ1-PtZT1 EUP and NPTΔ3-PtZT1 EUP Figure 11 b shows the 3HB and ethanol production curves of the engineered strains NPTΔ1-PtZT1 EUP and NPTΔ3-PtZT1 EUP

[0025] Figure 12 The growth curves of the engineered strains NP-pEZ15Asp and NPTΔ1-PtZT1 provided for the examples EUP at different carbon-nitrogen ratios Figure 12 a shows the OD curves of the fermentation broth of the engineered strains NP-pEZ15Asp and NPTΔ1-PtZT1 EUP Figure 12 b shows the 3HB and ethanol production curves of the engineered strains NP-pEZ15Asp and NPTΔ1-PtZT1 EUP Specific implementation manners

[0026] ​​​​​​​In order to make the objectives, technical solutions and advantages of the present application clearer and more understandable, the present application will be further described in detail below in conjunction with embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application. Reagents not described in detail and individually in the present application are all conventional reagents and can be obtained from commercial sources; methods not described in detail and specifically are all conventional experimental methods and can be known from the prior art.

[0027] The production of fine chemicals is carried out through chemical synthesis. However, this traditional chemical synthesis method largely relies on non-renewable fossil resources such as petroleum as raw materials, and often leads to the problems of heavy metal and organic solvent residues during the synthesis process. Compared with traditional chemical synthesis, biosynthesis has the advantages of renewable raw materials, high safety, environmental friendliness, etc. With the continuous maturity of biosynthesis technology, cell factories are gradually applied to the synthesis of fine chemicals. 3-Hydroxybutyric acid (3HB) is an important fine chemical and is widely used in the chemical industry and the biomedical field. 3HB has therapeutic effects on various diseases such as hypertension, neurodegenerative diseases, and colitis. In industry, it can be used to synthesize biodegradable polymers such as polyhydroxybutyrate (PHB) and polyhydroxyalkanoate, and can also be used to synthesize precursors of various stereospecific fine chemicals such as antibiotics, pheromones, and amino acids.

[0028] 3HB has two enantiomers, (R)-3HB and (S)-3HB, and its biosynthesis is usually achieved through two different mechanisms. One is the depolymerization (in vitro or in vivo) of poly(R)-3-hydroxybutyric acid (PHB) synthesized by microorganisms. Due to the stereospecific limitation of PHB synthesis, it is only composed of (R)-3HB monomer units, and only (R)-3HB can be obtained after depolymerization. The other is the direct synthesis of (R)-3HB and (S)-3HB. Currently, most 3HB-producing strains are aerobic strains, while the remaining 3HB-producing strains have the disadvantages of low yield and long fermentation cycle. Zymomonas mobilis can utilize the Entner-Doudoroff (ED) pathway to consume sugar to produce ethanol. It has the advantages of good alcohol and acid tolerance, fast growth rate, biological safety, and being not easily infected by phages, and has been used as an excellent chassis cell to produce products such as 2,3-butanediol and isobutanol. As a facultative anaerobic organism, Zymomonas mobilis can ferment under anaerobic conditions, reducing the oxygen consumption energy and thus reducing the production cost. Moreover, it has previously been demonstrated that Zymomonas mobilis can produce PHB with high yield using acetyl coenzyme A, and the production pathway of the R-3HB precursor R-3HB-CoA already exists.

[0029] In this application, the starting strain is Zymomonas mobilis ZMNPΔ0038. Through genetic engineering, metabolic engineering and other means, a 3HB-producing strain of Zymomonas mobilis is obtained, and the 3HB yield is further increased by optimizing the culture medium conditions, making Zymomonas mobilis an efficient cell factory for 3HB production. Among them, these modification means include introducing the acetyl-CoA transferase gene, acetoacetyl-CoA reductase gene and thioesterase gene in the 3-hydroxybutyric acid synthesis pathway; introducing genes related to overexpressing cofactor supply (phosphodehydrogenase gene); introducing the adh2 gene and ada gene in the exogenous ethanol utilization pathway; knocking out the ZMO1089 gene and knocking out the ZMO0959 gene; increasing the copy number of genes related to the 3-hydroxybutyric acid synthesis pathway; and optimizing its fermentation medium.

[0030] In this application, Zymomonas mobilis ZMNPΔ0038 is Zymomonas mobilis ZMNP-Cas12a with Cas12a knocked out. The ZMNP-Cas12a strain was obtained with reference to CN115806922A. As Figure 1 shown, the construction process of the ZMNP-Cas12a strain generally includes: using Zymomonas mobilis ZM4-Cas12a as the starting strain. First, a first editing plasmid (which targets the elimination of pZM32 and pZM36) is constructed and transferred into ZM4-Cas12a to obtain the strain ZM4-Cas12aΔ32Δ36 with pZM32 and pZM36 eliminated; then the second editing plasmid (targeting the elimination of pZM33, specifically targeting the replicase gene ZMOp33×028 of pZM33) is transferred into ZM4-Cas12aΔ32Δ36 to obtain the strain ZM4-Cas12aΔ32Δ33Δ36 with the endogenous plasmids pZM32, pZM33 and pZM36 eliminated; then the fourth editing plasmid is transferred into ZM4-Cas12aΔ32Δ33Δ36, and the toxin-antitoxin system (T-A system) gene on the pZM39 plasmid is replaced with the chloramphenicol gene by homologous recombination to obtain the ZM4-Cas12aΔ32Δ33Δ36ΔTA::Cm strain; then the third editing plasmid (targeting the elimination of pZM39, specifically targeting the replicase gene ZMOp39×032 of pZM39) is transferred into the ZM4-Cas12aΔ32Δ33Δ36ΔTA::Cm strain to obtain the strain ZMNP-Cas12a.

[0031] Among them, Zymomonas mobilis ZM4-Cas12a was constructed by integrating the nuclease Cas12a gene derived from Francisella novicida and the spectinomycin resistance gene into the ZMO0038 locus of the ZM4 (Zymomonas mobilis subsp. mobilis ZM4 ATCC 3182) strain genome through homologous recombination. The construction method refers to "Establishment and application of a CRISPR-Cas12a assisted genome-editing system In Zymomonas mobilis [J], Microbial Cell Factories, 2019, 18:162". The engineered strain ZM4-Cas12 contains the endogenous CRISPR-IF gene editing system and the exogenous CRISPR-Cas12a editing system of Zymomonas mobilis. Among them, the four endogenous plasmids in the ZM4-Cas12a strain are named in order of size as: pZM32 (32,791 bp, Genbank accession number CP023678), pZM33 (33,006 bp, Genbank accession number NZ － P023679), pZM36 (36,494 bp, Genbank accession number CP023680) and pZM39 (39,266 bp, Genbank accession number CP023681).

