Complex and preparation method and application thereof

Abstract

This disclosure describes a complex, its preparation method, and its application. The complex is a mesenchymal stem cell exosome modified with a nucleic acid aptamer that can specifically recognize beta cells. Applications include using the complex in the preparation of a reagent for improving pancreatic islet function in diabetic patients and in the preparation of a reagent for inhibiting ferroptosis of beta cells. According to this disclosure, a complex for improving pancreatic islet function in diabetic patients, its preparation method, and its application can be provided.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a complex and a preparation method and application thereof. Background Art

[0002] Diabetes mellitus is a metabolic disease characterized by hyperglycemia due to deficient insulin secretion or impaired insulin action. Among diabetic patients, type 2 diabetes mellitus (T2DM) predominates, accounting for over 90%. Type 2 diabetes is a chronic disease characterized by elevated blood sugar levels due to insufficient insulin secretion and / or insulin resistance (a decrease in the body's sensitivity to insulin and its inability to effectively utilize it) caused by genetic and / or environmental factors. Significant changes in lifestyle and the environment have made T2DM a global health concern.

[0003] Human pancreatic islets consist of A cells (α cells) and B cells (β cells). α cells account for approximately 20% of pancreatic islet cells and secrete glucagon, which strongly promotes glycogenolysis and gluconeogenesis, significantly increasing blood sugar. β cells account for 60% to 70% of pancreatic islet cells and secrete insulin, the only hormone in the body that can lower blood sugar. Research suggests that a decrease in β cell number is a key factor in the development and progression of diabetes.

[0004] Mesenchymal stem cell-derived exosomes (MSC-EXO) have the potential to become a cell-free therapy for the treatment of type 2 diabetes (T2DM). However, the precise effects and mechanisms by which MSC-EXOs influence β-cell function remain unclear, hindering their clinical application. Furthermore, their limited ability to target the pancreas may also affect their therapeutic efficacy. Summary of the Invention

[0005] The present disclosure is made in view of the above-mentioned state of the prior art, and its purpose is to provide a complex that can specifically target pancreatic β cells, and a preparation method and application thereof.

[0006] To this end, the first aspect of the present disclosure provides a complex comprising mesenchymal stem cell exosomes modified with nucleic acid aptamers that can specifically recognize β cells. In the present disclosure, the complex comprises mesenchymal stem cell exosomes modified with nucleic acid aptamers that can specifically recognize β cells. The nucleic acid aptamers that can specifically recognize β cells can facilitate better targeting of the mesenchymal stem cell exosomes to β cells, thereby better exerting the function of the mesenchymal stem cell exosomes.

[0007] In the complex of the first aspect of the present disclosure, the complex further comprises cholesterol-polyethylene glycol-maleimide, and the aptamer and the mesenchymal stem cell exosomes are linked via the cholesterol-polyethylene glycol-maleimide to form the complex. Thus, the cholesterol-polyethylene glycol-maleimide enables the aptamer and the mesenchymal stem cell exosomes to be linked, and the polyethylene glycol can increase the blood circulation time of the complex, thereby facilitating the mesenchymal stem cells to function better.

[0008] In the complex of the first aspect of the present disclosure, the sequence of the nucleic acid aptamer is SEQ ID NO. 1. Thus, a nucleic acid aptamer that can specifically recognize β cells can be provided.

[0009] In the complex of the first aspect of the present disclosure, the complex is used to improve pancreatic islet function in diabetic patients. The present disclosure has determined through in vivo and in vitro studies that mesenchymal stem cell exosomes can improve pancreatic islet function, thereby facilitating the clinical application of mesenchymal stem cells.

[0010] In the complex of the first aspect of the present disclosure, the complex improves pancreatic islet function by inhibiting β-cell ferroptosis. Through in vivo and in vitro studies, the present disclosure confirms that mesenchymal stem cell exosomes can improve pancreatic islet function by inhibiting β-cell ferroptosis, thereby facilitating the clinical application of mesenchymal stem cells.

[0011] In the complex of the first aspect of the present disclosure, the complex inhibits β-cell ferroptosis by acting on NRF2. The present disclosure has experimentally determined that mesenchymal stem cell exosomes inhibit β-cell ferroptosis by acting on NRF2, thereby facilitating the clinical application of mesenchymal stem cells.

[0012] In the complex of the first aspect of the present disclosure, the complex inhibits β-cell ferroptosis by activating the AKT signaling pathway and the ERK signaling pathway. The present disclosure has experimentally determined that mesenchymal stem cell exosomes inhibit β-cell ferroptosis by activating the AKT signaling pathway and the ERK signaling pathway, thereby facilitating the clinical application of mesenchymal stem cells.

[0013] A second aspect of the present disclosure provides a method for preparing a complex, comprising: replacing the 3'-terminal group of a nucleic acid aptamer that specifically recognizes β cells with a thiol group to obtain a nucleic acid aptamer-SH; and mixing the nucleic acid aptamer-SH, cholesterol-polyethylene glycol-maleimide, and mesenchymal stem cell exosomes to form nucleic acid aptamer-modified mesenchymal stem cell exosomes that specifically recognize β cells, i.e., the complex. In this manner, the complex can be prepared.

[0014] A third aspect of the present disclosure provides a use of a complex in the preparation of a reagent for improving pancreatic islet function in diabetic patients, wherein the complex comprises mesenchymal stem cell exosomes modified with a nucleic acid aptamer that specifically recognizes β cells. Thus, the complex can be used to improve pancreatic islet function in diabetic patients.

