A kit for detecting chestnut blight pathogen, detection method and application thereof

Abstract

The present invention provides specific primers and a visual detection method for rapid detection of chestnut blight pathogen based on RAA-CRISPR / Cas12a, wherein the specific primers include gRNA primers and RAA primers for specific detection of chestnut blight pathogen. The visual detection method for detecting chestnut blight pathogen of the present invention has the characteristics of simple operation, rapid detection, low cost, high sensitivity, strong specificity and visualization. The RAA amplification method is combined with the CRISPR / Cas12a detection method to detect chestnut blight pathogen, and visual detection is achieved through an ultraviolet gel imager and a Cas12 / 13 special nucleic acid detection test strip, which can realize on-site rapid detection of chestnut blight pathogen, provide an effective method for rapid detection and early diagnosis of chestnut blight pathogen, and provide guidance for monitoring, early warning and precise prevention and control of chestnut blight.

Description

Technical Field

[0001] The invention relates to a detection system and a detection method for plant blight bacteria, in particular to a detection system and a detection method for fruit tree blight bacteria, and belongs to the field of biotechnology. Background Art

[0002] Chestnut blight pathogen is a devastating disease caused by Cryphonectria parasitica, and is one of the targets of plant quarantine in China. When trees are infected, chestnut branches will rot and ulcerate, which may weaken the tree at the least or even kill the whole tree or even the entire chestnut forest, causing serious economic losses. Chestnuts in different growth stages may be infected by chestnut blight pathogen. In the early stage of infection, the lesions on the rough bark cannot be identified, which leads to tree weakness and even death. Traditional quarantine methods for chestnut blight pathogens are mainly through lesion observation and microscopic characteristics of pathogens. It is difficult to quickly detect a large number of plants. It is time-consuming, labor-intensive, and prone to human errors. It is difficult to meet the modern requirements for rapid, accurate, and sensitive quarantine of plant diseases, and it is easy to miss the best prevention and control period. Therefore, it is of great significance to establish a rapid and highly sensitive chestnut blight pathogen detection technology for the prevention and control of chestnut blight.

[0003] With the rapid development of molecular biology technology, the main methods for detecting and identifying chestnut blight pathogens are conventional PCR and real-time fluorescence PCR. However, traditional molecular biology detection methods rely on expensive instruments and equipment, with complex steps and a long time consumption, making it difficult to meet the needs of rapid on-site detection. Based on isothermal amplification technology (RPA, LAMP, RAA, etc.), nucleic acid amplification can be achieved under constant temperature conditions. Compared with traditional PCR technology, it greatly reduces dependence on laboratory instruments and equipment and simplifies detection steps and time. However, this method still has some limitations, such as non-specific amplification, aerosol contamination, false positives, etc., which affect the accuracy of rapid detection results. In recent years, because of the high sensitivity and good specificity of the CRISPR / Cas system, the system has been developed as a fast, accurate, and highly sensitive molecular detection technology.

[0004] Cas12a, also known as Cpf1, is an RNA-guided monomeric endonuclease that belongs to the second type of CRISPR / Cas system. The basic principle of the CRISPR / Cas12a system is that after CRISPR RNA (crRNA) guides the Cas12a protein to cut the target sequence, it will cut the single-stranded ssDNA labeled with fluorescein or biotin in the detection system. The results can be directly judged by detecting fluorescence or using test strips. It can be tested in the laboratory or on-site. The detection system based on CRISPR / Cas12a is widely used in the detection of various pathogens and gene editing due to its high sensitivity and specificity. The optimal temperature for Cas12a to exert its nuclease function is similar to the reaction temperature of RAA nucleic acid amplification (37°C). When it is used in combination with isothermal amplification technology, the detection method has the advantage of dual specificity, which ensures the accuracy of the test results and makes the detection easier and faster. Therefore, the two can be used in combination, that is, RAA is responsible for isothermal amplification of the target sequence to increase the copy number of the target sequence, and the specific gRNA guides the Cas12a protein to cut the target gene, while activating the trans-cutting activity of the Cas12a protein to cut the ssDNA probe labeled with fluorescent or biotin in the detection system, and finally the results are interpreted by ultraviolet detection or test strips.

[0005] The present invention takes the Sge1 sequence of the Gti1 / Pac2 family transcription factor of chestnut blight pathogen as the target, designs specific RAA primers, and develops a rapid detection system in combination with specific gRNA primers, Cas12a cleavage system and visual test strips. The detection method has the advantages of being rapid, sensitive, specific, and easy to operate, and can be applied to on-site identification, which is of great significance for the rapid identification of chestnut blight pathogen. Summary of the invention

[0006] The purpose of the present invention is to provide a kit, a detection method and an application for rapid detection of chestnut blight pathogen based on RAA-CRISPR / Cas12a technology, aiming at the technical problems that the existing chestnut blight pathogen has a long detection time, the plant material needs to be taken to the detection laboratory, and whether it is infected can be determined by observing the lesions and the morphological characteristics of the pathogen, and the detection result has a large error. The detection kit and the detection method of the present invention can realize on-site rapid detection and identification of chestnut blight pathogen in a wild chestnut planting site, provide gRNA primers and RAA primers of chestnut blight pathogen, and the method of the present invention does not need to rely on complex instruments and equipment in the process of detecting chestnut blight pathogen, and can judge whether chestnut is infected by naked eye visualization detection technology. The method of the present invention has the advantages of rapidity, high sensitivity, strong specificity, simple operation and the like, can be suitable for on-site identification, and is of great significance for the rapid identification of chestnut blight pathogen.

[0007] To achieve the above purpose, the present invention adopts the following technical solutions:

[0008] The first aspect of the present invention provides a kit for rapid detection of chestnut blight pathogen, comprising: gRNA primers, RAA amplification primers, wherein: the gRNA primer sequence is: SEQ ID No.1 or SEQ ID No.2; the RAA amplification primer sequence is: SEQ ID NO.3, SEQ ID NO.4.

[0009] In particular, the gRNA primer sequences are as follows:

[0010] Cp-gRNA1:uaauuucuacuaaguguagauuuccuugggagcagcagcag, SEQ ID NO.1;

[0011] Cp-gRNA2:uaauuucuacuaaguguagauccgacaugaugcuguuggcc, SEQ ID NO. 2.

[0012] The base U of RNA in the sequence listing is replaced by T.

[0013] In particular: the RAA amplification primer sequence is as follows:

[0014] Upstream primer Cp-RAA-5F: tcctggacgaccgagccctactccttggaatga, SEQ ID NO. 3;

[0015] Downstream primer Cp-RAA-5R: ctgctgctgctgctgctgttggtggtgttg, SEQ ID NO.4.

[0016] A second aspect of the present invention provides a kit for rapid detection of chestnut blight pathogenic bacteria based on RAA-CRISPR / Cas12a, which also includes a ssDNA probe for visual observation of chestnut blight pathogenic bacteria.

[0017] Among them, the ssDNA probe is selected as the ssDNA1 probe of chestnut blight pathogen for visual fluorescence detection and / or the ssDNA2 probe of chestnut blight pathogen for detection by Cas12 / 13 special nucleic acid detection test strip.

[0018] Wherein, the ssDNA1 probe sequence of chestnut blight pathogen used for visualized fluorescence detection is: ssDNA1: 5′-FAM-ttatt-BHQI-3′, SEQ ID No. 11;

[0019] The ssDNA2 probe sequence of chestnut blight pathogen detected by the Cas12 / 13 dedicated nucleic acid detection test strip is: ssDNA2: 5′-FAM--ttttttttatttttt-Biotin-3′, SEQ ID No.10.

[0020] The 5′ and 3′ ends of the fluorescent probe ssDNA1 were labeled with carboxyfluorescein (FAM) and quencher group-1 (BHQ-1), respectively; the 5′ and 3′ ends of the ssDNA2 probe were labeled with carboxyfluorescein (FAM) and biotin, respectively.

[0021] In particular, the kit for rapid detection of chestnut blight pathogen based on RAA-CRISPR / Cas12a also includes: RAA nucleic acid amplification kit, CRISPR / Cas12a protein, NEBuffer2.1 buffer, nuclease-free water, and Cas12 / 13 special nucleic acid detection test strips.

[0022] In particular, the RAA nucleic acid amplification kit includes: buffer V, primer Cp-RAA-5F, primer Cp-RAA-5R, purified water, basic reaction unit, and magnesium acetate.

[0023] Among them, the Cas12a cutting system includes: Cas12a protein, NEBuffer2.1 buffer, gRNA primer, probe ssDNA, template and nuclease-free water.