[0032] Engineered strain introducing the 3-hydroxybutyric acid synthesis pathway

[0033] On the one hand, the embodiment discloses an engineered strain of Zymomonas mobilis. The engineered strain is Zymomonas mobilis ZMNPΔ0038 containing the acetyl-CoA transferase gene (PhaA), the acetoacetyl-CoA reductase gene (PhaB) and the thioesterase gene in the 3-hydroxybutyric acid synthesis pathway. Among them, both the acetyl-CoA transferase gene and the acetoacetyl-CoA reductase gene are derived from Alcaligenes eutrophus H16; the thioesterase gene is derived from FadM, YciA or TesB of Escherichia coli K-12.

[0034] In some embodiments, the engineered strain contains multiple copies of the PhaA, PhaB and thioesterase genes.

[0035] In some embodiments, the engineered strain contains at least one copy of PhaA located outside its nucleus, at least one copy of PhaB located outside its nucleus, and at least one copy of FadM located outside its nucleus. The engineered strain is obtained by transferring a recombinant plasmid carrying the operon composed of PhaA, PhaB, and FadM into ZMNPΔ0038. The recombinant plasmid is named pEZ-PtF, and the engineered strain is named NP-PtF.

[0036] In some embodiments, the engineered strain contains at least one copy of PhaA located outside its nucleus, at least one copy of PhaB located outside its nucleus, and at least one copy of YciA located outside its nucleus. The engineered strain is obtained by transferring a recombinant plasmid carrying the operon composed of PhaA, PhaB, and YciA into ZMNPΔ0038. The recombinant plasmid is named pEZ-PtY, and the engineered strain is named NP-PtY.

[0037] In some embodiments, the engineered strain contains at least one copy of PhaA located outside its nucleus, at least one copy of PhaB located outside its nucleus, and at least one copy of TesB located outside its nucleus. The engineered strain is obtained by transferring a recombinant plasmid carrying the operon composed of PhaA, PhaB, and TesB into ZMNPΔ0038. The recombinant plasmid is named pEZ-PtT1, and the engineered strain is named NP-PtT1.

[0038] Figure 6 Results of 3HB and ethanol of NP-PtF, NP-PtY, and NP-PtT1 under different concentrations of tetracycline induction are shown. As Figure 5 shown, an efficient thioesterase in the 3HB synthesis pathway was screened according to the growth of the fermentation strain and the 3HB yield. After testing, at a tetracycline concentration of 1.2 μg / mL, the 3HB yields of the strains NP-PtF, NP-PtY, and NP-PtT1 were 175.33 ± 3.06 mg / L, 187.00.67 ± 2.00 mg / L, and 425.67 ± 2.89 mg / L, respectively, and the 3HB yield of NP-PtT1 was the highest.

[0039] The embodiment also discloses a method for constructing the engineered strain. The method includes: obtaining Zymomonas mobilis ZMNPΔ0038 as the starting strain; preparing a recombinant plasmid, where the recombinant plasmid carries the acetyl-CoA transferase gene, acetoacetyl-CoA reductase gene, and thioesterase gene in the 3-hydroxybutyric acid synthesis pathway; and transferring the recombinant plasmid into the Zymomonas mobilis to obtain the engineered strain.

[0040] In some embodiments, the method for constructing the engineered strains (NP-PtF, NP-PtY, and NP-PtT1) includes:

[0041] 1. Construct recombinant plasmids (pEZ-PtF, pEZ-PtY, pEZ-PtT1)

[0042] In some embodiments, PhaA, PhaB, FadM, YciA, and TesB are respectively synthesized by PCR. For example, PhaA (SEQ ID NO.1) and PhaB (SEQ ID NO.2) (preserved in the general pUC plasmid vector) synthesized by GenScript Nanjing are used as DNA amplification templates, and primers for each gene are designed for PCR amplification to obtain PhaA and PhaB. For example, using the genome of Escherichia coli K-12 as a template, primers for each gene are designed for PCR amplification to obtain FadM (SEQ ID NO.3), YciA (SEQ ID NO.4), and TesB (SEQ ID NO.5) with homologous arms. Using the Escherichia coli genome as a template, the promoter Ptet (SEQ ID NO.6) is amplified by using primer pairs.

[0043] The primers for amplifying PhaA are:

[0044] PhaA-R10-F: ATGACCGATGTTGTCA ttgtctctgc, SEQ ID NO.7, the underlined part is the homologous arm.

[0045] PhaA-R: GTGCTTACTTTCTCTAG attatggttatttgcgttcaacggccaaag, SEQ ID NO.8, the underlined part is the homologous arm.

[0046] The primers for amplifying PhaB are:

[0047] PhaB-F: CTAGAGAAAGTAAGCAC atgacccaacgtattgcctatg, SEQ ID NO.9, the underlined part is the homologous arm.

[0048] PhaB-R: GCTCGAGATCTATGG ttaacccatatgcaagccaccattc, SEQ ID NO.10, the underlined part is the homologous arm.

[0049] The primers for amplifying FadM are:

[0050] FadM-F: ATCTCCCATGCAAAC acaaatcaaagttcg, SEQ ID NO.11, the underlined part is the homologous arm.

[0051] FadM-PhaA-R: TTTCTCTAGATTATG gttacttaaccatctgctccagct, SEQ ID NO.12, the underlined part is the homologous arm.

[0052] The primers for amplifying YciA are:

[0053] YciA-F: GAGAAAGGATCTCCC atgtctacaacacat, SEQ ID NO.13, the underlined part is the homologous arm.

[0054] YciA-PhaA-R: TGACAACATCGGTCAT gtgcttactttctctagattatggttactcaacaggtaag, SEQ ID NO.14, the underlined part is the homologous arm.

