Nucleic acid aptamers targeting Epstein-Barr virus and their applications

Abstract

The present invention relates to a nucleic acid aptamer targeting Epstein-Barr virus and its application, and relates to the field of bioengineering technology. The nucleic acid aptamer comprises a targeting sequence, and the nucleic acid aptamer specifically binds to the gHgL protein of the Epstein-Barr virus. The aptamer can target the Epstein-Barr virus by specifically binding to the gHgL protein, and has a strong binding force and affinity with the gHgL protein, and can be used for the diagnosis and treatment of the Epstein-Barr virus, molecular imaging, drug delivery, etc.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a nucleic acid aptamer targeting Epstein-Barr virus and an application thereof. Background Art

[0002] Epstein-Barr (EB) virus, also known as human herpesvirus type 4, is an enveloped double-stranded DNA virus belonging to the human gamma herpesvirus family. Its particles are composed of four structural components, including core protein, capsid, shell, and envelope, among which the core protein tightly wraps around the viral DNA. EB virus is the earliest human tumor virus discovered. It was first successfully isolated from burkitt lymphoma cells by Epstein and Barr in 1964. EB virus infection is very common in the population. More than 95% of people in the world have been infected with EB virus. Once infected, it can remain latent for life. EB virus is the main cause of infectious mononucleosis and is the earliest discovered human tumor virus. It is associated with a variety of malignant tumors such as nasopharyngeal carcinoma and gastric cancer, posing a serious threat to human health. EB virus infection has obvious host selectivity. It mainly infects B lymphocytes and epithelial cells in the body. EB virus mainly infects human epithelial cells or lymphatic B cells through different combinations of multiple envelope glycoproteins on its surface. Although researchers have a certain understanding of EB virus, there is still no effective vaccine or specific antiviral drug for EB virus on the market, and there is also a lack of specific targeted treatments to treat diseases related to EB virus infection. Summary of the invention

[0003] In view of the above problems, the present invention provides a nucleic acid aptamer targeting Epstein-Barr virus. The aptamer can target Epstein-Barr virus by specifically binding to gHgL protein, and has strong binding force and affinity to gHgL protein, and can be used in the diagnosis and treatment of Epstein-Barr virus, molecular imaging, drug delivery and other aspects.

[0004] In order to achieve the above object, the present invention provides a nucleic acid aptamer targeting Epstein-Barr virus, wherein the nucleic acid aptamer comprises a targeting sequence, and the nucleic acid aptamer specifically binds to the gHgL protein of the Epstein-Barr virus.

[0005] This aptamer can target the Epstein-Barr virus by specifically binding to the gHgL protein, and has strong binding force and affinity to the gHgL protein, and can be used in the diagnosis and treatment of the Epstein-Barr virus, molecular imaging, drug delivery, etc.

[0006] Previous studies have found that glycoprotein gHgL plays a key role in the process of EB virus infecting human epithelial cells and lymphocyte B cells. At the same time, nucleic acid aptamers are single-stranded nucleic acid molecules screened from random libraries by systematic evolution of ligands by exponential enrichment (SELEX). Nucleic acid aptamers have complex three-dimensional stem-loop, hairpin and pseudoknot structures, and can bind to targets through hydrogen bonds, van der Waals forces, base stacking forces and complementary molecular shape recognition. The unique secondary or tertiary structure binds specifically to the target. In theory, almost all substances in nature can be used as targets for nucleic acid aptamers, such as amino acids, nucleotides, antibiotics and other small molecules, as well as macromolecules such as proteins, tissue cells and pathogens such as viruses and bacteria. Because nucleic acid aptamers can recognize and bind to targets with high specificity and high affinity, they are called chemical antibodies or artificial antibodies. In addition, compared with antibodies, nucleic acid aptamers also have good chemical stability, convenient modification, and low cost, and are widely regarded as substitutes for antibodies. Therefore, the application of nucleic acid aptamers is becoming more and more extensive, and has good application prospects in various fields such as molecular imaging and targeted therapy. At the same time, considering that gHgL protein is a key protein molecule for EB virus to infect host cells, the inventors propose to screen nucleic acid aptamers targeting gHgL protein of EB virus, and apply them to virus detection, molecular imaging or drug delivery, etc., which is of great significance for in-depth understanding of the pathogenic mechanism of EB virus infection and prevention and control of EB virus infection, and provides valuable information and means for us to deeply understand the infection process of human herpes virus at the molecular level, prevent EB virus infection or target treatment of EB virus-related diseases.