[0024] The third aspect of the present invention provides a method for rapid detection of chestnut blight pathogen, comprising the following steps:

[0025] (1) DNA extraction:

[0026] Extracting chestnut blight pathogen genomic DNA to obtain chestnut blight pathogen genomic gDNA for later use;

[0027] (2) Construction of T plasmid (i.e. gene fragment amplification and PMD TM 19-T VECTOR connection)

[0028] Firstly, the genomic DNA of chestnut blight pathogen was extracted and used as a template to perform PCR amplification reaction; then the PCR amplification product was connected with the T-vector to construct the CpSge1-T-Vector plasmid, referred to as Cp-T plasmid;

[0029] (3) RAA amplification treatment

[0030] Using the Cp-T plasmid constructed in step (2) as a template, an RAA isothermal amplification reaction is performed to obtain a RAA amplification product Cp-RAA;

[0031] (4) CRISPR / Cas12 fluorescent cleavage

[0032] The RAA amplification product is fully mixed with gRNA primer, Cas12a protein, NEBuffer2.1 buffer, probe ssDNA and nuclease-free water, incubated, and subjected to CRISPR / Cas12a fluorescent cleavage reaction to obtain a CRISPR / Cas12a fluorescent cleavage reaction product;

[0033] (5) Fluorescence visualization detection

[0034] The fluorescent signal of the CRISPR / Cas12a fluorescent cleavage reaction product is measured, and whether chestnut blight pathogen is present is judged based on the presence or absence of the fluorescent signal. When the fluorescent signal is detected, it indicates that chestnut blight pathogen is present, otherwise it is not present.

[0035] In particular, the primers for the PCR amplification reaction in step (2) are CpSge1-5F and CpSge1-5R, wherein the sequences of the primers CpSge1-5F and CpSge1-5R are:

[0036] CpSge1-5F: atggacgagcttgtgtcgca, SEQ ID NO.5;

[0037] CpSge1-5R: aaggacgcgaagaactgatcg, SEQ ID NO. 6.

[0038] In particular, the PCR amplification procedure in step (2) is: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 56°C for 10 s, extension at 72°C for 10 s, repeated for 30 cycles; final extension at 72°C for 5 min;

[0039] In particular, the PCR amplification system in step (2) is: 2×Mix 50 μL, ddH2O 47 μL, gDNA 1 μL, CpSge1-5F primer 1 μL, CpSge1-5R primer 1 μL, totaling 100 μL.

[0040] In particular, the extracted chestnut blight pathogen genomic gDNA was used as a template and CpSge1-5F and CpSge1-5R were used as primers to carry out PCR amplification reaction to obtain the chestnut blight pathogen CpSge1 fragment.

[0041] In particular, the method also includes recovering and purifying the CpSge1 fragment of chestnut blight pathogen and then connecting it with the T vector.

[0042] In particular, the T vector is selected as pGEM-T, pUC18-T or pMD TM19-T Vector, preferably PMD TM 19-TVector.

[0043] In particular, the ligation reaction in step (2) is carried out as follows: the recovered and purified CpSge1 full-length fragment is ligated to the T vector, that is, 2.5 μL of Solution 1, 2 μL of the CpSge1 full-length fragment and pMD TM Add 0.5 μL of 19-TVector to the PCR tube, centrifuge for 10 seconds to mix, and place in a 16°C metal bath for connection for 10-12 hours.

[0044] In particular, according to pMD TM Follow the instructions of 19-T Vector Cloning Kit.

[0045] In particular, the method further comprises step 2A): adding DH5α E. coli competent cells to the mixed solution after the ligation reaction to carry out E. coli TA cloning transformation; and extracting plasmids by shaking the cells after screening positive clones to obtain Cp-T plasmids.

[0046] In particular, the E. coli TA cloning transformation was carried out according to the following method: the ligation product was mixed with DH5α E. coli competent cells for E. coli TA cloning transformation, and then the E. coli TA cloning transformation system solution was spread on an LB plate supplemented with 50 μL / mL ampicillin resistance, and cultured in a constant temperature incubator at 37°C for 12 hours. After colonies grew, single colonies were picked and transferred to an LB plate supplemented with 50 μL / mL ampicillin resistance.

[0047] In particular, the screening of positive clones is carried out according to the following steps: the system solution after the transformation of the Escherichia coli TA clone is evenly spread on an LB plate supplemented with 50 μL / mL ampicillin resistance, and then cultured in a constant temperature incubator at 37°C for 12 hours. After the colonies grow, single colonies are picked and transferred to an LB plate supplemented with 50 μL / mL ampicillin resistance, and used as a template to screen positive clone strains containing the Cp-T plasmid using specific primers, and then the positive clone strains are picked into LB liquid culture medium and cultured on a constant temperature shaker at 37°C and a rotation speed of 220 rpm for 12 hours.

[0048] In particular, the specific primer is pMD TM The 19-T Vector specific primers are M13F and M13R, where the sequences of primers M13F and M13R are as follows:

[0049] M13F: cgccagggttttcccagtcacgac, SEQ ID NO.7;

[0050] M13R: agcggataacaatttcacacagga, SEQ ID NO. 8.

[0051] In particular, the method further comprises adding a positive clone strain to LB liquid culture medium, culturing for 12 hours on a constant temperature shaker at a temperature of 37° C. and a rotation speed of 220 rpm, and then performing plasmid extraction by shaking to obtain the Cp-T plasmid.

[0052] In particular, the E. coli TA cloning product was extracted using a rapid plasmid mini kit.

[0053] In particular, the primers for the RAA amplification reaction in step (3) are Cp-RAA-5F and Cp-RAA-5R, and the sequences of Cp-RAA-5F and Cp-RAA-5R are as follows:

[0054] Cp-RAA-5F: tcctggacgaccgagccctactccttggaatga, SEQ ID NO.3;

[0055] Cp-RAA-5R: ctgctgctgctgctgctgttggtggtgttg, SEQ ID NO. 4.

[0056] In particular, a RAA nucleic acid amplification kit is used to perform RAA isothermal amplification with Cp-RAA-5F and Cp-RAA-5R primers and the Cp-T plasmid constructed in step (2) as a template. After the RAA amplification system is mixed, the RAA amplification reaction is performed at 37-42°C for 40±5 minutes to obtain a RAA amplification product.

[0057] The RAA amplification reaction does not require a PCR instrument and can be performed in the field.

[0058] The product of ordinary PCR is only used to screen the best gRNA, Cas12 and gRNA amount. After it is clear that it is gRNA1, and Cas12 (0.125uL) and gRNA (0.25uL) are added, the RAA product is used for fluorescence detection. Ordinary PCR can increase the amplification multiple, and compared with RAA amplification, more CpSge1-RAA fragments can be obtained, thereby better verifying the Cas12a protein cutting activity and screening the gRNA sequence.

[0059] In particular, the RAA amplification reaction is carried out according to the following steps: first, a RAA amplification system is configured according to 25 μL of buffer V, 2 μL of primer Cp-RAA-5F, 2 μL of primer Cp-RAA-5R, and 14.5 μL of purified water, which is placed in a basic reaction unit, mixed by hand and briefly centrifuged; then, 5 μL of magnesium acetate is added, mixed thoroughly, and then 1.5 μL of the Cp-T plasmid constructed in step (2) is added and mixed thoroughly; then, the reaction is placed in a metal bath instrument preheated at 37° C. for reaction for 40 minutes to obtain a RAA amplification product (referred to as Cp-RAA).

[0060] In particular, the basic reaction unit, buffer V, and magnesium acetate are components of the RAA nucleic acid amplification kit.

[0061] Among them, the components of the RAA nucleic acid amplification kit are: basic reaction unit (12T / Pack), buffer V (1500μL / Tube), purified water (1500μL / Tube), magnesium acetate (600μL / Tube), basic positive quality control product (25μL / Tube), basic positive control forward primer (25μL / Tube), and basic negative control forward primer (25μL / Tube).

[0062] In particular, the method further comprises step 3A), wherein after the RAA amplification reaction is completed, 50 μL of a phenol-chloroform (1:1) mixture is added to each tube, and the mixture is mixed and then centrifuged in a centrifuge to separate the layers.

[0063] An appropriate amount of the supernatant after stratification was taken for identification by 2% agarose gel electrophoresis to verify whether the Cp-RAA-5F and Cp-RAA-5R primers were correct and ensure that the designed primers could be used for CpSge1 detection.