[0015] A fourth aspect of the present disclosure provides a use of a complex in the preparation of a reagent for inhibiting ferroptosis of β cells, wherein the complex is a mesenchymal stem cell exosome modified with a nucleic acid aptamer that can specifically recognize β cells. Thus, a use of the complex in inhibiting ferroptosis of β cells can be provided.

[0016] According to the present disclosure, a complex for improving pancreatic islet function in diabetic patients, and a preparation method and application thereof can be provided. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 A schematic diagram of the construction process of the complex involved in the examples of the present disclosure is shown.

[0018] Figure 2 Schematic diagram of transmission electron microscopy of mesenchymal stem cell exosomes and complexes according to examples of the present disclosure.

[0019] Figure 3 Graphs showing the diameter measurement results of mesenchymal stem cell exosomes and complexes according to examples of the present disclosure.

[0020] Figure 4 Graphs showing the zeta potential of mesenchymal stem cell exosomes and complexes according to examples of the present disclosure are shown.

[0021] Figure 5 The figure shows the results of immunoblotting analysis of mesenchymal stem cell exosomes and complexes involved in the examples of the present disclosure.

[0022] Figure 6 A graph showing the fluorescence detection results of the complex involved in the examples of the present disclosure is shown.

[0023] Figure 7 A schematic diagram showing the results of mesenchymal stem cell exosomes improving blood sugar according to the examples of the present disclosure.

[0024] Figure 8 A schematic diagram showing that mesenchymal stem cell exosomes according to an example of the present disclosure improve the ratio of pancreatic islet cells.

[0025] Figure 9 A schematic diagram showing the mesenchymal stem cell exosomes involved in the examples of the present disclosure inhibiting ferroptosis in vitro.

[0026] Figure 10A schematic diagram showing that mesenchymal stem cell exosomes according to the examples of the present disclosure inhibit ferroptosis in vivo.

[0027] Figure 11 A schematic diagram showing that mesenchymal stem cell exosomes according to the examples of the present disclosure inhibit cell ferroptosis through NRF2.

[0028] Figure 12 A schematic diagram of the KEGG pathway analysis structure of mesenchymal stem cell exosomes involved in the examples of the present disclosure is shown.

[0029] Figure 13 A schematic diagram showing the AKT and ERK levels after intervention with mesenchymal stem cell exosomes according to the examples disclosed herein.

[0030] Figure 14 A schematic diagram showing how the inhibition of AKT and ERK signaling pathways weakens the ferroptosis-inhibiting effect of mesenchymal stem cell exosomes according to an example of the present disclosure.

[0031] Figure 15 Schematic diagram showing that the complexes according to the disclosed examples exhibit better cellular uptake in vitro.

[0032] Figure 16 Schematic diagram showing that the complexes according to the disclosed examples exhibit better uptake in vivo.

[0033] Figure 17 A schematic diagram showing a complex according to an example of the present disclosure having a longer blood circulation time.

[0034] Figure 18 A schematic diagram showing that the complex according to the disclosed examples improves blood sugar and insulin levels.

[0035] Figure 19 A schematic diagram showing that the complex according to an example of the present disclosure improves the distribution of pancreatic islet cells. DETAILED DESCRIPTION

[0036] The preferred embodiments of the present disclosure are described in detail below with reference to the accompanying drawings. In the following description, identical components are assigned identical reference numerals, and duplicate descriptions are omitted. In addition, the accompanying drawings are merely schematic, and the proportions of the dimensions of the components and the shapes of the components may differ from the actual ones.

[0037] It should be noted that the terms "including" and "having" and any variations thereof in the present invention, such as a process, method, system, product or device that includes or has a series of steps or units are not necessarily limited to those steps or units clearly listed, but may include or have other steps or units that are not clearly listed or are inherent to these processes, methods, products or devices.

[0038] In addition, the subheadings and the like in the following description of the present invention are not intended to limit the content or scope of the present invention, but are merely provided as a guide for reading. Such subheadings should not be understood as dividing the content of the article, nor should the content under the subheadings be limited to the scope of the subheadings.

[0039] In a first aspect, the present disclosure provides a complex. The complex may be a mesenchymal stem cell exosome modified with a nucleic acid aptamer that can specifically recognize β cells. In the present disclosure, the complex is a mesenchymal stem cell exosome modified with a nucleic acid aptamer that can specifically recognize β cells. The nucleic acid aptamer that can specifically recognize β cells can help the mesenchymal stem cell exosomes better target β cells, thereby better exerting the function of the mesenchymal stem cell exosomes.

[0040] In the present disclosure, mesenchymal stem cell exosomes (MSC-EXO) are secreted and released by mesenchymal stem cells (MSC), spread in body fluids such as blood, and can finally be phagocytosed by other cells. They are important mediators of intercellular communication.

[0041] The present disclosure determines the effects and mechanisms of mesenchymal stem cell exosomes and complexes in improving pancreatic islet function through in vivo and in vitro studies, thereby facilitating the clinical application of mesenchymal stem cells and complexes.

[0042] In some examples, the sequence of the nucleic acid aptamer can be CAACAAACUAAUCAGACACGAGACAGAGAGAUAGAUCUGCCAGA (SEQ ID NO. 1). Thus, a nucleic acid aptamer that can specifically recognize β cells can be provided.