[0007] In one embodiment, the targeting sequence comprises SEQ ID NO.7 or SEQ NO.9.

[0008] In one embodiment, the targeting sequence is selected from SEQ NO.6 or SEQ NO.8.

[0009] In one embodiment, when the targeting sequence is SEQ NO.6, the secondary structure of the targeting sequence is as follows:

[0010]

[0011] When the targeting sequence is SEQ NO.8, the secondary structure of the targeting sequence is as follows:

[0012]

[0013] In one embodiment, the nucleic acid aptamer further includes a marker, and the marker is selected from at least one of biotin, a luminescent group, and an enzyme.

[0014] The present invention also provides the use of the nucleic acid aptamer in preparing a product for detecting Epstein-Barr virus, and the use does not include the use in disease diagnosis.

[0015] The present invention also provides a kit for detecting EB virus, comprising the nucleic acid aptamer.

[0016] In one embodiment, the nucleic acid aptamer further includes a marker, and the marker is selected from at least one of biotin, a luminescent group, and an enzyme.

[0017] The present invention also provides a non-diagnostic EB virus detection method, comprising the following steps: incubating the sample to be tested with the nucleic acid aptamer in the kit, washing, and detecting the labeling signal of the label.

[0018] The present invention also provides the use of the nucleic acid aptamer in preparing anti-EB virus drugs.

[0019] The present invention also provides an anti-EB virus drug, comprising a drug active ingredient and a carrier, wherein the carrier is the nucleic acid aptamer.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The nucleic acid aptamer targeting Epstein-Barr virus and its application of the present invention can target Epstein-Barr virus by specifically binding to gHgL protein, and has strong binding force and affinity to gHgL protein, and can be used in diagnosis and treatment of Epstein-Barr virus, molecular imaging, drug delivery and other aspects. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The result diagram of the binding of gHgL protein to the candidate DNA sequence in the embodiment;

[0023] Figure 2 The secondary structure prediction diagram of the nucleic acid aptamer in the embodiment;

[0024] Figure 3 This is a graph showing the affinity of nucleic acid aptamers L14 and L28 for gHgL protein analyzed by SPR in the examples;

[0025] Figure 4 This is a graph showing the specificity of the binding of nucleic acid aptamers L14 and L28 to gHgL protein by ELASA in the example; wherein His protein and random starting library were used as controls, **, p<0.01. DETAILED DESCRIPTION

[0026] In order to facilitate the understanding of the present invention, the present invention will be described more fully below with reference to the relevant drawings. The preferred embodiments of the present invention are given in the drawings. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more related listed items.

[0028] source:

[0029] Unless otherwise specified, the reagents, materials, and equipment used in this example are all commercially available; the experimental methods are all conventional experimental methods in the art unless otherwise specified.

[0030] Example

[0031] 1. Design and construction of random starting nucleic acid library (ssDNA) and primers.

[0032] The random starting library used for aptamer screening and the primers for PCR amplification reactions were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The library consists of a 36-base random sequence in the middle (N36) and fixed sequences at both ends (20 bases each), where N represents any of the four nucleotide bases A, T, C or G.

[0033] Random single-stranded DNA library (5'-3'):

[0034] CTACGGTGCCTTGAAGTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATAGCAGGTCACTTCCAGG (SEQ NO. 1).

[0035] Table 1 Primer information (5'-3')

[0036]

[0037] The S in the primer name represents the forward primer, A represents the reverse primer, the 25 A's in the sequence represent a polyA tail composed of 19 adenylic acids (A), and "Spacer 18" represents an 18-atom hexaethylene glycol spacer; among them, Lib S1-FAM is a 5'-end modified FAM group of the sequence CTACGGTGCCTTGAAGTGAC (SEQ NO. 4), and Lib A2-ployA is a polyA tail of the sequence AAAAAAAAAAAAAAAAAAAAAAAAACCTGGAAGTGACCTGCTATG (SEQ NO. 5) modified with an 18-atom hexaethylene glycol spacer.

[0038] 2. Preparation of positive screening magnetic beads (gHgL protein).