[0064] In particular, the gRNA primer described in step (4) is selected as gRNA1 or gRNA2, wherein the sequence of gRNA1 or gRNA2 is as follows:

[0065] gRNA1:uaauuucuacuaaguguagauuuccuugggagcagcagcag, SEQ ID NO.1;

[0066] gRNA2:uaauuucuacuaaguguagauccgacaugaugcuguuggcc, SEQ ID NO. 2.

[0067] In particular, the gRNA primer is selected as gRNA1.

[0068] The probe-ssDNA described in step (4) is the ssDNA1 probe of chestnut blight pathogen used for visualized fluorescence detection or the ssDNA2 probe of chestnut blight pathogen used for Cas12 / 13 special nucleic acid detection test strip detection, wherein: the ssDNA1 probe sequence is SEQ ID NO.11; the ssDNA2 probe sequence is SEQ ID NO.10.

[0069] In particular, the ssDNA1 probe sequence is: ssDNA1: 5′-FAM-ttatt-BHQI-3′, SEQ ID NO.11; the ssDNA2 probe sequence is: ssDNA2: 5′-FAM--ttttttttattttt-Biotin-3′, SEQ ID NO.10.

[0070] In particular, in step (4), the CRISPR / Cas12a fluorescent cleavage reaction is carried out according to the following steps: the RAA amplification product is fully mixed with the gRNA primer, Cas12a protein, NEBuffer2.1 buffer, probe ssDNA1 and nuclease-free water, incubated, and then the CRISPR / Cas12a fluorescent cleavage reaction is carried out at 37°C, wherein the fluorescence value is measured every 5 minutes during the Cas12a protein cleavage reaction for 1 hour to obtain the CRISPR / Cas12a fluorescent cleavage reaction product.

[0071] In particular, in step (4), the CRISPR / Cas12a fluorescent cleavage reaction is carried out according to the following steps: the RAA amplification product is fully mixed with the gRNA primer, Cas12a protein, NEBuffer2.1 buffer, probe ssDNA2 and nuclease-free water, incubated, and then the CRISPR / Cas12a fluorescent cleavage reaction is carried out at 37°C, wherein after 40 minutes of Cas12a protein cleavage reaction, the cleavage reaction solution is diluted 10 times, and then the Cas12 / 13 special nucleic acid test strip is placed in the dilution solution and incubated for 2 minutes, and then the color development results of the detection line (T) and the quality control line (C) in the interpretation area of ​​the Cas12 / 13 special nucleic acid test strip are observed.

[0072] In particular, the CRISPR / Cas12a fluorescent cleavage reaction was carried out according to the following steps: the Cas12a protein cleavage system was prepared according to NEBuffer 2.1 5 μL, Cas12a protein (100 μM) 0.125 μL, gRNA1 primer (50 μM) 0.25 μL, ssDNA1 (100 μM) 0.25 μL, template Cp-RAA 2 μL, and ddH20 42.375 μL, and the reaction system was 50 μL in total; then, the Cas12a protein cleavage reaction was carried out in a fluorescent quantitative PCR instrument at 37 ° C, wherein the fluorescence value was measured every 5 min during the Cas12a protein cleavage reaction, and the data was saved and analyzed after the end.

[0073] In particular, the reaction system of Cas12a protein cleavage reaction was added to the 8-tube PCR strip, and the LC96 fluorescence quantitative PCR instrument was used to select the FAM channel. The reaction was carried out at 37°C for 1 hour, and the fluorescence value was measured every 5 minutes. After the reaction was completed, the data was saved and analyzed. After the reaction was completed, the fluorescence state was observed under a UV gel imager and photographed.

[0074] In particular, the CRISPR / Cas12a fluorescent cleavage reaction is carried out according to the following steps: NEBuffer 2.1 5 μL, Cas12a protein (100 μM) 0.125 μL, gRNA1 primer (50 μM) 0.25 μL, ssDNA2 (10 μM) 0.5 μL, template Cp-RAA 2 μL, ddH20 42.125 μL prepare the Cas12a protein cleavage system; then, after the Cas12a protein cleavage reaction is carried out in a metal bath at 37°C for 40 minutes, the cleavage reaction product is accurately drawn, and the reaction product is diluted 10 times, and then incubated with a Cas12 / 13 special nucleic acid test strip. After incubation with the test strip for 2 minutes, take photos and observe, and observe the color development results of the detection line (T) and the quality control line (C) in the reading area of ​​the Cas12 / 13 special nucleic acid test strip.

[0075] In particular, the optimal concentration ratios of gRNA primer (gRNA1) and Cas12a protein in the Cas12a protein cleavage system are 0.25 μM and 0.25 μM, respectively.

[0076] In particular, red strips appear on both the quality control line (C line) and the test line (T line) in the reading area of ​​the Cas12 / 13 special nucleic acid test strip; the quality control line (C line) does not show color, and a red strip appears on the test line (T line), both of which indicate the presence of chestnut blight pathogenic bacteria; a red strip appears on the quality control line (C line) and the test line (T line) does not show color, which is judged as a negative result and does not contain chestnut blight pathogenic bacteria; no strips appear on either the quality control line (C line) or the test line (T line), indicating that the test strip or amplification reagent used may have been damaged, ineffective, or operated incorrectly.

[0077] In particular, it also includes screening primers and gRNA according to the following steps:

[0078] A) using Cp-RAA-5F and Cp-RAA-5R as primers and the Cp-T plasmid constructed in step (2) as a template to perform PCR amplification to obtain the CpSge1-RAA fragment;

[0079] B) Using the CpSge1-RAA fragment obtained by PCR amplification in step A) as a template, primer gRNA1 or gRNA2 was added respectively, and the template with water was used as a negative control. The RAA nucleic acid amplification kit was used, and the reaction system was prepared according to NEBuffer2.1 5μL, Cas12aprotein (100μM) 0.5μL, primer gRNA (50μM) 1μL, ssDNA1 (100μM) 0.25μL, CpSge1-RAA2μL, and ddH2041.5μL, and added to the PCR eight-tube strip. Using an LC96 fluorescence quantitative PCR instrument, the FAM channel was selected, and the reaction was carried out at 37°C for 1h. The fluorescence value was measured every 5min. After the end, the data was saved and analyzed;

[0080] C) The fluorescence intensity of the reaction product of the primer-gRNA can be observed under ultraviolet light. Primers with bright fluorescence intensity, linear increase in the fluorescence value of the cleavage reaction product, high degree of linearization, and high fluorescence peak are selected.

[0081] The PCR amplification system described in step A) includes: 2×Mix 50 μL, ddH2O 47 μL, Cp-T plasmid 1 μL, Cp-RAA-5F primer 1 μL, Cp-RAA-5R primer 1 μL, totaling 100 μL.

[0082] In particular, the PCR amplification program described in step A) is: preliminary denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 56°C for 10 s, extension at 72°C for 10 s, repeated for 30 cycles; and final extension at 72°C for 5 min.

[0083] In particular, the sequences of the primers Cp-RAA-5F and Cp-RAA-5R are as follows:

[0084] Cp-RAA-5F: tcctggacgaccgagccctactccttggaatga, SEQ ID NO.3;

[0085] Cp-RAA-5R: ctgctgctgctgctgctgttggtggtgttg, SEQ ID NO. 4.

[0086] In particular, in step B), CpSge1-RAA and gRNA are configured according to CpSge1-RAA+gRNA1 and CpSge1-RAA+gRNA2, respectively; the negative control uses water as a template and is configured according to the template being water+gRNA1 and the template being water+gRNA2, respectively.

[0087] In particular, the sequence of the gRNA primer is as follows:

[0088] Cp-gRNA1:uaauuucuacuaaguguagauuuccuugggagcagcagcag, SEQ ID NO.1;

[0089] Cp-gRNA2:uaauuucuacuaaguguagauccgacaugaugcuguuggcc, SEQ ID NO. 2.

[0090] In particular, the primer gRNA is preferably gRNA1.

[0091] In particular, it also includes screening the concentrations of Cas12a single plate and primer gRNA1 in the CRISPR / Cas12a fluorescent cleavage reaction system according to the following steps: performing an orthogonal test on the Cas12a protein (1 μM, 0.5 μM, 0.25 μM) and gRNA1 concentrations (1 μM, 0.75 μM, 0.5 μM, 0.25 μM) of the Cas12a protein cleavage system in step (4), and preparing the reaction system according to the following dosages: NEBuffer 2.1 5 μL, Cas12a protein X μL, gRNA Y μL, ssDNA1 (100 μM) 0.25 μL, genomic gDNA of chestnut blight pathogen 2 μL, ddH20 42.75-X-YμL, 50μL of Cas12a protein cleavage system, add the reaction system to the PCR eight-tube strip, use LC96 fluorescence quantitative PCR instrument, select FAM channel to react at 37℃ for 1h, measure the fluorescence value every 5min, save the data after the end and analyze it; select the Cas12a protein and gRNA1 concentration with the highest fluorescence intensity value, and the optimal concentration ratios of gRNA1 and Cas12a protein in the system are 0.25μM and 0.25μM, respectively.