[0043] In some examples, the mesenchymal stem cells may be at least one of umbilical cord mesenchymal stem cells and bone marrow mesenchymal stem cells. In other words, the mesenchymal stem cells may be derived from umbilical cord tissue and / or bone marrow tissue.

[0044] In some examples, a method for preparing mesenchymal stem cell exosomes includes: providing umbilical cord tissue from a newborn and dividing the umbilical cord tissue; culturing the divided umbilical cord tissue in a culture medium containing 10% fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin until the cells reach 80% confluency; switching to a culture medium without exosomes for 36 to 60 hours, performing a first centrifugation to obtain a supernatant; and performing a second centrifugation of the supernatant to obtain a precipitate to obtain mesenchymal stem cell exosomes. In this manner, mesenchymal stem cell exosomes can be prepared.

[0045] In some examples, the first centrifugation can be performed at 300g for 10 minutes, followed by centrifugation of the supernatant at 2000g for 20 minutes. In some examples, the second centrifugation can be performed at 120,000g for 70 minutes. This facilitates the removal of cells and cell debris, thereby improving the purity of mesenchymal stem cell exosomes.

[0046] In some cases, both mesenchymal stem cell exosomes and the complexes were able to improve pancreatic islet function.

[0047] Ferroptosis is a newly discovered, unique form of non-programmed cell death characterized by intracellular iron overload leading to lipid peroxidation, which in turn causes cell membrane rupture and cell death. In some cases, the mesenchymal stem cell exosomes in the complex improve pancreatic islet function by inhibiting ferroptosis in β cells. The nucleic acid aptamers in the complex, which specifically recognize β cells, can help the mesenchymal stem cell exosomes better target β cells, thereby enhancing their function. In other words, the complex can improve pancreatic islet function by inhibiting ferroptosis in β cells.

[0048] In some examples, the complex's mesenchymal stem cell exosomes inhibit β-cell ferroptosis by acting on NRF2. This disclosure, through experimental studies, has determined that mesenchymal stem cell exosomes inhibit β-cell ferroptosis by acting on NRF2, which may facilitate the clinical application of the complex and mesenchymal stem cells. In some examples, the complex can inhibit β-cell ferroptosis by acting on NRF2 (Nuclear factor E2 related factor 2).

[0049] In some examples, the mesenchymal stem cell exosomes of the complex inhibit ferroptosis of beta cells by activating the AKT signaling pathway and the ERK signaling pathway. The present disclosure has determined through experimental studies that mesenchymal stem cell exosomes inhibit ferroptosis of beta cells by activating the AKT signaling pathway and the ERK signaling pathway, thereby facilitating the clinical application of the complex and mesenchymal stem cells. In some examples, the complex can inhibit ferroptosis of beta cells by activating the AKT signaling pathway and the ERK signaling pathway.

[0050] A second aspect of the present disclosure provides a method for preparing a composite (hereinafter sometimes referred to as “preparation method”).

[0051] In some examples, the preparation method may include: providing a nucleic acid aptamer that can specifically recognize β cells, cholesterol-polyethylene glycol-maleimide, and mesenchymal stem cell exosomes; replacing the group at the 3' end of the nucleic acid aptamer with a thiol group to obtain a nucleic acid aptamer-SH; mixing the nucleic acid aptamer-SH, cholesterol-polyethylene glycol-maleimide, and mesenchymal stem cell exosomes to form a complex. In this way, a complex can be prepared. In the present disclosure, the complex is a mesenchymal stem cell exosome modified with a nucleic acid aptamer that can specifically recognize β cells. The nucleic acid aptamer that can specifically recognize β cells can help the mesenchymal stem cell exosomes better target β cells, thereby better exerting the function of the mesenchymal stem cell exosomes. In addition, polyethylene glycol can help increase the blood circulation time of the complex, thereby helping the mesenchymal stem cells to better function.

[0052] A third aspect of the present disclosure provides a use of a complex in preparing a reagent for improving pancreatic islet function in diabetic patients. Thus, a use of a complex in improving pancreatic islet function in diabetic patients can be provided.

[0053] A fourth aspect of the present disclosure provides a use of a complex in preparing a reagent for inhibiting ferroptosis of β cells. Thus, a use of a complex in inhibiting ferroptosis of β cells can be provided.

[0054] In some examples, the agents for improving pancreatic islet function in diabetic patients or inhibiting ferroptosis of β cells described herein can be pharmaceutical compositions comprising mesenchymal stem cell exosomes and pharmaceutically acceptable excipients. In some examples, the excipients can be at least one of a diluent, an excipient, a binder, a filler, a solubility aid, a sustained-release agent, a flavoring agent, and a sweetener.

[0055] In some examples, the agent for improving islet function in diabetic patients or the agent for inhibiting ferroptosis of beta cells according to the present disclosure may be administered by injection. In some examples, the administration method may also be selected based on actual clinical needs.

[0056] In some examples, the dosage form of the agent for improving pancreatic islet function in diabetic patients or the agent for inhibiting ferroptosis of beta cells involved in the present disclosure can be at least one of a suspension, tablet, powder, emulsion, solution, or injection. This makes it easy to select different dosage forms according to actual needs.