[0055] The primers for amplifying TesB are:

[0056] TesB-mwy-F: TCTCCCATGAGTCAGG cgcta, SEQ ID NO.15, the underlined part is the homologous arm.

[0057] TesB-R10-R: TGACAACATCGGTCAT gtgcttactttctctagattatggttaattgtgattacgc, SEQ ID NO.16, the underlined part is the homologous arm.

[0058] The primers for amplifying Ptet are:

[0059] Ptet-F: GATCTctcGAgCGTC ttaagacccactttcacatttaagttg, SEQ ID NO.17, the underlined part is the homologous arm.

[0060] Ptet-R: CCTGACTCATGGGAGA tcctttctcc, SEQ ID NO.18, the underlined part is the homologous arm.

[0061] In some embodiments, such as Figure 2As shown, using the RBS-10 sequence (CCATAATCTAGAGAAAGTAAGCAC), the promoter Ptet, TesB, PhaA, and PhaB DNA fragments were successively amplified by overlap PCR to obtain at least one operon Ptet-TAB. Reverse PCR was performed on pEZ15A using primers 15Afk-F (SEQ ID NO.19) and 15Afk-R (SEQ ID NO.20) to amplify the reverse amplification fragment of pEZ15A. Then, the operon Ptet-TAB and the reverse amplification fragment of plasmid pEZ15A were subjected to Gibson assembly reaction at a molar ratio of 3:1, and the ligation product was transferred into Escherichia coli DH5α competent cells. Positive clones were screened using kanamycin plates, single colonies were picked, and colony PCR was performed using pEZ15A-F (SEQ ID NO.21) and pEZ15A-R (SEQ ID NO.22) as primer pairs to verify the first positive transformant, and the positive transformants verified by colony PCR were further sequenced and verified. The recombinant plasmid extracted from the first positive transformant was introduced into the methylated Escherichia coli trans110 cell competent cells, and positive clones on the colony PCR verification plate were verified to obtain the second positive transformant. The plasmid as shown in Figure 3 was extracted from the second positive transformant cultured overnight. This plasmid is pEZ15A carrying Ptet, TesB, RBS, PhaA, RBS, and PhaB, namely pEZ-PtT1. The construction processes of pEZ-PtF and pEZ-PtY refer to PtT1.

[0062] Among them, pEZ15A was obtained by referring to the method provided in "Yang S, Mohagheghi A, Franden MA, et al. Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars [J]. Biotechnol Biofuels, 2016, 9(1):189." To obtain pEZ15A with different coding genes (such as resistance genes), different marker genes can be inserted by referring to the method disclosed in "Construction and application of plasmid pUC19-CM-D [J]. Journal of Anhui Agricultural Sciences, 2010, issue 19".

[0063] Among them, the Gibson assembly reaction system contains 0.12 pM long fragment, 0.04 pM reverse amplification fragment of pEZ15A, 0.5 μL 10× Buffer4 (Thermo), 0.5 μL T5 exonuclease, and the balance of ddH2O in a volume of 5 μL.

[0064] Among them, the reaction system of colony PCR, calculated as 10 μL, contains 0.3 μL of pEZ15A-F (10 μM), 0.3 μL of pEZ15A-R (10 μM), 5 μL of 2×T5 Super PCR Mix (Tsingke), 1 μL of template, and the balance of ddH2O. The colony PCR amplification program is set as follows: pre-denaturation at 98 °C for 3 min; denaturation at 98 °C for 10 s, annealing at 55 °C for 10 s, extension at 72 °C for 80 s, for a total of 30 cycles.

[0065] 2. Preparation of competent cells of Zymomonas mobilis

[0066] Use an inoculation loop to pick an appropriate amount of glycerol stock of Zymomonas mobilis ZMNPΔ0038 and streak it on an RMG5 solid medium plate (RMG5: 50 g / L glucose, 10 g / L yeast extract, 2 g / L KH2PO4, 3 g / L agar), and incubate it inverted at 30 °C for 2 - 3 days for activation; pick an activated single colony and transfer it to a liquid medium containing about 10 mL of RMG5 (RMG5: 50 g / L glucose, 10 g / L yeast extract, 2 g / L KH2PO4), and incubate it statically at 30 °C until the mid-logarithmic phase to be used as a seed solution; transfer the seed solution to a 50 mL centrifuge tube containing 40 mL of RMG5 liquid medium, and control the initial OD to be between 0.025 and 0.03. Incubate it statically at 30 °C until the OD is between 0.4 and 0.6; centrifuge the centrifuge tube containing the bacterial solution at 4000 rpm / min for 10 min to collect the cells, and discard the supernatant; add 40 mL of pre-cooled sterile water to the centrifuge tube to resuspend and wash the cells, mix evenly, and then centrifuge at 4000 rpm / min for 10 min to discard the supernatant; add 40 mL of pre-cooled 10% glycerol to the centrifuge tube to resuspend and wash the cells, mix evenly, and then centrifuge at 4000 rpm / min for 10 min to discard the supernatant, and repeat this step once; add 1% (volume ratio) of 10% glycerol to resuspend the cells, slowly mix evenly, and then aliquot on ice, aliquot 50 μL into sterile 1.5 mL centrifuge tubes, quickly freeze in liquid nitrogen, and store at -80 °C.

[0067] 3. Electroporation of recombinant plasmid

[0068] Take the competent cells of Zymomonas mobilis ZMNPΔ0038 on ice. After the competent cells are melted, take 50 μL and add it to the electroporation cuvette, and add 1 ng of recombinant plasmid (pEZ-PtF, pEZ-PtY, or pEZ-PtT1) to the electroporation cuvette. The electroporation conditions are 1600 V, 25 μF, 200 Ω. After electroporation, recover it in an RMG5 liquid medium in an incubator at 30 °C. Take 100 μL of the culture recovered for 4 - 6 hours and spread it on a 100 μg / mL spectinomycin-resistant plate, and incubate it at 30 °C for 2 days.

[0069] 4. Screening of engineered strains (NP-PtF, NP-PtY, and NP-PtT1)

[0070] After colonies grew out, colony PCR was performed on the engineered strains. Strains with band sizes consistent with the expected values were verified by sequencing. After the obtained correct positive clones were activated in RMG5 medium (containing 100 μg / mL spectinomycin), they were preserved with 60% glycerol.