[0092] The present invention provides, in one aspect, a use of the above-mentioned kit in rapid detection of chestnut blight pathogen.

[0093] The beneficial effects of the present invention are as follows:

[0094] 1. The present invention designs specific RAA amplification primers and corresponding gRNAs targeting the Sge1 gene sequence of chestnut blight pathogen, and the specific gRNA guides the Cas12a protein to cut the target gene, while activating the non-specific cutting property of the Cas12a protein, and cutting the ssDNA labeled with fluorescein or biotin in the detection system, so as to indicate whether the chestnut branches contain the target sequence of the Sge1 gene of chestnut blight pathogen. If the target sequence is not contained, the solution will not emit fluorescence under ultraviolet light; if the target sequence is present, it will emit fluorescence.

[0095] 2. The method for chestnut blight pathogen detection using the chestnut blight pathogen detection kit of the present invention has high sensitivity. The sensitivity of RAA-CRISPR / Cas12a fluorescence detection and test strip detection using chestnut blight pathogen gDNA as a template can reach 2.1*10 1 copies / μL, and the fluorescence detection sensitivity of the RAA-CRISPR / Cas12a system can reach 2.32*10 3 copies / μL, while the detection sensitivity of the Cas12 / Cas13 dedicated nucleic acid test strip can reach 2.32*10 2 copies / μL.

[0096] 3. The RAA-CRISPR / Cas12a rapid detection method constructed by the present invention, which targets the Sge1 gene of chestnut blight pathogen, is a rapid detection technology with high sensitivity and strong specificity. The entire detection process takes a short time, and the reaction can be completed at a constant temperature of 37°C. The operation is simple and convenient, which is conducive to the on-site visual detection of chestnut blight pathogen. Compared with the traditional PCR method, the time is greatly shortened, and it can be completed without large instruments and professionals, and is particularly suitable for rapid detection in the field. It provides a new technical means for the prevention and control of chestnut blight pathogens.

[0097] 4. The chestnut blight pathogen detection kit of the present invention can be used for on-site real-time detection at wild chestnut planting sites, and during the detection process, it is not necessary to use complex large-scale instruments and professional detection personnel, and it is possible to quickly and accurately determine whether the chestnut plants are infected with chestnut blight pathogens. The detection speed is fast, and the detection method has high sensitivity and specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0098] Figure 1It is the electrophoresis result diagram of the feasibility detection of the RAA primers of the chestnut blight pathogen Sge1 gene of the present invention, wherein: 1 is Cp-RAA-5F and Cp-RAA-5R as primers; 2 is a negative control without primers, and 3 is a positive control in the RAA kit;

[0099] Figure 2A Fluorescence images of the RAA amplification product CpSge1-RAA configured with gRNA1 and gRNA2 for Cas12a protein cleavage activity reaction;

[0100] Figure 2B It is a fluorescence quantitative curve diagram of the Cas12 protein cleavage activity reaction of CpSge1-RAA;

[0101] Figure 3 It is a fluorescence diagram of the cleavage activity reaction product of different concentration ratios of Cas12a protein and gRNA1; wherein A is a fluorescence diagram of an orthogonal test of Cas12a (1 μM, 0.5 μM, 0.25 μM) and gRNA concentration (1 μM, 0.75 μM, 0.5 μM, 0.25 μM) of the Cas12a protein cleavage system; B is a fluorescence detection result diagram of different concentrations of Cas12a and gRNA1 ratios, in which the numbers represent the fluorescence intensity values ​​detected by the test;

[0102] Figure 4A The fluorescence images of the gDNA of six strains after RAA amplification reaction and then Cas12a protein cleavage reaction; Ps is Elaeocarpus rot, Cg is Colletotrichum gloeosporioides, Cp is chestnut blight, Gy is Yamada Glucorina, Vd is Verticillium dahliae, and Cc is poplar rot;

[0103] Figure 4B It is a fluorescence detection curve diagram of the gDNA of six strains after RAA amplification reaction and then Cas12a protein cleavage reaction within 60 minutes, where the abscissa represents time and the ordinate represents fluorescence intensity;

[0104] Figure 4C The specificity results of Cas12 / 13 nucleic acid test strips were detected after the gDNA of six strains was subjected to RAA amplification reaction and then Cas12a protein cleavage reaction;

[0105] Figure 5A Fluorescence images of chestnut blight pathogen gDNA diluted at different times, after RAA amplification reaction and then Cas12a protein cleavage reaction;

[0106] Figure 5BThe fluorescence detection curves are shown in Figure 2 after the chestnut blight pathogen gDNA was diluted at different times and subjected to RAA amplification reaction and then Cas12a protein cleavage reaction for 60 minutes, where the abscissa represents time and the ordinate represents fluorescence intensity;

[0107] Figure 5C The sensitivity results of Cas12 / 13 nucleic acid test strips after the gDNA of chestnut blight pathogen was diluted at different times and subjected to RAA amplification reaction and then Cas12a protein cleavage reaction;

[0108] Fig. 6A Fluorescence images of chestnut blight pathogen CpSge1-T-Vector diluted at different times, after RAA amplification reaction and then Cas12a protein cleavage reaction;

[0109] Figure 6B It is a fluorescence detection curve diagram of chestnut blight pathogen CpSge1-T-Vector diluted at different times, after RAA amplification reaction and then Cas12a protein cleavage reaction for 60 minutes, where the abscissa represents time and the ordinate represents fluorescence intensity;

[0110] Figure 6C The chestnut blight pathogen CpSge1-T-Vector was diluted at different times, and then subjected to RAA amplification reaction and Cas12a protein cleavage reaction, and the sensitivity result of Cas12 / 13 nucleic acid test strip detection was shown;

[0111] Fig. 7A The gDNA of healthy chestnuts and chestnuts carrying blight bacteria (Inoculated) is used as a template, and the fluorescence detection curve is 60 minutes after RAA amplification reaction and Cas12a protein cleavage reaction, wherein the abscissa represents time and the ordinate represents fluorescence intensity;

[0112] Figure 7B The gDNA of healthy chestnuts and chestnuts carrying blight bacteria were used as templates, and the fluorescence images were respectively subjected to RAA amplification reaction and then Cas12a protein cleavage reaction;

[0113] Figure 7C The actual application results of Cas12 / 13 dedicated nucleic acid test strips were obtained by using the gDNA of healthy chestnuts and chestnuts carrying the blight bacteria as templates, after RAA amplification reaction and Cas12a protein cleavage reaction. DETAILED DESCRIPTION

[0114] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0115] Example 1 Experimental Materials

[0116] Cryphonectria parasitica (Cp), Colletotrichum gloeosporioides (Cg), Verticillium dahliae (Vd), Cytospora chrysosperma (Cc), and Pseudocryphonectria elaeocarpicola (Ps) are all from the China Forestry Microbiological Culture Collection Center, with the collection numbers: CFCC 52154, CFCC 58729, CFCC 82516, CFCC 89981, and CFCC 57515.

[0117] Gymnosporangium yamadai (Gy) is a biotrophic strain that cannot be purified and preserved. It can only be collected from the diseased parts of the affected apples and DNA extracted that year. Since Gymnosporangium yamadai has a strong host specificity, the Gymnosporangium yamadai that infects apple leaves is determined to be Gymnosporangium yamadai.

[0118] The gDNA of the above six pathogens were extracted by CTAB method; the gDNA of the six pathogens were stored in the Forest Pathology Laboratory of the College of Forestry, Beijing Forestry University;

[0119] Agarose gel DNA recovery kit and rapid plasmid extraction kit were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; pMD TM 19-T Vector Cloning Kit was purchased from Bao-Ri Medical Biotechnology (Beijing) Co., Ltd.; 2×SanTaq PCR Mix was purchased from Sangon Biotechnology (Shanghai) Co., Ltd.; RAA nucleic acid amplification kit was purchased from Jiangsu Qitian Gene Biotechnology Co., Ltd.; Cas12 / 13 dedicated nucleic acid test strips were purchased from Beijing Baoying Tonghui Biotechnology Co., Ltd.; gRNA primers and RAA primer pairs were synthesized by Beijing Qingke Biotechnology Co., Ltd.; NEBuffer2.1 and Cas12aprotein (Cas12a protein) were purchased from NEW ENGLAND BIOLABS (NEB).