[0057] Below, in conjunction with the examples, the complex obtained by modifying mesenchymal stem cell exosomes with nucleic acid aptamers that can specifically recognize β cells, the preparation method of the complex, and the application of the complex are further explained in detail. However, these examples should not be construed as limiting the scope of protection of the present disclosure.

[0058] Example

[0059] Cell culture and treatment:

[0060] The Ethics Committee of Qilu Hospital of Shandong University approved the collection of fresh umbilical cords from healthy newborns, and consent was obtained from all participants after providing them with necessary information. Subsequently, blood vessels were extracted from the umbilical cords, and Wharton's jelly was broken into fine fragments. The fragments were then cultured in culture medium containing 10% fetal bovine serum (FBS; Gibco), 100 U / mL penicillin, and 100 μg / mL streptomycin (Gibco). When hucMSCs (human umbilical cord mesenchymal stem cells) reached 80% confluence in culture, flow cytometric analysis and differentiation induction were performed at the third to fifth passages of human umbilical cord mesenchymal stromal cells. Cells were grown in RPMI 1640 solution (Gibco) supplemented with 15% FBS (fetal bovine serum), 10 mM HEPES (4-hydroxyethylpiperazineethanesulfonic acid), 1 mM sodium pyruvate, 2 mM L-glutamine, and 50 μM β-mercaptoethanol at 37°C in an atmosphere of 5% CO2. Cells were plated in six-well plates and grown in medium containing 33.3 mM glucose (high glucose, or HG) for 48 hours. Subsequently, cells were exposed to hucMSC exosomes (MSC-EXO) or a ferroptosis inhibitor (Fer-1, 10 μM, Selleck) at a concentration of 25 μg / mL for 24 hours. To explore the mechanism of action of MSC-EXO, small interfering RNA (siRNA) was transfected into INS-1 cells using Lipofectamine 2000 transfection reagent (Invitrogen) before MSC-EXO treatment. INS-1 cells were then treated with MSC-EXO for 24 hours along with an AKT inhibitor (LY294002, 10 μM, MCE) or an ERK inhibitor (PD98059, 10 μM, MCE). MIN-6 cells were grown in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum and 100 μg / mL L-glutamine.

[0061] Isolation of exosomes, construction and identification of Apt-EXO:

[0062] After replacing hucMSC culture medium with exosome-depleted medium for 48 hours, the culture medium was collected. To remove cells, apoptotic bodies, and cellular debris, the conditioned medium underwent a series of centrifugation steps. Specifically, it was first spun at 300 g for 10 minutes, followed by centrifugation at 2000 g for 20 minutes. The supernatant was then passed through a 0.22 μm filter. To obtain exosomes, the remaining medium was centrifuged at 120,000 g for 70 minutes at 4°C.

[0063] Aptamers were linked to MSC-EXO to prepare the complex: 200 nM thiol- and cy3-labeled aptamers (Sangon) were reduced on ice for 30 minutes with TCEP (tris(2-carboxyethyl)phosphine), a disulfide bond reducing agent. Subsequently, the cells were incubated with cholesterol-polyethylene glycol-maleimide (chol-PEG-mal) in HEPES buffer overnight. Excess cholol-polyethylene glycol-maleimide (chol-PEG-mal) was filtered at 8000 g for 15 minutes with a molecular weight cutoff (MWCO) of 5000. Subsequently, 200 nM cy3-aptamer-PEG-chol was added to 1.0 mg / ml MSC-EXO in PBS and incubated overnight at 4°C. Unbound aptamers were removed by washing three times in PBS using a 100 kDa ultrafiltration tube. To confirm that the aptamer was successfully coupled to the exosome membrane, the fluorescence intensity of the cy3-aptamer exosomes was detected using a microplate reader. Figure 1 The figure shows a schematic diagram of the construction process of the complex involved in the examples of the present disclosure. The 3' end of the aptamer has a thiol group, which can undergo a Michalel reaction with the maleimide group in cholesterol-polyethyleneimide-maleimide (cholesterol-PEG-mal). In addition, the cholesterol group at the other end can attach to the exosome membrane, resulting in the binding of the aptamer to the exosome and the formation of the complex Apt-EXO ( Figure 4 ).

[0064] To identify exosomes (MSC-EXO) and complexes (Apt-EXO), transmission electron microscopy (TEM), nanoparticle tracking assay (NTA), zeta potential, and western blotting were used to analyze their structure, size, and protein composition.

[0065] Figure 2 A transmission electron microscopy diagram of the mesenchymal stem cell exosomes and complexes involved in the examples of the present disclosure is shown, showing that the mesenchymal stem cell exosomes and complexes are cup-shaped membrane structures. Figure 3 The diameter measurement results of the mesenchymal stem cell exosomes and complexes involved in the examples of the present disclosure are shown in the figure. The results show that the diameter of the colorectal stem cell exosomes is about 130 nanometers, and the cup-shaped membrane structure and approximate diameter of the complex are about 13 nanometers. Figure 4 The zeta potential diagram of the mesenchymal stem cell exosomes and the complex involved in the examples of the present disclosure is shown. Compared with the mesenchymal stem cell exosomes, the zeta potential of the complex modified with the aptamer is reduced. Figure 5The figure shows the results of immunoblotting analysis of mesenchymal stem cell exosomes and complexes involved in the examples of the present disclosure, which shows that the mesenchymal stem cell exosomes and complexes are positive for exosomal markers (including CD9, TSG101 and HSP70).