[0071] 5. Fermentation tests of engineered strains (NP-PtF, NP-PtY, and NP-PtT1)

[0072] (1) Growth and fermentation performance tests

[0073] The above-obtained engineered strains (NP-PtF, NP-PtY, and NP-PtT1) were subjected to fermentation tests in RMG5. First, a certain amount of glycerol bacteria was inoculated into a cryotube containing 1 mL of RMG5 medium (containing 100 μg / mL spectinomycin) and allowed to stand and activate in a 30°C incubator until turbid. Then, it was poured into a 50 mL centrifuge tube containing an appropriate amount of RMG5 medium (containing 100 μg / mL spectinomycin) and used as the fermentation seed liquid. It was statically cultured in a 30°C incubator until the mid-late logarithmic phase and then inoculated into RMG5 medium (containing 100 μg / mL spectinomycin) and fermented in a 50 mL Erlenmeyer flask with an 80% filling volume. The initial OD was controlled at 0.1 at OD 600nm . Tests were carried out at tetracycline concentrations of 0, 0.4, 0.8, and 1.2 μg / mL. Every 3 hours, 1 mL of the sample was taken out in a laminar flow hood and collected, and the optical density at 600 nm was measured with a UV spectrophotometer. The fermentation broth obtained at different time points was collected and used to detect the contents of glucose, ethanol, and 3HB in HPLC (high performance liquid chromatograph).

[0074] (2) Treatment of fermentation samples and determination of products

[0075] After collecting the fermentation broth obtained at different time points, centrifuge at 12,000 rpm / min for 1 min to collect the bacterial cells, collect the supernatant, filter it through a 0.22 μm filter (Millipore, MA, USA), take 400 μL and transfer it into an HPLC injection vial for detecting the contents of glucose, ethanol, and 3HB in HPLC (high-performance liquid chromatography). Use the Agilent 1100 series high-performance liquid chromatograph (LC-20AD) of Shimadzu Corporation; the detector is a refractive index detector (RID-10A); the chromatographic column is an organic acid chromatographic column (Bio-Rad Aminex HPX-87H, 300 mm × 7.8 mm); the cell temperature is 40 °C, and the column oven temperature is 35 °C; the mobile phase is 5 mM sulfuric acid (preparation of the mobile phase: take 1.41 mL of chromatographic grade concentrated sulfuric acid into a 5 L blue-capped bottle, make up the volume to 5 L with ultrapure water and mix evenly, filter it using a water-phase filter membrane with a pore size of 0.45 μm. Dispense the filtered mobile phase into 1 L blue-capped bottles for mobile phase and perform ultrasonic degassing for 15 - 20 min. After returning to room temperature, it can be used), the flow rate is 0.5 mL / min, the initial flow rate is set to 0.2 mL / min during instrument operation, and gradually increase to 0.5 mL / min at a flow rate of 0.1 mL / min after the column pressure is stable; the injection volume is 20 μL. Each sample was analyzed in triplicate.

[0076] (3) Results

[0077] The 3HB production of the engineered strains NP-PtF, NP-PtY, and NP-PtT1 was detected as Figure 6 shown. The 3HB production of the strains NP-PtF, NP-PtY, and NP-PtT1 under the induction condition of 1.2 μg / mL tetracycline was 175.33 ± 3.06 mg / L, 187.00.67 ± 2.00 mg / L, and 425.67 ± 2.89 mg / L respectively. The 3HB production of NP-PtT1 was the highest, so the highly efficient thioesterase TesB was selected to participate in the subsequent strain modification.

[0078] Engineered strain with increased copy number of genes related to the 3-hydroxybutyric acid synthesis pathway

[0079] In some embodiments, the engineered strain contains at least one copy of PhaA located at the ZMO1650 locus of its genome and / or at least one copy of PhaA located outside its cell nucleus.

[0080] In some embodiments, the engineered strain contains at least one copy of PhaB located at the ZMO1650 locus of its genome and / or at least one copy of PhaB located outside its cell nucleus.

[0081] In some embodiments, the engineered strain contains at least one copy of the thioesterase gene TesB located at the ZMO1650 locus of its genome and / or at least one copy of FadM located outside its cell nucleus.

[0082] In some embodiments, the engineered strain contains at least one copy of the thioesterase gene TesB located at the ZMO1650 locus of its genome and / or at least one copy of YciA located outside its cell nucleus.

[0083] In some embodiments, the engineered strain contains at least one copy of the thioesterase gene TesB located at the ZMO1650 locus of its genome and / or at least one copy of TesB located outside its cell nucleus.

[0084] In some embodiments, the Pgap-TAB operon fragment is integrated into the position of the ZMO1650 gene on the genome of Zymomonas mobilis ZMNPΔ0038 using the endogenous Crispr-Cas technology of Zymomonas mobilis to obtain the engineered strain NPTΔ1.

[0085] Some embodiments disclose the engineered strain NPTΔ1. The engineered strain is ZMNPΔ0038 containing at least one copy of PhaA located at the ZMO1650 locus of its genome; at least one copy of PhaB located at the ZMO1650 locus of its genome; and at least one copy of the thioesterase gene TesB located at the ZMO1650 locus of its genome.

[0086] In some embodiments, the Pgap-TAB operon fragment is integrated into the position of the ZMO1650 gene on the genome of Zymomonas mobilis ZMNPΔ0038 using the endogenous Crispr-Cas technology of Zymomonas mobilis, and the recombinant plasmid pEZ-PtT1 is transferred into NPTΔ1, thus obtaining the engineered strain NPTΔ1-PtT1.

[0087] Some embodiments disclose the engineered strain NPTΔ1-PtT1. The engineered strain is ZMNPΔ0038 containing at least one copy of PhaA located at the ZMO1650 locus of its genome and at least one copy of PhaA located outside its cell nucleus; at least one copy of PhaB located at the ZMO1650 locus of its genome and at least one copy of PhaB located outside its cell nucleus; at least one copy of the thioesterase gene TesB located at the ZMO1650 locus of its genome and at least one copy of TesB located outside its cell nucleus. After fermentation tests, such as Figure 7As shown, under the induction condition of 1.2 μg / mL tetracycline, the yield of 3HB by the engineered strain NPTΔ1-PtT1 can reach 533.00 ± 4.36 mg / L.