[0120] Example 2 Construction of chestnut blight pathogen-T plasmid (Cp-T plasmid)

[0121] 1. Extraction of genomic DNA of chestnut blight pathogen

[0122] Extract genomic DNA from chestnut blight pathogen to obtain genomic DNA (gDNA for short) of chestnut blight pathogen and set it aside.

[0123] In the specific implementation of the present invention, a nucleic acid extraction kit (CTAB method) is used to extract the genomic DNA of the pathogen. Other methods known in the art, such as chloroform extraction method, magnetic bead method, centrifugal column method, etc., are also applicable to the present invention.

[0124] 2. PCR amplification

[0125] The genomic gDNA of chestnut blight pathogen was used as a template, and CpSge1-5F and CpSge1-5R were used as primers to configure the PCR reaction system for the first PCR amplification (i.e., ordinary PCR amplification). The first PCR amplification product was separated by electrophoresis using 1% agarose gel to check the target band (1626 bp). After the band was correct, the first PCR amplification product was recovered and purified using an ordinary agarose gel DNA recovery kit to obtain the full-length fragment of the chestnut blight pathogen CpSge1 gene, and sequenced (SEQ ID NO.9);

[0126] The first PCR amplification reaction system is as follows: gDNA 1μL, primer CpSge1-5F 1μL, primer CpSge1-5R 1μL, ddH2O 22μL, 2×SanTaq PCR Mix 25μL, total volume 50μL. The sequences of primers CpSge1-5F and CpSge1-5R are as follows:

[0127] CpSge1-5F: atggacgagcttgtgtcgca, SEQ ID NO.5;

[0128] CpSge1-5R: aaggacgcgaagaactgatcg, SEQ ID NO. 6.

[0129] The first PCR amplification reaction program was as follows: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 56°C for 10 s, extension at 72°C for 10 s, repeated for 30 cycles; final extension at 72°C for 5 min;

[0130] The Sge1 gene is a transcription factor unique to fungi. The Gti1 / Pac2 domain in its N-terminal region has high sequence similarity in different fungi, while the C-terminal region is its variable region, that is, the sequences in this region of different fungi vary greatly. Therefore, the RAA primer is designed at the C-terminal of the CpSge1 gene. The principle of RAA primer design is 30-35bp, GC content is 40-60%, and the amplification length is 100-500bp. The amplification product must be specific in chestnut blight pathogens, and no fragments can be amplified in other fungi.

[0131] 3. Connect T-vector (pMD TM 19-T Vector)

[0132] The purified CpSge1 full-length fragment was connected to the T-vector. The specific operation method and steps were as follows: TM Follow the instructions of 19-T Vector Cloning Kit.

[0133] 3-1. Mix 2.5 μL of Solution 1, 2 μL of the full-length fragment of CpSge1 and pMD TM Add 0.5 μL of 19-T Vector to the PCR tube, centrifuge for 10 seconds to mix, and place in a 16°C metal bath for ligation reaction for 10-12 hours.

[0134] pMD TM 19-T Vector Cloning Kit components: Solution 1 and pMD TM 19-TVector

[0135] 3-2. Then add DH5α E. coli competent cells to the PCR tube and mix well to perform E. coli TA cloning transformation; then evenly spread the E. coli TA cloning transformation system solution on the LB plate with 50 μL / mL ampicillin resistance, and then culture it in a 37°C constant temperature incubator for 12 hours. After the colonies grow, pick a single colony and transfer it to the LB plate with 50 μL / mL ampicillin resistance, and use it as a template to use pMD TM The specific primers M13F and M13R of 19-T Vector were used for single-cell PCR reaction to screen the positive clone strains containing CpSge1-T-Vector, and then the positive clone strains were picked and added to LB liquid culture medium, and cultured for 12 hours on a constant temperature shaker at a temperature of 37°C and a speed of 220 rpm; the primers M13F and M13R are as follows:

[0136] M13F: cgccagggttttcccagtcacgac, SEQ ID NO.7;

[0137] M13R: agcggataacaatttcacacagga, SEQ ID NO. 8.

[0138] 3-3. Use a rapid plasmid extraction kit to extract the E. coli TA cloning product CpSge1-T-Vector plasmid (referred to as Cp-T plasmid), and send the sample for sequencing (Beijing Qingke Biotechnology Co., Ltd.). The Cp-T plasmid insert fragment is compared with the original sequence, and the positive clone plasmid with a correct test result is placed in a -20℃ refrigerator for long-term storage;

[0139] 3-4. Use nanodrop200 to measure the concentration of CpSge1-T-Vector plasmid and store it at -20℃.

[0140] The measurement results showed that the concentration of Cp-T plasmid was 110.5 ng / μL.

[0141] Example 3 RAA amplification

[0142] RAA isothermal amplification was performed using a RAA nucleic acid amplification kit, Cp-RAA-5F and Cp-RAA-5R as primers, and the Cp-T plasmid constructed in Example 2 as a template. The specific operation method and operation steps were performed according to the instructions of the RAA nucleic acid amplification kit, wherein the RAA isothermal amplification system was: buffer V 25 μL, primer Cp-RAA-5F 2 μL, primer Cp-RAA-5R 2 μL, purified water 14.5 μL, basic reaction unit, magnesium acetate 5 μL, CpSge1-T-Vector 1.5 μL; specifically as follows:

[0143] First, place 25 μL of buffer V, 2 μL of primer Cp-RAA-5F, 2 μL of primer Cp-RAA-5R, and 14.5 μL of purified water in the basic reaction unit, flick to mix, and centrifuge briefly to collect the liquid at the bottom of the tube; wherein:

[0144] Cp-RAA-5F: tcctggacgaccgagccctactccttggaatga (SEQ ID NO. 3);

[0145] Cp-RAA-5R: ctgctgctgctgctgctgttggtggtgttg (SEQ ID NO.4);

[0146] Next: add 5 μL of magnesium acetate, mix thoroughly, then add the template (CpSge1-T-Vector plasmid, 1.5 μL), mix thoroughly, and place in a metal bath instrument preheated at 37°C for isothermal RAA amplification reaction to obtain RAA amplification product (referred to as Cp-RAA);

[0147] In order to verify the correctness of the Cp-RAA product, an equal volume of phenol-chloroform (1:1) was added to the RAA reaction product, and after vigorous shaking and mixing, the supernatant was obtained by centrifugation. An appropriate amount of the supernatant was taken and verified by 2% agarose gel electrophoresis. The results showed that the target band size was correct (326 bp, Figure 1 ).

[0148] Example 4 Screening of gRNA Primers

[0149] 1. PCR amplification

[0150] PCR amplification was performed using Cp-RAA-5F and Cp-RAA-5R as primers and the Cp-T plasmid constructed in Example 2 as a template, wherein the PCR amplification system (100 μL) included: 2×Mix 50 μL, ddH2O 47 μL, Cp-T plasmid 1 μL, Cp-RAA-5F primer 1 μL, Cp-RAA-5R primer 1 μL; PCR amplification program: 98°C pre-denaturation for 3 min; 98°C denaturation for 10 s, 56°C annealing for 10 s, 72°C extension for 10 s, repeated for 30 cycles; 72°C final extension for 5 min.

[0151] The CpSge1-RAA fragment (326 bp) was obtained by PCR amplification, and a common agarose gel DNA recovery kit was used for gel excision recovery and purification to obtain the Cp-RAA fragment (326 bp).

[0152] 2. Cas12a protein cleavage reaction

[0153] The Cp-RAA fragment obtained by the PCR amplification reaction in step 1) was used as a template, and gRNA1 or gRNA2 was used as a primer, respectively. The Cas12a protein cleavage reaction system was configured according to NEBuffer 2.1 5 μL, Cas12a protein (Cas12a protein, 100 μM) 0.5 μL, primer (gRNA1 or gRNA2 (50 μM)) 1 μL, probe (ssDNA1, 100 μM)) 0.25 μL, Cp-RAA2 μL, and ddH20 41.5 μL. The FAM channel was selected by LC96 fluorescence quantitative PCR instrument, and the Cas12a protein cleavage reaction was performed at 37 ° C for 1 h. The fluorescence value was measured every 5 min during the reaction. After the reaction, the data was saved and analyzed; wherein: Cp-RAA and gRNA were configured according to CpSge1-RAA+gRNA1 and CpSge1-RAA+gRNA2, respectively;

[0154] The template with water was used as a negative control; the templates were configured as water + gRNA1 and water + gRNA2 respectively;

[0155] gRNA1: uaauuucuacuaaguguagauuuccuugggagcagcagcag, SEQ ID NO.1;

[0156] gRNA2: uaauuucuacuaaguguagauccgacaugaugcuguuggcc, SEQ ID NO. 2.