[0066] To confirm whether chemical binding occurred, exosomes were incubated with Cy3-labeled aptamers in the presence and absence of cholesterol-PEG-MAL, and the Cy3 fluorescence intensity emitted by the exosomes was measured. Figure 6 The fluorescence detection results of the complex involved in the example of the present disclosure are shown in the figure. The results show that the fluorescence signal of the cholesterol-peg-Mal group is significantly higher than that of the cholesterol-peg-Mal group, indicating that the PEGylated aptamer is successfully coupled to the exosome membrane.

[0067] Constructing animal models:

[0068] C57BL / 6J mice (Jiangsu Huachuang Chinese Medicine Technology Co., Ltd.) were acclimated for 12 weeks after a 1-2 week acclimation period and then fed a 60% fat high-fat diet (HFD). Control mice consumed a regular chow diet. Subsequently, 60 mg / kg of STZ (streptozotocin) was intraperitoneally injected for 5 consecutive days starting on day 1. T2DM mice were defined as having a fasting blood glucose level ≥16.7 mmol / L. To investigate the effects of MSC-EXO on pancreatic islet function and its underlying mechanisms, mice were divided into three groups: control group + PBS (phosphate-buffered saline), T2DM group + PBS, and T2DM group + MSC-EXO. To investigate the effects of exosomes modified with aptamers (Apt-EXO) on pancreatic islet function, mice were divided into four groups: control group + PBS, T2DM group + PBS, T2DM group + MSC-EXO, and T2DM group + Apt-EXO. Specifically, 200 μl of PBS solution containing 200 μg of MSC-EXO (or Apt-EXO) was injected through the tail vein twice a week for 6 consecutive weeks. The animal experimental protocol was approved by the Animal Ethics Committee of Shandong University.

[0069] Metabolic parameter analysis:

[0070] Body weight and random blood glucose were monitored weekly from the start of MSC-EXO or Apt-EXO treatment until two weeks after the end of the intervention. Blood samples were collected from the internal ophthalmic vein before and 30 minutes after the initiation of an IPGTT test to measure serum insulin levels. Blood glucose levels were measured at the tip of the tail.

[0071] Glucose-stimulated insulin secretion (GSIS):

[0072] INS-1 cells were cultured in KRBS-Ringer's bicarbonate solution (KRBS) containing 2.5 mmol / L glucose at 37°C for 1 hour, and the supernatant was collected. Insulin levels in the collected supernatant were quantified to assess the extent of insulin release after stimulation.

[0073] HE, IHC and IF staining:

[0074] Hematoxylin and eosin (HE) staining followed standard protocols. To inactivate native peroxidase and prevent nonspecific attachment, sections were first soaked in 3% H₂O₂ solution for 15 minutes, followed by incubation with goat serum for 30 minutes. Primary antibodies were then incubated overnight at 4°C. Secondary antibody staining and DAB staining were performed the following day according to the IHC kit's instructions. Antibodies used for immunohistochemistry (IHC) staining included GPX4 (1:200, ab125066, Abcam, USA), p-AKT (Ser473) (1:100, 4060, CST, USA), p-ERK (Thr202 / Tyr204) (1:200, 4370, CST, USA), and ACSL4 (1:100, A20414, ABclonal, China). For immunofluorescence (IF) staining, after antigen retrieval and blocking of nonspecific sites, the following antibodies were used: insulin (1:200, ab181547, Abcam, USA), glucagon (1:200, 67286-1-Ig, Proteintech, China), p-NRF2 (Ser40) (1:200, DF7519, Affinity, China), p-AKT (Ser473) (1:500, 4060, CST, USA), and p-ERK (Thr202 / Tyr204) (1:200, 4370, CST, USA). The following day, the cells were probed with fluorophore-conjugated secondary antibodies (ZSGB-Bio, China) at 37°C for one hour. After DAPI staining, fluorescence microscopy images were captured.

[0075] Western blotting:

[0076] Proteins were extracted using lysis buffer and separated by SDS-PAGE (polyacrylamide gel electrophoresis). After transferring the proteins to a PVDF membrane, the membrane was blocked and incubated with primary antibodies overnight, followed by horseradish peroxidase-conjugated secondary antibodies (ZSGB-Bio) the following day. The antibodies used for Western blotting were as follows: GAPDH (1:2000, 60004-1-Ig, Proteintech), Calnexin (1:1000, 10427-2-AP, Proteintech), CD9 (1:1000, 60232-1-Ig, Proteintech), TSG101 (1:1000, 28283-1-AP, Proteintech), HSP70 (1:1000, ab5439, Abcam, USA), NRF2 (1:1000, AF0639, Affinity), p-NRF2 (Ser40) (1:1000, DF7519, Affinity), KEAP1 (1:1000, TA5266, Abmart), GPX4 (1:200, ab125066, Abcam), HO-1 (1:1000, T55113, Abmart), SLC7A11 (1:1000, A2413, ABclonal), ITGA5 (1:1000, A19069, ABclonal), ITGB3 (1:1000, A19073, ABclonal), HRAS (1:1000, A7901, ABclonal) ), RAP1A (1:RAP1B (1:1000, A12925, ABclonal), AKT (1:1000, 4691, CST), p-AKT (Ser473) ( 1:1000, 4060, CST), ERK (1:1000, 4695, CST), p-ERK (Thr202 / Tyr204) (1:1000, 4370, CST).