[0088] The example also discloses a construction method of the engineered strain NPTΔ1-PtT1. The construction method includes: constructing a first editing plasmid (pL2R-ZMO1650), the first editing plasmid carrying a first donor fragment (SEQ ID NO.23) for replacing the ZMO1650 gene on the ZMNPΔ0038 genome and at least one CRISPR cluster, the CRISPR cluster being composed of at least one first guide sequence targeting the ZMO1650 gene and two repeat regions (SEQ ID NO.25) located upstream and downstream of the first guide sequence (SEQ ID NO.24) respectively, the first donor fragment being the Pgap-TAB operon; transferring the first editing plasmid into the Zymomonas mobilis ZMNPΔ0038 to obtain an engineered strain (NPTΔ1) in which the ZMO1650 gene of ZMNPΔ0038 is replaced with the Pgap-TAB operon fragment; and then transferring the recombinant plasmid pEZ-PtT1 into the engineered strain (NPTΔ1) to obtain the engineered strain NPTΔ1-PtT1. Among them, the first donor fragment contains the upstream and downstream homologous sequences of ZMO1650 and the Pgap-TAB operon fragment located therein.

[0089] In some embodiments, the construction methods of the engineered strain NPTΔ1 and the engineered strain NPTΔ1-PtT1 include:

[0090] 1. Preparation of the first editing plasmid (pL2R-ZMO1650)

[0091] 1) Synthesis of the first guide sequence

[0092] Select the sequence 32 bp downstream of the PAM site CCC in the ZMO1650 gene from the ZM4 genome as the first guide sequence.

[0093] 2) Construction of the first targeting plasmid

[0094] In some embodiments, insert the first CRISPR cluster containing the first guide sequence into the basic plasmid to obtain the first targeting plasmid, which targets the ZMO1650 gene.

[0095] In some embodiments, targeting primers (1650-gr1-F, shown as SEQ ID NO.26; 1650-gr1-R: shown as SEQ ID NO.27) are designed according to the first guide sequence to direct the cleavage of the nuclease at the target site; after annealing, the target is ligated to the basic plasmid (pEZ15Asp), and the first targeting plasmid is obtained by screening.

[0096] Specific methods for constructing some first targeting plasmids include:

[0097] The vector pEZ15Asp is digested with the restriction endonuclease BsaⅠ to obtain linearized pEZ15Asp; then the primers (gr-F, gr-R) of the first guide sequence are annealed according to the system shown in Table 1 (the annealing system contains, in a volume of 10 μL: 1 μL gr-F (10 μM), 1 μL gr-R (10 μM), and 8 μL ddH2O), denatured at 95 °C for 5 min, and cooled to room temperature for standby; the annealed product (i.e., the first guide sequence) and linearized pEZ15Asp are ligated using T4 ligase at 22 °C for 3 - 6 h; the ligation product is transformed into the Escherichia coli cloning strain DH5α by the general chemical transformation method in the art for plasmid construction; screening is carried out using a spectinomycin plate, single colonies are picked, and verified by colony PCR using the primers pEZ15A-F and pEZ15A-R. Those with a band size consistent with the expectation are verified by sequencing. Among them, the T4 reaction system contains, in a volume of 10 μL, 20 - 40 ng of linearized pEZ15Asp, 2 μL of the first guide sequence, 0.5 μL of T4 ligase, 1 μL of Buffer, and the balance of ddH2O. The reaction program for colony PCR is: pre-denaturation at 98 °C for 3 min, 1 cycle; denaturation at 98 °C for 10 s, annealing at 55 °C for 10 s, extension at 72 °C, set at 10 s / kb according to the fragment length, for a total of 30 cycles; extension at 72 °C for 2 min, 1 cycle; storage at 12 °C for 2 min, 1 cycle.

[0098] 3) Construct the first editing plasmid (pL2R-ZMO1650)

[0099] In some embodiments, the preparation steps of the first editing plasmid include:

[0100] 1) The upstream sequence of the ZMO1650 gene is amplified using the primers 1650-up-F (shown as SEQ ID NO.28) and 1650-up-R (shown as SEQ ID NO.29). The downstream sequence of the ZMO1650 gene is amplified using the primers 1650-down-F (shown as SEQ ID NO.30) and 1650-down-R (shown as SEQ ID NO.31).

[0101] 2) As Figure 3As shown in the figure, using the RBS sequence, the promoter Pgap, TesB, PhaA, and PhaB DNA fragments were successively amplified by overlap PCR to obtain at least one operon Pgap-TAB (shown in SEQ ID NO. 32), and this Pgap-TAB operon is a sequence composed of Pgap, TesB, RBS-10, PhaA, RBS-10, and PhaB.

[0102] 3) The upstream sequence, the operon Pgap-TAB, and the downstream sequence were successively ligated by Overlap PCR to serve as the first donor fragment.

[0103] 3) The first targeted plasmid constructed in the previous step was amplified by inverse PCR using primers 15Afk-F and 15Afk-R to obtain the inversely amplified first targeted plasmid.

[0104] 4) The inversely amplified first targeted plasmid and the first donor fragment were subjected to Gibson assembly and ligation at a ratio of 1:3, and the ligation product was transferred into Escherichia coli competent cells. Screening was carried out using a spectinomycin plate, single colonies were picked, and verification was performed by colony PCR using primers pEZ15A-F and pEZ15A-R. Those with a band size consistent with the expected value were verified by sequencing. The first editing plasmid (pL2R-ZMO1650) was extracted and isolated from the verified positive clones.

[0105] 2. Electroporation of the first editing plasmid

[0106] 1 ng of the first editing plasmid was added to 50 μL of competent ZMNPΔ0038, mixed well and then added to a 0.1 cm electroporation cuvette, and electroporation was carried out according to the program of 1600 V, 25 μF, and 200 Ω. After electroporation, it was transferred into 1 mL of RM medium and statically cultured in a 30 °C incubator for 4 - 6 h, and then 200 μL was taken and evenly spread on a 100 μg / ml spectinomycin-resistant plate, and it was inverted and cultured in a 30 °C incubator for 2 - 3 days.