[0039] Take 50 μL of carboxyl magnetic beads (Invitrogen, Dynabeads TM MyOne TM Carboxylic Acid, #65012), washed three times with 200μL H2O, and then aspirated the magnetic beads with a magnetic stand and removed the supernatant. Take the prepared 50μL NHS (N-hydroxysuccinimide; 0.1M aqueous solution) and 50μL EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution), slowly thaw at room temperature, mix them and add them to the washed magnetic beads, and incubate them on a shaker at room temperature for 25min to activate the carboxyl groups on the surface of the magnetic beads. After aspirating the magnetic beads with a magnetic stand, remove the supernatant and quickly wash them twice with 200μL H2O. Take 10μL GHGL protein (concentration of 1mg / ml, prepared and purified in this laboratory), add 190μL pH 4.0 10mM sodium acetate solution and mix well, add it to the activated magnetic beads, and incubate on a shaker at room temperature for 60min to couple gHgL protein. After the magnetic beads were absorbed by the magnetic stand, the supernatant was removed and the beads were quickly washed twice with 200μL H2O. 100μL 1M pH8.5 ethanolamine was added to the above magnetic beads and incubated on a shaker at room temperature for 20 min to block the unreacted activation sites on the surface of the beads. After the magnetic beads were absorbed by the magnetic stand, the supernatant was removed and the beads were washed 4 times with 200μL DPBS (137mM NaCl, 2.7mM KCl, 1.5mMKH2PO4, 8mM Na2HPO4, 1mM CaCl2, 0.5mM MgCl2). 50μL DPBS was added to store the beads and recorded as MB-gHgL for later use.

[0040] 3. Preparation of counter-screening magnetic beads.

[0041] Since the gHgL protein prepared and purified in this laboratory is His-tagged, blank magnetic beads (marked as MB-blank) and magnetic beads with His protein (marked as MB-His) were used for counter-screening. 50μL of carboxyl magnetic beads were washed 4 times with 200μL H2O, and then the magnetic beads were aspirated on the magnetic rack and the supernatant was removed. After washing 200μL H2O twice, 100μL 1M pH8.5 ethanolamine was added and incubated on a shaker at room temperature for 25min. The magnetic beads were aspirated on the magnetic rack and the supernatant was removed. After washing 4 times with 200μL DPBS, 50μL DPBS was added to preserve the magnetic beads and they were marked as MB-blank for later use. The method of coupling His protein is the same as that of coupling gHgL protein. In each round of magnetic bead screening, blank magnetic beads or His protein magnetic beads were used for counter-screening before the positive screening targeting gHgL protein.

[0042] 4. Magnetic bead screening process.

[0043] Take 1OD random nucleotide library and centrifuge at 12000rpm for 5min. Add DPBS to dissolve, dilute the library to a final concentration of 5μM, divide into PCR tubes and put into PCR instrument for denaturation treatment. The program is: 95℃10min, 4℃5min, 25℃10min. Add the above denatured library to 50μL MB-blank, mix it slowly with a pipette, and incubate it on a shaker at room temperature for 60min. Absorb the magnetic beads with a magnetic stand, aspirate the supernatant with a pipette and mark it as pool-, and then incubate it with 50μL MB-gHgL magnetic beads on a shaker at room temperature for 60min for positive screening as a single-stranded nucleotide library. Absorb the magnetic beads with a magnetic stand and discard the supernatant, and wash the magnetic beads 4 times with 400μl DPBS. Add 200μl DPBS boiling water bath to the washed magnetic beads for 10min, aspirate the magnetic beads with a magnetic stand, collect the supernatant and mark it as elution by MB-gHgL.

[0044] 5. Prepare single strands.

[0045] The nucleic acid in the above elution by MB-gHgL was used as a molecular template and added to 2 ml of emulsion PCR (ePCR) mix (ePCRmix formula: ddH2O 1732μl, 200U Pfu enzyme 8μl, 10*pfu enzyme buffer 200μl, 10mM dNTPmix 40μl, forward primer 100μM LibS1 FAM 10μl, reverse primer 100μM LibA2 ployA 10μl; total volume 2ml), and then 4 times the volume of ePCR microdroplet generation oil (purchased from Anpu Tuoma Biotechnology Co., Ltd., EPO100) was added. The prepared emulsion was divided into PCR tubes, and 100μL per tube was used for ePCR amplification reaction. The program was: 95℃2min; 95℃30s, 60℃30s, 72℃30s, 25Cycles. After amplification, the ePCR product was recovered, 2 volumes of n-butanol were added to mix thoroughly, centrifuged at 10000rpm for 10min, and the upper phase was discarded to obtain concentrated PCR products. An equal volume of the product was added to urea denaturation buffer and boiled for 15min. After an ice bath for 1min, the sample was subjected to urea denaturation PAGE electrophoresis to separate the FAM-labeled positive chain and the PolyA-labeled reverse chain. The FAM-labeled positive chain was recovered by gel cutting, and the gel strip was transferred to a 1.5ml EP tube and 1ml ddH2O was added. The ssDNA in the gel was transferred to the solution in a boiling water bath for 10 minutes. 2 volumes of n-butanol were added to mix thoroughly, centrifuged at 10000rpm for 10min, and the upper phase was discarded to obtain ssDNA. The ssDNA was dialyzed overnight with a micro-nucleic acid dialysis membrane 3.5KD and DPBS buffer. The obtained ssDNA was marked as pool 1 for the next round of screening.