[0077] Transmission Electron Microscopy (TEM):

[0078] The pancreas was treated with 2.5% electron microscopy grade glutaraldehyde solution, and then the cells were fixed, dehydrated, embedded, sectioned and stained. Finally, the samples were observed using a transmission electron microscope.

[0079] CCK-8 test:

[0080] After INS-1 cells were treated with Fer-1 (10 μM, a ferroptosis inhibitor), Z-VAD (10 μM, a pan-caspase inhibitor), and Nec-1 (10 μM, a necroptosis inhibitor) exposed to high glucose (HG), the culture medium was replaced with CCK-8 working solution containing 10% CCK-8 reagent. The absorbance of each well was then measured at 450 nm using a microplate reader.

[0081] Iron content measurement:

[0082] Total intracellular iron content was measured using an iron assay kit, and ferrous iron content in pancreatic tissue was measured using a ferrous iron assay kit. The experimental protocol was performed in strict accordance with the manufacturer's guidelines.

[0083] MDA (malondialdehyde) measurement:

[0084] MDA levels in serum and pancreatic tissue were assessed using a lipid peroxidation MDA assay kit, while the cell lipid peroxidation MDA assay kit was used to analyze MDA levels in cells. MDA was determined by reacting MDA with thiobarbituric acid.

[0085] Chromatin immunoprecipitation (ChIP):

[0086] INS-1 cells were treated with 1% formaldehyde to induce cross-linking, fragmented into 150-900 bp fragments, and then incubated with an anti-NRF2 antibody (CST, 12721) or a standard IgG antibody overnight at 4°C. Finally, the cells were attached using magnetic beads. ChIP assays were performed strictly according to the manufacturer's instructions. Finally, RT-qPCR was used to assess the enrichment of specific DNA sequences.

[0087] Quantitative reverse transcription PCR (qRT-PCR):

[0088] Total RNA from INS-1 cells was obtained using an RNA extraction kit and then reverse transcribed using the EvoM-MLVRT kit.

[0089] C11-BODIPY staining:

[0090] To assess lipid peroxidation in cells, a C11-BODIPY probe (D3861, Invitrogen, USA) was used. INS-1 cells were incubated with 5 μmol / L C11-BODIPY solution for 30 minutes, then stained with Hoechst dye (C1027, Biostime, China) for 10 minutes. The stained cells were observed using a confocal scanning microscope.

[0091] TUNEL (TdT-mediated dUTP nick end labeling) test:

[0092] TUNEL assay was performed using a TUNEL assay kit and strictly followed the provided instructions to assess cell death in INS-1 cells. Fluorescence images were taken using a fluorescence microscope.

[0093] Exosome cellular internalization experiment:

[0094] In in vitro studies, MSC-EXO and Apt-EXO were labeled with DIO cell labeling solution. Flow cytometry was used to determine the uptake efficiency of exosomes in MIN-6 cells, and fluorescence imaging was used to analyze the uptake of exosomes in mouse pancreas.

[0095] Biodistribution imaging:

[0096] Distribution analysis involved taking whole-body photographs at 2, 6, and 12 hours, and dissecting the pancreas, liver, spleen, lungs, kidneys, and heart 12 hours later for fluorescence imaging. Distribution images were acquired using a fluorescence tomography in vivo imaging system.

[0097] Proteomic data analysis:

[0098] Raw proteomic data for MSC-EXO were downloaded from ProteomeXchange with the identifier PXD033899. Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis was performed using the R package clusterProfiler, with a significance threshold of P < 0.05. Pathway bubble plots were generated using the ggplot2 package, R version 4.2.2. Significant differentially expressed genes (DEGs) were aligned with the STRING database, and protein-protein interaction (PPI) network analysis was performed using a confidence threshold greater than 0.4. Network visualization was performed using Cytoscape software (v3.9.1).

[0099] Statistical analysis:

[0100] Data are presented as mean ± SEM. Paired Student's t-test or one-way analysis of variance was performed using GraphPad Prism 9 software to assess differences between groups. Statistical significance was considered at a significance level of less than 0.05.

[0101] Unless otherwise specified, the reagents, materials, instruments, and software used in this example are all commercially available products.

[0102] Analysis of experimental results:

[0103] (1) Mesenchymal stem cell exosomes can improve pancreatic islet function

[0104] Figure 7 The figure shows the results of improving blood sugar by mesenchymal stem cell exosomes according to the examples disclosed herein. Figure 7 As shown in the results, random blood glucose levels in mice treated with mesenchymal stem cell exosomes (MSC-EXO) were significantly reduced, and T2DM mice lost weight. T2DM mice treated with MSC-EXO showed significant improvements in glucose tolerance, insulin sensitivity, and insulin secretion 30 minutes after IPGTT. Figure 8 Schematic diagram showing the improvement of pancreatic islet cell ratio by mesenchymal stem cell exosomes according to the examples disclosed herein. Figure 8 As shown, the size of pancreatic islets and pancreatic beta cells in T2DM mice was significantly reduced compared to normal controls. T2DM mice also had a lower proportion of insulin-positive cells and a higher proportion of glucagon-positive cells. Administration of mesenchymal stem cell exosomes reversed the loss of insulin-positive cells.

[0105] In summary, mesenchymal stem cell exosomes can improve pancreatic islet function.