[0157] ssDNA1 (probe): 5′-FAM-ttatt-BHQI-3′, SEQ ID No.11.

[0158] The Cas12a protein cleavage reaction is to pass through the LC96 fluorescence quantitative PCR instrument, select the FAM channel, set 37 ° C reaction for 1h, measure the fluorescence value every 5min, and save the data and analyze it after the fluorescence quantitative PCR reaction is completed (reaction for 1h). After the reaction is completed, it is placed under a UV gel imager to observe the fluorescence state.

[0159] The solution after the Cas12 protein cleavage reaction was completed was placed under a UV gel imager to observe the fluorescence state, and the best gRNA primer for the Cas12a protein cleavage activity reaction was screened according to the fluorescence intensity. The observation results are as follows Figure 2A The fluorescence curve of CpSge1-RAA in the Cas12a protein cleavage activity reaction for 1 hour is shown in Figure 2B .

[0160] The results showed that under ultraviolet light, the fluorescence intensity of the reaction product of primer gRNA1 was brighter than that of the reaction product of primer gRNA2 ( Figure 2A ), the fluorescence value of the cleavage reaction product of gRNA1 primer showed a linear upward trend, while the peak fluorescence value of gRNA2 was lower than that of gRNA1, and the degree of linearization was not as good as that of gRNA1 ( Figure 2B ). The results showed that the cutting effect of Cas12a guided by gRNA1 was better than that of gRNA2, so gRNA1 primer was selected for subsequent experiments.

[0161] Example 4A Screening of Cas12a and gRNA concentrations

[0162] Taking the product (Cp-RAA) of the RAA amplification reaction in Example 3 as a template and gRNA1 as a primer, NEBuffer2.1 5 μL, Cas12a protein (Cas12a protein) X μL, gRNAY μL, ssDNA1 (100 μM) 0.25 μL, Cp-RAA2 μL, ddH20 42.75-X-Y μL reaction system (50 μL in total) was configured, and by LC96 fluorescence quantitative PCR instrument, FAM channel was selected, and Cas12a protein cleavage reaction was performed at 37 ° C for 1 h. The fluorescence value was measured every 5 min during the reaction, and the data was saved and analyzed after the end; wherein, orthogonal test was performed according to Cas12a (1 μM, 0.5 μM, 0.25 μM) and gRNA concentrations (1 μM, 0.75 μM, 0.5 μM, 0.25 μM) in the Cas12a protein cleavage system.

[0163] After the reaction is completed, place the gel under UV imaging to observe the fluorescence state. The fluorescence observation results are as follows: Figure 3 , wherein A is the fluorescence graph of the orthogonal test of Cas12a (1 μM, 0.5 μM, 0.25 μM) and gRNA concentration (1 μM, 0.75 μM, 0.5 μM, 0.25 μM) in the Cas12a protein cleavage system; B is the fluorescence intensity detection result of the orthogonal test of Cas12a and gRNA at different concentrations.

[0164] The observation results are as follows: When the concentration of Cas12a protein is 0.25 μM and the concentration of gRNA1 is 0.25 μM, the fluorescence value has reached nearly 20,000 AU (fluorescence intensity) ( Figure 3 ), considering the cost of reagents and consumables, the selected concentration ratios of gRNA1 and Cas12a protein were 0.25 μM and 0.25 μM, respectively.

[0165] For example, if the concentration of Cas12a protein is 100 μM, the amount (X) of Cas12a protein used in the CRISPR / Cas12a cleavage reaction of the present invention is 0.25 μM×50 μL / 100 μM=0.125 μL;

[0166] If the concentration of gRNA1 is 50 μM, the amount of gRNA1 (Y) used during the CRISPR / Cas12a cleavage reaction of the present invention is 0.25 μM×50 μL / 50uM=0.25 μL.

[0167] Example 4B Specificity test of RAA / CRISPR-Cas12a detection method

[0168] 1. Nucleic acid extraction

[0169] Nucleic acid extraction kit (CTAB method) was used to extract gDNA of pathogens of chestnut blight pathogen (Cryphonectria parasitica), gloletotrichum gloeosporioides, Gymnosporangium yamadai, Pseudocryphonectria elaeocarpicola, Verticillium dahliae and Cytospora chrysosperma, which were marked as Cp, Cg, Gy, Ps, Vd, Cc-gDNA respectively;

[0170] 2. RAA isothermal amplification reaction

[0171] RAA nucleic acid amplification kit was used to perform RAA amplification on the gDNA of pathogens of chestnut blight pathogen, gloeosporium anthracnose pathogen, Yamada balanoposthium, el-o'-lane rot pathogen, dahliae verticillium and poplar rot pathogen, and RAA amplification reaction products of six pathogens were obtained (respectively labeled as Cp-RAA, Cg-RAA, Gy-RAA, Ps-RAA, Vd-RAA, Cc-RAA), among which:

[0172] Primers: Cp-RAA-5F and Cp-RAA-5R; Template: gDNA extracted from DNA of 6 pathogens; The rest of the reaction system and reaction conditions are the same as those of the RAA amplification reaction in Example 3.

[0173] The RAA amplification system is: buffer V 25 μL, primer Cp-RAA-5F 2 μL, primer Cp-RAA-5R 2 μL, purified water 14.5 μL, basic reaction unit, magnesium acetate 5 μL, template pathogen gDNA 1.5 μL.

[0174] 3. Visualized fluorescence detection

[0175] The RAA amplification reaction products (2 μL) of the six pathogens in the isothermal RAA amplification reaction in step 2) were used as templates to perform Cas12a protein cleavage reactions:

[0176] 3A) The Cas12a protein cleavage reaction system was configured according to the following dosage: NEBuffer 2.1 5 μL, Cas12aprotein (100 μM) 0.125 μL, gRNA1 (50 μM) 0.25 μL, ssDNA1 (100 μM) 0.25 μL, RAA amplification product 2 μL, ddH20 42.375 μL; then the mixed reaction system was added to the PCR eight-tube row, and the LC96 fluorescence quantitative PCR instrument was used to select the FAM channel to perform the Cas12a protein cleavage reaction, wherein the cleavage reaction temperature was 37 ° C, the reaction time was 1 h, and the fluorescence value was measured every 5 min during the cleavage reaction, and the data was saved and analyzed after the end; the fluorescence test results are as follows Figure 4A ; Wherein: ssDNA1 is a fluorescent probe, 5′-FAM-ttatt-BHQI-3′, SEQ ID NO.11;

[0177] The fluorescent probe ssDNA1 is an oligonucleotide (i.e., a fluorescent reporter molecule), with carboxyfluorescein (FAM) labeled at the 5' end and quencher group-1 (BHQ-1) labeled at the 3' end. When the probe is intact, the fluorescent signal emitted by the reporter group carboxyfluorescein is absorbed by the quencher group. As the reaction proceeds, the probe is cut by the Cas12a enzyme, the 5' end reporter group is freed, and the fluorescence is detected.

[0178] 3B) After the cleavage reaction is completed, place the gel under a UV gel imager to observe the fluorescence state and take pictures. Visualize the fluorescence observation photos as shown in Figure 4A .

[0179] Depend on Figure 4A , Figure 4B The test results show that only chestnut blight pathogen (Cp) shows a strong fluorescence signal under ultraviolet light ( Figure 4A ); when the fluorescence quantitative PCR instrument was used to monitor for 1 hour at 37℃, only the sample of chestnut blight pathogen (Cp) showed obvious fluorescence value ( Figure 4B ); The above results show that the method constructed by this method for chestnut blight pathogen RAA-Cas12a fluorescence detection has good specificity for chestnut blight pathogen (Cp).