[0107] 3. Preparation of engineering strain NPTΔ1

[0108] The cultured strain was passaged in RMG5 medium until the strain could grow in RMG5 but could not grow in RMG5 containing spectinomycin to discard the first editing plasmid. After subculture, the engineering strain NPTΔ1 could be obtained. After colonies grew out, verification was performed by colony PCR using primers pEZ15A-F and pEZ15A-R. Those with a band size consistent with the expected value were verified by sequencing.

[0109] 4. Preparation of engineering strain NPTΔ1-PtT1

[0110] The above recombinant plasmid pEZ-PtT1 was electrotransformed into the competent engineering strain NPTΔ1, and the electrotransformation method was referred to the above-mentioned examples. The engineering strain NPTΔ1-PtT1 was obtained through screening and verification, and the screening and verification methods were the same as those in the above-mentioned examples.

[0111] 5. Fermentation test of the engineering strain NPTΔ1-PtT1

[0112] Refer to the fermentation test methods of the above-mentioned engineering strains (NP-PtF, NP-PtY, and NP-PtT1).

[0113] Engineered strain overexpressing genes related to cofactor supply

[0114] Since the acetoacetyl-CoA reductase in the 3HB production process depends on the consumption of the cofactor NADPH, enhancing the supply of the cofactor NADPH by overexpressing the gene of the endogenous phosphodehydrogenase (Zwf) of Zymomonas mobilis can increase the 3HB yield.

[0115] Based on this, some embodiments disclose engineering strains of Zymomonas mobilis. The engineering strain contains at least one copy of PhaA located at the ZMO1650 locus of its genome and at least one copy of PhaA located outside its nucleus; at least one copy of PhaB located at the ZMO1650 locus of its genome and at least one copy of PhaB located outside its nucleus; at least one copy of the thioesterase gene TesB located at the ZMO1650 locus of its genome and at least one copy of TesB located outside its nucleus; and Zymomonas mobilis ZMNPΔ0038 containing at least one copy of Zwf located outside its nucleus.

[0116] In some embodiments, the construction method of the engineering strain (named NPTΔ1-PtZT1) containing genes related to overexpressing cofactor supply includes: constructing the recombinant plasmid pEZ-PtZT1 containing Zwf and the Ptet-TAB operon; transferring the recombinant plasmid pEZ-PtZT1 into the engineering strain NPTΔ1, and the engineering strain NPTΔ1-PtZT1 can be obtained. As Figure 8 shown, under the induction condition of 1.2 μg / mL tetracycline, the yield of 3HB of the engineering strain NPTΔ1-PtZT1 can reach 685.67 ± 10.69 mg / L.

[0117] In some embodiments, as Figure 3As shown, using zwf-F (shown in SEQ ID NO.33) and zwf-R (shown in SEQ ID NO.34) as primer pairs, with ZM4 as the template, the zwf gene fragment (shown in SEQ ID NO.35) was amplified, and then DNA recovery was performed (according to the method of the kit). Then, the TAB fragment on the pEZ-PtT1 plasmid was amplified using zwf-tesB-F (shown in SEQ ID NO.36) and phaB-R (shown in SEQ ID NO.37), and DNA recovery was carried out. The obtained zwf fragment and the TAB fragment were ligated by overlap PCR and then DNA gel recovery was performed to obtain zwf-TAB (shown in SEQ ID NO.38). The zwf-TAB was ligated with the reversely amplified pEZ-15A vector to construct the recombinant plasmid pEZ-PtZT1.

[0118] For the specific construction method of the recombinant plasmid pEZ-PtZT1, the construction method of the engineering strain NPTΔ1-PtZT1, and the fermentation test method of the engineering strain NPTΔ1-PtZT1, refer to the above-mentioned examples.

[0119] Engineered strain introducing an exogenous ethanol utilization pathway

[0120] The exogenous ethanol utilization pathway (EUP) is a pathway encoded by the adh2 and ada genes from Saccharomyces cerevisiae. It was found in the examples of this application that introducing the EUP pathway into Zymomonas mobilis ZMNPΔ0038 can further increase its 3HB synthesis yield.

[0121] Some examples disclose engineering strains of Zymomonas mobilis. The engineering strain is Zymomonas mobilis ZMNPΔ0038 containing at least one copy number of PhaA located at the ZMO1650 locus of its genome and at least one copy number of PhaA located outside its nucleus; containing at least one copy number of PhaB located at the ZMO1650 locus of its genome and at least one copy number of PhaB located outside its nucleus; containing at least one copy number of the thioesterase gene TesB located at the ZMO1650 locus of its genome and at least one copy number of TesB located outside its nucleus; containing at least one copy number of Zwf located outside its nucleus; containing at least one copy number of the ada gene located outside its nucleus; and containing at least one copy number of the adh2 gene located outside its nucleus.

[0122] Some examples disclose a construction method of an engineering strain (NPTΔ1-PtZT1 EUP ) introducing an exogenous ethanol utilization pathway. The construction method includes: constructing the recombinant plasmid pE39p-Pe containing the ada and adh2 genes EUP ; then the recombinant plasmid pE39p-PeEUP Transfer into the engineered strain NPTΔ1-PtZT1 to obtain the engineered strain NPTΔ1-PtZT1 EUP As Figure 9 shown, after testing, at a tetracycline concentration of 1.2 μg / mL, the 3HB production of the engineered strain NPTΔ1-PtZT1 EUP can reach 1114.33 ± 26.50 mg / L. After adjusting the carbon source-nitrogen source ratio of the medium, after testing, under the medium conditions of 50 g / L glucose and 5 g / L yeast extract, the 3HB production of the engineered strain NPTΔ1-PtZT1 EUP at a tetracycline concentration of 1.2 μg / mL can reach 1323 ± 22.61 mg / L.

[0123] Refer to "Li, Y., Wang, Y., Wang, R., Yan, X., Wang, J., Wang, X., Chen, S., Bai, F., He, Q., & Yang, S. Metabolic engineering of Zymomonas mobilis for continuous co-production of bioethanol and poly-3-hydroxybutyrate (PHB). Green Chemistry, 2022, 24." After connecting the ada and adh2 genes with the RBS-10K (ATCACAGGGTCTAGAAGGAGGTCGAA) sequence and constructing the EUP operon (shown in SEQ ID NO. 39) with Peno as the promoter, and constructing it into the shuttle vector pEZ39p, the recombinant plasmid pE39p-Pe can be obtained EUP .