[0106] (2) Mesenchymal stem cell exosomes can inhibit β-cell ferroptosis

[0107] Figure 9 A schematic diagram showing the mesenchymal stem cell exosomes involved in the examples of the present disclosure inhibiting ferroptosis in vitro is shown. Figure 10 Schematic diagram showing the inhibition of ferroptosis in vivo by mesenchymal stem cell exosomes according to the examples disclosed herein. Figure 9 As shown, INS-1 cells were subjected to CCK-8 assay to evaluate the effects of programmed cell death inhibitors on cell activity, including Z-VAD-FMK (apoptosis inhibitor), Fer-1 (ferrostatin-1, cell iron death inhibitor) and Nec-1 (necroptosis inhibitor). Compared with other inhibitors, Fer-1 had the most significant effect in maintaining cell viability. In addition, GSIS test showed that HG had the harmful effect of reducing insulin secretion in INS-1 cells, however, both Fer-1 intervention and MSC-EXO treatment effectively improved this harmful effect. Subsequently, the morphological and biochemical indicators related to cell iron death were detected, and the results showed that Fer-1 intervention and MSC-EXO intervention could significantly inhibit the upregulation of MDA and total iron concentration induced by HG in cells. As Figure 10As shown, testing for ferroptosis-related markers in T2DM mice revealed significantly elevated MDA levels in both serum and pancreas. However, these levels decreased significantly after MSC-EXO treatment. Similar results were also observed in testing for ferrous iron content. Transmission electron microscopy revealed a decrease or absence of mitochondrial spines in the T2DM group, and MSC-EXO treatment was able to mitigate this decrease or absence.

[0108] These results indicate that MSC-EXO can inhibit ferroptosis of β cells both in vivo and in vitro.

[0109] (3) NRF2 plays an important role in the anti-ferroptosis effect of MSC-EXO

[0110] Figure 11 A schematic diagram showing the inhibition of ferroptosis by NRF2 in mesenchymal stem cell exosomes according to the disclosed examples. Analysis showed that MSC-EXO treatment enhanced the expression of NRF2, p-NRF2, and HO-1, increased the mRNA expression of SLC7A11 and HO-1, while the expression of KEAP1 was not affected ( Figure 11 Before translocating to the nucleus, NRF2 is phosphorylated at Ser40 (which serves as a binding site for KEAP1). Therefore, the NRF2-Ser40 (p-NRF2) antibody can be used to quantify the proportion of nuclear NRF2. This indicates that MSC-EXO increased the expression, nuclear translocation, and transcriptional activity of NRF2, but did not regulate NRF2 through the KEAP1 pathway. By immunofluorescence staining, it was found that MSC-EXO could reverse the decrease in phosphorylated NRF2 levels in pancreatic cells of T2DM mice ( Figure 11 Subsequently, we introduced NRF2 siRNA into INS-1 cells, and Western blot results showed that NRF2 knockout led to the reversal of NRF2 translocation into the nucleus and the reduction of HO-1, GPX4, and SLC7A11 translocation ( Figure 11 Meanwhile, NRF2 inhibition can reduce lipid peroxidation caused by MSC-EXO and improve cell death ( Figure 11 Finally, ChIP assays using INS-1 cells showed that MSC-EXO treatment significantly promoted the recruitment of NRF2 to GPX4 and SLC7A11, indicating that NRF2 directly binds to this chromatin region ( Figure 11 H and I parts).

[0111] The above results indicate that NRF2 is the key target of MSC-EXO in inhibiting cell ferroptosis.

[0112] (4) AKT and ERK pathways are involved in the NRF2-mediated anti-ferroptosis effect of MSC-EXO

[0113] The proteomic data of MSC-EXO were analyzed to identify the active proteins related to the ferroptosis inhibition effect of MSC-EXO. Figure 12 The figure shows the KEGG pathway analysis structure diagram of the mesenchymal stem cell exosomes involved in the examples of the present disclosure. Figure 12 As shown in the figure, KEGG pathway analysis showed that exosomal proteins were enriched in the PI3K-AKT and MAPK signaling pathways. Figure 13 Figure 2 shows a schematic diagram of AKT and ERK levels after intervention with mesenchymal stem cell exosomes according to the disclosed examples. To determine whether MSC-EXO activates AKT and ERK signaling pathways in vitro and in vivo, IHC staining and IF staining were performed. IHC staining results confirmed that MSC-EXO led to increased AKT phosphorylation and ERK phosphorylation levels in T2DM mice ( Figure 13 In addition, MSC-EXO treatment can lead to increased levels of p-AKT and p-ERK in INS-1 cells ( Figure 13 ). Taken together, these results suggest that AKT and ERK signaling pathways may be involved in NFR2-mediated inhibition of ferroptosis.

[0114] Subsequently, MSC-EXOs were simultaneously injected into INS-1 cells with LY294002 (AKT inhibitor) or PD98059 (ERK inhibitor). Figure 14 Schematic diagram showing the inhibition of AKT and ERK signaling pathways involved in the present disclosure to weaken the inhibitory effect of mesenchymal stem cell exosomes on cell ferroptosis. The results showed that LY294002 and PD98059 inhibited the phosphorylation of AKT and ERK by MSC-EXO ( Figure 14 Western blot analysis showed that MSC-EXO could enhance the expression of NRF2 and p-NRF2, as well as the expression of anti-ferroptosis proteins GPX4 and SLC7A11 ( Figure 14 LY294002 and PD98059 abolished the effects of MSC-EXO treatment, including decreased lipid peroxidation and a decreased proportion of TUNEL-positive cells ( Figure 14 B, C and D of the .