[0180] 4. Visualized fluorescence-specific detection of test paper

[0181] The RAA amplification reaction products (2 μL) of the six pathogens in the isothermal RAA amplification reaction in step 2) were used as templates to perform Cas12a protein cleavage reactions:

[0182] 4A) Prepare the Cas12a protein cleavage reaction system according to the following dosage: NEBuffer 2.1 5μL, Cas12aprotein (100μM) 0.125μL, gRNA1 (50μM) 0.25μL, ssDNA2 (10μM) 0.5μL, RAA amplification product 2μL, ddH20 42.125μL, add the mixed reaction system to the PCR eight-tube strip, use the LC96 fluorescence quantitative PCR instrument, select the FAM channel, and perform the Cas12a protein cleavage reaction, wherein the cleavage reaction temperature is 37°C, after 40min of cleavage reaction, the 5μL cleavage reaction product accurately drawn is added to 45μL of water, the reaction product is diluted 10 times, and then the Cas12 / 13 special nucleic acid test strip is inserted into the diluted reaction product. After incubation for 2min, take pictures and observe. The observation results are as follows Figure 4C , wherein: ssDNA2 is a biotin reporter molecule, 5′-FAM--ttttttttatttttt-Biotin-3′, SEQ ID NO.10;

[0183] The incubation treatment is as follows: after the reaction product of the Cas12a protein cleavage reaction is diluted, the Cas12 / 13 special nucleic acid test strip binding pad end (arrow end) is inserted into the PCR tube, and the liquid level must not exceed the uppermost end of the binding pad, and the judgment area is completely infiltrated (about 1 to 2 minutes. When the external ambient temperature is low, such as in winter, the water absorption rate will be reduced, and the infiltration time of the judgment area will be extended). After the quality control line (C line) is colored, about 2 minutes later, the test strip can be taken out. Read the test results directly according to the color development of the test strip.

[0184] The Cas12 / 13 special nucleic acid test strip is divided into three parts: the absorption pad, the reading area, and the binding pad. There are detection lines (T) and quality control lines (C) in the reading area. Red strips appear on both the quality control line (C line) and the detection line (T line); the quality control line (C line) does not show color, and a red strip appears on the detection line (T line). Both of the above situations indicate that Cas12 / 13 can be effectively cut and activate the reporter group to develop color; a red strip appears on the quality control line (C line), and the detection line (T line) does not show color, which is judged as a negative result. This result shows that Cas12 / 13 failed to cut the fluorescent probe and failed to activate the reporter group to develop color; no strips appeared on the quality control line (C line) and the detection line (T line), indicating that the test strip or amplification reagent used may have been damaged, ineffective, or operated incorrectly.

[0185] Figure 4CThe results showed that except for chestnut blight pathogen (Cp), the test strips of the other five groups of pathogens showed no T line ( Figure 4C ). The results showed that the chestnut blight pathogen RAA-CRISPR / Cas12a fluorescence detection and test strip detection system of the method of the present invention have good specificity for chestnut blight pathogen (Cp).

[0186] Example 4C Sensitivity test of RAA / CRISPR-Cas12a detection method

[0187] The CpSgel-T-Vector (Cp-T) plasmid prepared in Example 2 and the gDNA of chestnut blight pathogen extracted in Example 1 were used as templates, and the concentration of Cp-T plasmid and the gDNA concentration of chestnut blight pathogen were measured by spectrophotometer nanodrop200 to calculate the copy number. 8 groups were diluted in 10-fold gradient.

[0188] 1) Using a spectrophotometer nanodrop200, the concentrations of the CpSge1-T-Vector (Cp-T) plasmid prepared in Example 2 and the gDNA of the chestnut blight pathogen extracted in Example 1 were respectively measured, and the copy numbers were calculated. Then, 8 groups of dilutions were performed in a 10-fold gradient to prepare a series of dilution solutions of the Cp-T plasmid and gDNA;

[0189] 2) Using the diluted Cp-T plasmid and chestnut blight pathogen gDNA as templates, respectively, the RAA amplification system was prepared according to the following amounts: primer Cp-RAA-5F 2 μL, primer Cp-RAA-5R 2 μL, purified water 14.5 μL, basic reaction unit, magnesium acetate 5 μL, template 1.5 μL, buffer V 25 μL, and RAA amplification reactions were performed respectively. The conditions of the RAA amplification reaction were the same as those of the RAA amplification reaction in Example 3;

[0190] The conditions for the RAA amplification reaction are as follows: 25 μL of buffer V, 2 μL of primer Cp-RAA-5F, 2 μL of primer Cp-RAA-5R, and 14.5 μL of purified water are mixed, and the mixture is mixed by hand and briefly centrifuged; then the mixture is added to the basic reaction unit, mixed thoroughly and briefly centrifuged; then 5 μL of magnesium acetate is added and mixed thoroughly; then the template (Cp-T plasmid or chestnut blight pathogen gDNA and its serial dilution samples, 1.5 μL) is added and mixed thoroughly; and then the mixture is placed in a metal bath instrument preheated at 37°C for reaction for 40 minutes.

[0191] 3) After the RAA reaction is completed, a serial dilution RAA amplification product of the Cp-T plasmid or the chestnut blight pathogen gDNA is obtained, and 2 μL of the corresponding RAA product is taken as a template, and the Cas12a protein cleavage reaction is performed respectively, and fluorescence and test strip visualization detection are performed, wherein:

[0192] 3-1) The system was configured according to the method of visualized fluorescence detection in step 3) of Example 4B, and the Cas12a protein cleavage reaction was performed. The reaction conditions were the same as those in step 3) of Example 4B; that is, the fluorescent probe ssDNA1 was selected for fluorescent visualization detection, and the serially diluted RAA amplification reaction products were used as templates. NEBuffer 2.1 5μL, Cas12a protein (100μM) 0.125μL, gRNA1 (50μM) 0.25μL, ssDNA1 (100μM) 0.25μL, template 2μL, ddH20 42.375μL (50μL in total) reaction system was added to the PCR eight-tube row, and the LC96 fluorescence quantitative PCR instrument was used to select the FAM channel. Set the reaction at 37°C for 1h, measure the fluorescence value every 5min, save the data and analyze it after completion. After the reaction is completed, observe the fluorescence state under a UV gel imager and take pictures, such as Figure 5A , 6A ; Visualized fluorescence detection reaction within 1h fluorescence curve as Figure 5B , 6B .

[0193] Depend on Figure 5A , 5B The experimental results show that the gDNA of chestnut blight pathogen was diluted by 10 -6 In this case, the fluorescence is more obvious ( Figure 5A ), the fluorescence quantitative PCR instrument was monitored at 37℃ for 1h, the gDNA limit concentration detected was 1pg / μL, and the copy number limit detected was 2.1*10 1 copies / μL( Figure 5B ).

[0194] Depend on Fig. 6A , 6B The experimental results show that the chestnut blight pathogen Cp-T plasmid was diluted 10 -7 In this case, fluorescence detection is still quite obvious ( Fig. 6A );Fluorescence quantitative PCR instrument was used to monitor for 1 h at 37℃, and the dilution was 10 -7 The fluorescence value can still be detected, indicating that when the Cp-T plasmid is used as a template, the minimum concentration of the RAA-CRISPR / Cas12a fluorescence detection system of chestnut blight pathogen is 10fg / μL, and the calculated minimum copy number of detection is 2.32*10 3 copies / μL( Figure 6B ).

[0195] 3-2) The system was configured according to the method of visualized fluorescence-test paper detection in step 4) of Example 4B, and the Cas12a protein cleavage reaction was performed. The reaction conditions were the same as those in step 4) of Example 4B, that is:

[0196] The biotin reporter molecule ssDNA2 was used for visual detection of the test strip. The diluted RAA amplification product was used as a template. NEBuffer 2.1 5μL, Cas12a protein (100μM) 0.125μL, gRNA1 (50μM) 0.25μL, ssDNA2 (10μM) 0.5μL, template 2μL, ddH20 42.125μL reaction system were added to the PCR tube, set to 37℃ for 40min, the reaction product was diluted 10 times (5μL reaction product + 45μL water) and then inserted into the Cas12 / 13 special nucleic acid test strip, incubated for 2min, and photographed for observation. The observation results are as follows: Figure 5C , 6C .

[0197] Depend on Figure 5C , 6C The test results show that the Cas12 / 13 special nucleic acid test paper shows that the gDNA is diluted by 10 -6 The T line can still be detected in the samples, indicating that the gDNA limit concentration of chestnut blight pathogen RAA-CRISPR / Cas12a combined with Cas12 / 13 special nucleic acid test paper is 1pg / μL, and the copy number limit of detection is 2.1*10 1 copies / μL( Figure 5C ). When Cp-T plasmid was used as template, the chestnut blight pathogen RAA-CRISPR / Cas12a combined with Cas12 / Cas13 dedicated nucleic acid detection system was diluted 10 -8 The test strip can still detect the T line in this case, the lowest concentration detected is 1fg / μL, and the calculated lowest copy number detected is 2.32*10 2 copies / μL( Figure 6C ).