[0124] Specifically, the construction process of the engineered strain NPTΔ1-PtZT1 EUP and the fermentation test process refer to the above-mentioned examples.

[0125] Engineered strain with defects in penicillin-binding proteins (PBPs) constructed

[0126] The deletion of penicillin-binding proteins (PBPs) expressed by Zymomonas mobilis will interfere with the normal synthesis of peptidoglycan, thereby interfering with the membrane structure, resulting in an increase in the concentration of glucosamine in Z. mobilis mutants, making the outer membrane permeability increase, which is beneficial to the better secretion of intracellular substances to the extracellular. In the example, the PBPs-deficient strain was constructed by knocking out the ZMO0959 and ZMO1089 genes in the strain ZMNPΔ0038 respectively.

[0127] Based on this, some embodiments disclose an engineered strain of Zymomonas mobilis (named NPΔ0959-PtZT1). This engineered strain contains the acetyl-CoA transferase gene, acetoacetyl-CoA reductase gene, and thioesterase gene in the 3-hydroxybutyric acid synthesis pathway; and Zymomonas mobilis ZMNPΔ0038 with the ZMO0959 gene knocked out.

[0128] Based on this, some embodiments disclose an engineered strain of Zymomonas mobilis (named NPΔ1089-PtZT1). This engineered strain contains the acetyl-CoA transferase gene, acetoacetyl-CoA reductase gene, and thioesterase gene in the 3-hydroxybutyric acid synthesis pathway; and Zymomonas mobilis ZMNPΔ0038 with the ZMO1089 gene knocked out.

[0129] Embodiments disclose a method for constructing the engineered strain NPΔ0959-PtZT1. The construction method includes: constructing a second editing plasmid (pL2R-ZMO0959), the second editing plasmid carrying a second donor fragment (SEQ ID NO.40) for replacing the ZMO0959 gene on the genome of ZMNPΔ0038 and at least one CRISPR cluster, the CRISPR cluster being composed of at least one second guide sequence (SEQ ID NO.41) targeting the ZMO0959 gene and two repeat regions (SEQ ID NO.25) located upstream and downstream of the second guide sequence respectively, the second donor fragment being a sequence composed of the upstream and downstream regions of the ZMO0959 gene; transferring the second editing plasmid into Zymomonas mobilis NP-PtT1 to obtain an engineered strain (NPΔ0959-PtZT1) with the ZMO0959 gene knocked out in NPTΔ1-PtT1. For the specific construction method, refer to the above embodiments. Among them, the second donor fragment is composed of the upstream and downstream homologous sequences of ZMO0959.

[0130] The embodiment discloses a construction method of the engineered strain NPΔ1089-PtZT1. The construction method includes: constructing a third editing plasmid (pL2R-ZMO1089), the third editing plasmid carrying a third donor fragment (SEQ ID NO.42) for replacing the ZMO1089 gene on the ZMNPΔ0038 genome and at least one CRISPR cluster, the CRISPR cluster being composed of at least one third guide sequence (SEQ ID NO.43) targeting the ZMO1089 gene and two repeat regions (SEQ ID NO.25) located upstream and downstream of the third guide sequence respectively, the third donor fragment being a sequence composed of the upstream and downstream regions of the ZMO1089 gene; transferring the third editing plasmid into the Zymomonas mobilis NP-PtT1 to obtain an engineered strain (NPΔ1089-PtZT1) with the ZMO01089 gene knocked out in NPTΔ1-PtT1. For the specific construction method, refer to the above embodiment. Among them, the third donor fragment is composed of upstream and downstream homologous sequences of ZMO1089.

[0131] For the specific construction process and fermentation test process of the engineered strains NPΔ0959-PtZT1 and NPΔ1089-PtZT1, refer to the above embodiment. Using a tetracycline concentration of 1.2 μg / mL for the control test with NP-PtZT1, the contents of 3HB, glucose, and ethanol were fermentatively tested. As Figure 10 shown, the 3HB yields of the NPΔ0959-PtZT1 and NPΔ1089-PtZT1 strains obtained by shake flask fermentation in the RMG5 medium were 600 ± 11.53 mg / L and 723.33 ± 9.71 mg / L respectively.

[0132] Combining different strategies to improve the 3HB production of engineered strains

[0133] Based on the above embodiment, some embodiments disclose the engineered strain NPTΔ3-PtZT1 EUP . The engineered strain NPTΔ3-PtZT1 EUP is a strain obtained by knocking out ZMO1089 of the engineered strain NPTΔ1 and integrating the EUP operon of the exogenous ethanol utilization pathway into the ZMO1094 locus.

[0134] Based on this, the embodiment discloses the engineered strain NPTΔ3-PtZT1 EUP。The engineered strain contains at least one copy of PhaA located at the ZMO1650 locus of its genome and at least one copy of PhaA outside its nucleus; at least one copy of PhaB located at the ZMO1650 locus of its genome and at least one copy of PhaB outside its nucleus; at least one copy of the thioesterase gene TesB located at the ZMO1650 locus of its genome and at least one copy of TesB outside its nucleus; ZMO1089 is knocked out; at least one copy of the EUP operon located at the ZMO1094 locus of its genome and at least one copy of the EUP operon outside its nucleus; and Zymomonas mobilis ZMNPΔ0038 containing at least one copy of Zwf outside its nucleus. After fermentation tests, as Figure 11 shown, in RMG5 medium, the engineered strain NPTΔ3-PtZT1 EUP had a 3HB production of 1074 ± 61.56 mg / L under the induction condition of 1.2 μg / mL tetracycline in shake flask fermentation. After adjusting the carbon source-nitrogen source ratio of the medium, it was tested that under the medium conditions of 50 g / L glucose and 5 g / L yeast extract, the engineered strain NPTΔ3-PtZT1 EUP had a 3HB production of up to 1525 ± 72.16 mg / L under the induction condition of 1.2 μg / mL tetracycline.