[0115] These results indicate that MSC-EXO plays a controlling role in NRF2-mediated inhibition of ferroptosis through the AKT signaling pathway and the ERK signaling pathway.

[0116] (5) Apt-EXO can specifically target pancreatic β cells both in vivo and in vitro

[0117] Figure 15 Schematic diagram showing that the complexes involved in the examples of the present disclosure exhibit better cellular uptake in vitro. Figure 15 As shown, MIN-6 cells treated with Apt-EXO exhibited greater exosome uptake compared with MIN-6 cells treated with EXO. Figure 16 Schematic diagram showing that the complexes involved in the examples of the present disclosure exhibit better uptake in vivo. DIR-labeled EXO and Apt-EXO were injected into the mouse model through the tail vein and whole-body imaging was performed. 12 hours after the injection, the organs were dissected and fluorescence imaging was performed. Figure 16 As shown, the results showed that the pancreatic fluorescence intensity was significantly greater in the Apt-EXO-treated group compared with the EXO-treated group. Figure 17 Schematic diagram showing the complex involved in the example of the present disclosure having a longer blood circulation time. Figure 17 As shown, blood samples were collected 1, 3, and 6 hours after treatment with DIR-labeled Apt-EXO and EXO, and the fluorescence signal in the blood was detected. The results showed that the blood fluorescence signal of the Apt-EXO treatment group was significantly higher than that of the EXO treatment group.

[0118] The above results indicate that aptamer-modified exosomes have the ability to target pancreatic β cells and have a longer blood circulation time.

[0119] (6) Apt-EXO has better improvement in islet function than EXO

[0120] Figure 18 A schematic diagram showing that the complex according to the disclosed examples improves blood sugar and insulin levels is shown. Figure 19 A schematic diagram showing the improvement of pancreatic islet cell distribution by the complex involved in the examples of the present disclosure. Apt-EXO and EXO were used to intervene in the T2DM mouse model. The results showed that Apt-EXO reduced random glucose to a greater extent than EXO ( Figure 18 The changes in body weight were similar in the two groups ( Figure 18 In addition, the glucose tolerance of T2DM mice treated with Apt-EXO was significantly improved after fasting and IPGTT for 30 minutes ( Figure 18 C and D) and insulin secretion ( Figure 18 Compared with EXO treatment, Apt-EXO treatment significantly improved the islet area ( Figure 18 In addition, there was no significant difference in insulin sensitivity between Apt-EXO treatment and EXO treatment ( Figure 18 Since insulin sensitivity indicates the level of insulin resistance in peripheral organs, this finding is consistent with the fact that Apt-EXO specifically targets pancreatic β cells. Figure 19As shown, HE and IF staining analysis showed that Apt-EXO treatment significantly improved islet area, β-cell area, and the proportion of insulin-positive cells compared with EXO treatment.

[0121] The above results indicate that aptamer-modified MSC-EXO can enhance the improvement effect of MSC-EXO on pancreatic islet function.

[0122] Although the present disclosure has been described in detail above with reference to the accompanying drawings and embodiments, it will be understood that the above description does not limit the present disclosure in any form. Those skilled in the art may modify and change the present disclosure as needed without departing from the spirit and scope of the present disclosure, and such modifications and variations all fall within the scope of the present disclosure.

Claims

1. A complex, characterized in that The complex is a mesenchymal stem cell exosome modified with a nucleic acid aptamer that can specifically recognize β cells. The sequence of the nucleic acid aptamer is SEQ ID NO.

1. The nucleic acid aptamer and the mesenchymal stem cell exosome are connected through cholesterol-polyethylene glycol-maleimide to form the complex.

2. The composite body according to claim 1, characterized in that The complex is used for improving pancreatic islet function in diabetic patients.

3. The composite body according to claim 2, characterized in that The complex improves pancreatic islet function by inhibiting β-cell ferroptosis.

4. The composite body according to claim 3, characterized in that The complex inhibits β-cell ferroptosis by acting on NRF2.

5. The composite body according to claim 4, characterized in that The complex inhibits β-cell ferroptosis by activating the AKT signaling pathway and the ERK signaling pathway.

6. A method for preparing a composite, characterized in that: include: The 3' end group of the nucleic acid aptamer that can specifically recognize β cells is replaced with a thiol group to obtain the nucleic acid aptamer -SH; The nucleic acid aptamer-SH, cholesterol-polyethylene glycol-maleimide and mesenchymal stem cell exosomes are mixed to form nucleic acid aptamer-modified mesenchymal stem cell exosomes that can specifically recognize β cells, that is, the complex. The sequence of the nucleic acid aptamer is SEQ ID NO.

1.

7. Use of a complex in the preparation of a reagent for improving pancreatic islet function in patients with type 2 diabetes, characterized in that: The complex is a mesenchymal stem cell exosome modified with a nucleic acid aptamer that can specifically recognize β cells. The sequence of the nucleic acid aptamer is SEQ ID NO.

1. The nucleic acid aptamer and the mesenchymal stem cell exosome are connected through cholesterol-polyethylene glycol-maleimide to form the complex.

Images