[0198] The above results show that:

[0199] A. When the chestnut blight pathogen gDNA was used as a template for RAA-CRISPR / Cas12a fluorescence detection and test strip detection, the sensitivity could reach 2.1*10 1 copies / μL;

[0200] B. When the Cp-T plasmid of chestnut blight pathogen was used as a template, the fluorescence detection sensitivity of the RAA-CRISPR / Cas12a system could reach 2.32*10 3copies / μL, while the detection sensitivity of the Cas12 / Cas13 dedicated nucleic acid test strip can reach 2.32*10 2 The detection results show that the detection effect of the method of the present invention is good and the sensitivity is high.

[0201] Test example actual sample testing

[0202] 1. DNA extraction from healthy chestnut branches and chestnut branches infected with chestnut blight pathogen

[0203] The chestnut branches inoculated with chestnut blight pathogen and the chestnut branches not inoculated with chestnut blight pathogen were collected, and gDNA was extracted by CTAB method to obtain inoculated gDNA inoculated with chestnut blight pathogen (referred to as BL-gDNA-1); the uninoculated gDNA not inoculated with chestnut blight pathogen (referred to as BL-gDNA-0);

[0204] 2. RAA amplification

[0205] BL-gDNA-1 and BL-gDNA-0 were used as templates, and RAA nucleic acid amplification kits (Jiangsu Qitian Gene Biotechnology Co., Ltd.) were used to perform RAA amplification, respectively. RAA amplification was performed according to the following steps: First, 25 μL of buffer V, 2 μL of primer Cp-RAA-5F, 2 μL of primer Cp-RAA-5R, and 14.5 μL of purified water were placed in the basic reaction unit, mixed by hand and centrifuged briefly; then, 5 μL of magnesium acetate was added and mixed thoroughly, and templates (BL-gDNA-1 and BL-gDNA-0, 1.5 μL each) were added respectively, and after being mixed thoroughly, the mixture was placed in a metal bath instrument preheated at 37°C to perform RAA amplification reaction respectively; then, after 40 minutes of RAA amplification reaction, RAA amplification products were obtained, namely BL-gDNA-1-Cp-RAA and BL-gDNA-0-Cp-RAA;

[0206] 3. Fluorescence detection

[0207] BL-gDNA-1-Cp-RAA and BL-gDNA-0-Cp-RAA were used as templates for Cas12a protein cleavage reaction. The specific operations were as follows: fluorescent probe ssDNA1 was selected, and the reaction system configured according to NEBuffer 2.1 5μL, Cas12aprotein (100μM) 0.125μL, gRNA1 (50μM) 0.25μL, ssDNA1 (100μM) 0.25μL, template RAA 2μL, and ddH20 42.375μL was added to the PCR eight-tube row, and the LC96 fluorescence quantitative PCR instrument was used. The FAM channel was selected to perform Cas12a protein cleavage reaction. The reaction temperature was set to 37°C, the reaction time was 1h, and the fluorescence value was measured every 5min. The measurement results are as follows: Fig. 7A , Fig. 7A The horizontal axis represents time, min; the vertical axis represents fluorescence intensity. Figure 7B It is a fluorescence image of the Cas12a protein cleavage activity reaction.

[0208] 4. Cas12 / 13 special nucleic acid test strip detection

[0209] BL-gDNA-1-Cp-RAA and BL-gDNA-0-Cp-RAA were used as templates for Cas12a protein cleavage reaction. The specific operations were as follows: biotin reporter molecule ssDNA2 was selected, and the reaction system configured according to NEBuffer 2.1 5μL, Cas12a protein (100μM) 0.125μL, gRNA1 (50μM) 0.25μL, ssDNA2 (10μM) 0.5μL, template RAA 2μL, and ddH20 42.125μL was added to the PCR tube, placed in a 37°C metal bath for reaction for 40min, and the cleavage reaction product was diluted 10 times (for example, 5μL of reaction product + 45μL of water), inserted into the Cas12 / 13 special nucleic acid test strip, incubated for 2min, and photographed for observation. The observation results are as follows: Figure 7B , 7C ,in: Figure 7B Fluorescence image of the RAA-CRISPR / Cas12a protein cleavage activity reaction using healthy chestnut and chestnut carrying blight bacteria gDNA as templates; Figure 7C The actual application results of the RAA-CRISPR / Cas12a reaction combined with the Cas12 / 13 dedicated nucleic acid test strips were used as templates for the gDNA of healthy chestnuts and chestnuts carrying the blight bacteria.

[0210] The results of fluorescence detection and Cas12 / 13-specific nucleic acid test strip detection verified the practicability, accuracy and precision of the method of the present invention, and the actual application effect is significant.

Claims

1. A kit for rapid detection of chestnut blight pathogen, characterized in that: It includes primers CpSge1-5F and CpSge1-5R, gRNA primers, and RAA amplification primers for PCR amplification using chestnut blight pathogen genomic DNA as a template, wherein the gRNA primer sequence is: SEQ ID NO.1 or SEQ ID NO.2; the RAA amplification primer sequence is: SEQ ID NO.3, SEQ ID NO.4; the sequences of the primers CpSge1-5F and CpSge1-5R are: SEQ ID NO.5, SEQ ID NO.6, respectively.

2. The kit according to claim 1, characterized in that It also includes a ssDNA probe for visual observation of chestnut blight pathogen, wherein the ssDNA probe is a ssDNA1 probe sequence of chestnut blight pathogen for visual fluorescence detection, SEQ ID NO.11 or / and a ssDNA2 probe sequence of chestnut blight pathogen for detection by Cas12 / 13 special nucleic acid detection test strip, SEQ ID NO.

10.

3. The kit according to claim 2, characterized in that The ssDNA1 probe sequence is: ssDNA1: 5′-FAM-ttatt-BHQI-3′, SEQ ID NO.11; The ssDNA2 probe sequence: ssDNA2: 5′-FAM-ttttttttatttttt-Biotin-3′, SEQ ID NO.

10.

4. A method for rapid detection of chestnut blight pathogen, characterized in that: The following steps are involved: (1) extracting genomic DNA of chestnut blight pathogen to obtain genomic DNA of chestnut blight pathogen; (2) First, a PCR amplification reaction was performed using the extracted chestnut blight pathogen genomic DNA as a template; then, the PCR amplification product was ligated with the T vector to construct a CpSge1-T-Vector plasmid, referred to as Cp-T plasmid, wherein the primers for the PCR amplification reaction were CpSge1-5F and CpSge1-5R, and the sequences of the primers CpSge1-5F and CpSge1-5R were: SEQ ID NO.5, SEQ ID NO.6, respectively; (3) using the Cp-T plasmid constructed in step (2) as a template, performing isothermal amplification using a RAA nucleic acid amplification kit to obtain a RAA amplification product Cp-RAA, wherein the primers for RAA isothermal amplification are Cp-RAA-5F and Cp-RAA-5R, wherein the sequences of the primers Cp-RAA-5F and Cp-RAA-5R are SEQ ID NO.3 and SEQ ID NO.4, respectively; (4) The RAA amplification product is fully mixed with gRNA primer, Cas12a protein, NEBuffer2.1 buffer, probe ssDNA and nuclease-free water, incubated, and CRISPR / Cas12a fluorescent cleavage reaction is performed to obtain CRISPR / Cas12a fluorescent cleavage reaction products, wherein the gRNA primer is selected as gRNA1 or gRNA2, wherein the sequence of gRNA1 or gRNA2 is SEQ ID NO.1 and SEQ ID NO.2, respectively; (5) Determine the fluorescent signal of the CRISPR / Cas12a fluorescent cleavage reaction product, and determine whether chestnut blight pathogenic bacteria are present based on the presence or absence of the fluorescent signal. When the fluorescent signal is detected, it indicates that chestnut blight pathogenic bacteria are present, otherwise it is not present.

5. The method according to claim 4, characterized in that The probe-ssDNA described in step (4) is the ssDNA1 probe of chestnut blight pathogen used for visualized fluorescence detection or the ssDNA2 probe of chestnut blight pathogen used for Cas12 / 13 special nucleic acid detection test strip detection, wherein: the ssDNA1 probe sequence is SEQ ID NO.11; the ssDNA2 probe sequence is SEQ ID NO.

10.

6. Use of the kit as described in any one of claims 1 to 3 in detecting chestnut blight pathogen.

Images