[0135] The example also discloses the construction method of the engineered strain NPTΔ3-PtZT1 EUP . The construction method includes: constructing a third gene editing plasmid (the construction method is the same as the above example); transferring the third editing plasmid into NPTΔ1 to knock out ZMO1089 to obtain the engineered strain NPTΔ2; constructing a fourth editing plasmid (pL2R-ZMO1094), the fourth editing plasmid carrying an EUP operon as the fourth donor fragment (SEQ ID NO.44) and at least one CRISPR cluster, the CRISPR cluster consisting of at least one fourth guide sequence (SEQ ID NO.45) targeting the ZMO1094 gene and two repeat regions (SEQ ID NO.25) located upstream and downstream of the fourth guide sequence respectively, the fourth donor fragment being a sequence composed of the upstream sequence of the ZMO1094 gene, the EUP operon and the downstream region; transferring the fourth editing plasmid into Zymomonas mobilis NPTΔ2 to obtain an engineered strain (NPTΔ3) with the EUP operon integrated into the ZMO1094 locus; transferring the recombinant plasmid pEZ-PtZT1 into the engineered strain NPTΔ3 to obtain the engineered strain NPTΔ3-PtZT1; transferring the recombinant plasmid pE39p-Pe EUPIt was transferred into the engineered strain NPTΔ3-PtZT1 to obtain NPTΔ3-PtZT1 EUP strain.

[0136] For the specific construction method and fermentation test method, refer to the above-mentioned examples.

[0137] Construction of the starting strain ZMNPΔ0038

[0138] The examples also disclose the construction method of the starting strain ZMNPΔ0038 involved in the above-mentioned examples. As Figure 3 shown, the construction method includes: constructing a fifth editing plasmid (pL2R-Cas12a), the fifth editing plasmid carrying a fifth donor fragment (SEQ ID NO.46) for the Cas12a gene and at least one CRISPR cluster, the CRISPR cluster being composed of at least one fifth guide sequence (SEQ ID NO.47) targeting the ZMO0038 gene and two repeat regions (SEQ ID NO.25) located upstream and downstream of the fifth guide sequence respectively, the fifth donor fragment being a sequence composed of the upstream and downstream regions of the ZMO0038 gene; transferring the fifth editing plasmid into the Zymomonas mobilis ZMNP-Cas12a to obtain the starting strain ZMNPΔ0038. For the specific construction method, refer to the above-mentioned examples.

[0139] Optimizing the culture medium conditions

[0140] Some examples use glucose as the carbon source and yeast extract as the nitrogen source, controlling the ratio of the carbon source to the nitrogen source to optimize the optimal carbon-nitrogen source ratio to increase the 3HB yield under nitrogen-limited or high carbon-nitrogen ratio conditions.

[0141] In some examples, the engineered strain NPTΔ1-PtZT1 EUP and the control strain NP-pEZ15Asp were respectively inoculated into 80% of the bottle volume in 50 mL Erlenmeyer flasks, each containing a medium with a carbon-nitrogen ratio of 10:1 (50 / 5, 20 / 2), 10:2 (50 / 10, 20 / 4) or 10:3 (50 / 15, 20 / 6). Three parallel tests were set for each condition for fermentation testing. The initial OD600nm was controlled to be 0.1. During the fermentation process, 1 mL of the sample was taken at regular intervals and temporarily stored at -80 °C. After the glucose in the fermentation broth was consumed, the 3HB yield and the changes of glucose and ethanol during the fermentation process were detected. Among them, the control strain NP-pEZ15Asp was a strain obtained by electrotransforming the plasmid pEZ15Asp (empty plasmid) into the competent engineered strain ZMNPΔ0038. The results are as Figure 12, at a concentration of 1.2 μg / mL of tetracycline, the NPTΔ1-PtZT1EUP strain was able to produce 1323 ± 22.61 mg / L of 3HB under the condition of a C / N ratio of 50 / 5.

[0142] As described above, it is only a preferred specific embodiment of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed by the present application should be covered within the protection scope of the present application.

Claims

1. An engineered strain of Zymomonas mobilis, wherein the engineered strain is: a Zymomonas mobilis ZMNPΔ0038 in which the ZMO0959 gene is knocked out, and which contains the acetyl-CoA transferase gene, acetoacetyl-CoA reductase gene, and thioesterase gene in the 3-hydroxybutyric acid synthesis pathway; Among them, the Zymomonas mobilis ZMNPΔ0038 is Zymomonas mobilis ZMNP-Cas12a in which Cas12a is knocked out, the acetyl-CoA transferase gene and the acetoacetyl-CoA reductase gene are both derived from Ralstonia eutropha H16, and the thioesterase gene is derived from TesB of Escherichia coli K-12.

2. The engineered strain according to claim 1, wherein the engineered strain: contains at least one copy of the acetyl-CoA transferase gene located on its genome and / or at least one copy of the acetyl-CoA transferase gene located outside its nucleus; contains at least one copy of the acetoacetyl-CoA reductase gene located on its genome and / or at least one copy of the acetoacetyl-CoA reductase gene located outside its nucleus; and contains at least one copy of the thioesterase gene located on its genome and / or at least one copy of the thioesterase gene located outside its nucleus.

3. A method for preparing 3HB, which comprises: obtaining an engineered strain; inoculating the engineered strain into a medium containing glucose for fermentation; and harvesting the 3HB from the fermentation product; wherein the engineered strain is a Zymomonas mobilis ZMNPΔ0038 in which the ZMO0959 gene is knocked out, and which contains the acetyl-CoA transferase gene, acetoacetyl-CoA reductase gene, and thioesterase gene in the 3-hydroxybutyric acid synthesis pathway; wherein the Zymomonas mobilis ZMNPΔ0038 is Zymomonas mobilis ZMNP-Cas12a in which Cas12a is knocked out, the acetyl-CoA transferase gene and the acetoacetyl-CoA reductase gene are both derived from Ralstonia eutropha H16, and the thioesterase gene is derived from TesB of Escherichia coli K-12.

4. The method according to claim 3, wherein the engineered strain: contains at least one copy of the acetyl-CoA transferase gene located on its genome and / or at least one copy of the acetyl-CoA transferase gene located outside its nucleus; contains at least one copy of the acetoacetyl-CoA reductase gene located on its genome and / or at least one copy of the acetoacetyl-CoA reductase gene located outside its nucleus; and contains at least one copy of the thioesterase gene located on its genome and / or at least one copy of the thioesterase gene located outside its nucleus.

5. Use of the engineered strain according to claim 1 or 2 for synthesizing 3HB.

Images