[0046] 6. Subsequent screening.

[0047] The above magnetic bead method was used to repeat 11 rounds of screening, and each operation used the secondary library obtained in the previous round of screening as the starting nucleic acid library. In order to improve the specificity and affinity of the ssDNA obtained by screening, in the subsequent screening, the binding time of the library with the gHgL protein was gradually shortened, the number of washing times was increased, and MB-His was added for counter-screening. During the screening process, surface plasmon resonance (SPR) was used to detect the changes in the recognition ability of the ssDNA library for the gHgL protein in each round. When the binding ability of the screened DNA single-stranded library to gHgL was higher than that of the screening starting library, the obtained enriched product library was cloned and sequenced for analysis, and several sequences were selected to be synthesized by Shanghai Biotech to detect the affinity and specificity of the nucleic acid aptamers obtained by screening.

[0048] 7. Surface plasmon resonance (SPR) detection of affinity of candidate DNA sequences.

[0049] 1. Wash the chip with 50mM NaOH, set the flow rate to 10μl / min, and inject 20μl. Mix equal volumes of EDC (0.4M aqueous solution) and NHS (0.1M aqueous solution) and inject them to activate the chip, with a flow rate of 10μl / min, and activate channels 1 and 3. Dilute the gHgL protein 60 times with a sodium acetate aqueous solution with a pH of 4.5 and a concentration of 10mM and inject it into channel 3. The gHgL protein coupling amount is 8400RU. Dilute the His protein with a sodium acetate aqueous solution with a pH of 4.5 and a concentration of 10mM to 25μg / ml and inject it into channel 1. The His protein coupling amount is 280RU. After the injection is completed, inject 1M pH8.5 ethanolamine reagent to block channels 1 and 3, with a flow rate of 10μL / min, and inject for 10min. The screened DNA sequences were diluted to 2 μM with DPBS and then detected using a surface plasmon resonance spectrometer (GE Healthcare, model: Biacore T200).

[0050] 2. Affinity detection of candidate DNA sequences obtained by targeted gHgL screening.

[0051] Through magnetic bead screening and subsequent high-throughput sequencing identification, we obtained 30 aptamer DNA sequences that bind to gHgL protein. Figure 1 As shown, through SPR identification, it was found that the 14th and 28th nucleic acid aptamer DNA sequences had higher affinity to gHgL protein.

[0052] 3. Prediction of nucleic acid aptamer sequence and secondary structure targeting gHgL

[0053] The two nucleic acid aptamer sequences with high affinity for gHgL protein were named L14 and L28.

[0054] The full length of the L14 sequence is:

[0055] CTACGGTGCCTTGAAGTGACTGTTGACCAGGGACTGCTCGGGATTGCGGAAGTCAACATAGCAGGTCACTTCCAGG (SEQ NO. 6);

[0056] The core sequence is TGTTGACCAGGGACTGCTCGGGATTGCGGAAGTCAA (SEQ NO. 7).

[0057] The full length of the L28 sequence is:

[0058] CTACGGTGCCTTGAAGTGACTGTTGACCGGGGACTGCTCGGGATTGCGGACGTCAACATAGCAGGTCACTTCCAGG(SEQ NO.8);

[0059] The core sequence is TGTTGACCGGGGACTGCTCGGGATTGCGGACGTCAA (SEQ NO. 9).

[0060] The MFold program was used to analyze the secondary structures and Gibbs free energy (ΔG) values ​​of the two nucleic acid aptamers by predicting the most likely minimum energy structure. Both L14 and L28 can form unique stem-loop structures with ΔG values ​​of -59.50 and -52.72 kJ / mol, respectively. Figure 2 shown.

[0061] 8. SPR detection of the affinity of nucleic acid aptamers L14, L28 and gHgL protein.

[0062] 1. Wash the chip with 50mM NaOH, set the flow rate to 10μl / min, and inject 20μl. Mix equal volumes of EDC (0.4M aqueous solution) and NHS (0.1M aqueous solution) and inject them to activate the chip, with a flow rate of 10μl / min and injection for 10min. Dilute the gHgL protein to 10μg / ml with a 10mM sodium acetate aqueous solution at pH 4.5 and inject it. The gHgL protein coupling amount is 1400RU. After the injection is completed, inject 1M pH 8.5 ethanolamine to seal the chip, with a flow rate of 10μl / min and injection for 10min. The synthesized nucleic acid aptamer sequence was diluted with DPBS to 0, 0.01953125, 0.0390625, 0.078125, 0.15625, 0.3125, 0.625, 1.25, 2.5, 5, and 10 μM and then detected using a surface plasmon resonance instrument (GE Healthcare, model: Biacore T200).

[0063] 2. Detection of affinity of nucleic acid aptamers to gHgL protein.

[0064] We tested the affinity of nucleic acid aptamers L14 and L28 by surface plasmon resonance (SPR) experiments. Figure 3 As shown, it was shown that both L14 and L28 had strong binding affinity with gHgL protein detected by SPR, with Kd values ​​of 562nM and 109.8nM, respectively.

[0065] 9. The specificity of nucleic acid aptamers L14, L28 and gHgL protein was detected by enzyme-linked apta-sorbent assay (ELASA).

[0066] 1. Dissolve 5 μg gHgL protein in 100 μl DPBS, then add 96-well ELISA plate (purchased from Corning Biotech Co., Ltd., #3590) to coat overnight at 4°C, and use an equal amount of His protein as a control protein. After washing with DPBS twice, block the plate with 100 μl 3% BSA at 4°C for 30 minutes. After washing with DPBS three times, add 100 μl 500nM biotin-labeled nucleic acid aptamer (biotin-labeled initial library as a control) and incubate at room temperature for 30 minutes. After washing with DPBS three times, add 100 μl horseradish peroxidase-streptavidin (Pierce HRP-Strep, Thermo Fisher Scientific, 1:10000 dilution) and incubate for 30 minutes. After washing the well plate with DPBS for 5 times, the OD450 value of each well was detected by a microplate reader using a Pierce TMB substrate kit (ThermoFisher Scientific) to analyze the binding specificity of the nucleic acid aptamer.

[0067] 2. Specific detection of nucleic acid aptamer binding to gHgL protein.

[0068] The binding of aptamers L14 and L28 to gHgL protein and control His protein was detected by ELASA. Figure 4 As shown, gHgL protein and the two aptamers have good binding properties. The initial random library did not bind to gHgL protein significantly, and the two aptamers also did not bind to the control protein His. The results show that the two aptamers L14 and L28 can bind to gHgL protein, and this binding is specific.

[0069] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0070] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A nucleic acid aptamer targeting Epstein-Barr virus, characterized in that: The nucleic acid aptamer comprises a targeting sequence, and the nucleic acid aptamer specifically binds to the gHgL protein of the Epstein-Barr virus. The targeting sequence is selected from SEQ ID NO.6 or SEQ ID NO.

8.

2. The nucleic acid aptamer according to claim 1, characterized in that When the targeting sequence is SEQ ID NO.6, the secondary structure of the targeting sequence is as follows: ； When the targeting sequence is SEQ ID NO.8, the secondary structure of the targeting sequence is as follows: 。 3. Use of the nucleic acid aptamer according to any one of claims 1 to 2 in the preparation of a product for detecting Epstein-Barr virus, excluding use in disease diagnosis.

4. A kit for detecting Epstein-Barr virus, characterized in that: The invention comprises the nucleic acid aptamer according to any one of claims 1 to 2.

5. The kit according to claim 4, characterized in that The nucleic acid aptamer further includes a label, and the label is selected from at least one of biotin, a luminescent group, and an enzyme.

6. A method for detecting EB virus for non-diagnostic purposes, characterized in that: The following steps are involved: The sample to be tested is incubated with the nucleic acid aptamer in the kit according to claim 5, washed, and the labeling signal of the label is detected.

7. An anti-EB virus drug, characterized in that: The invention comprises a pharmaceutical active ingredient and a carrier, wherein the carrier is the nucleic acid aptamer according to any one of claims 1 to 2.

Images