KASP molecular marker for leaf angle trait of watermelon flooding tolerance and its application

Abstract

The present invention discloses a KASP molecular marker for the watermelon flooding-resistant leaf angle trait and its use. The molecular marker LAS obtained by the present invention is a KASP marker for the watermelon flooding-resistant response control leaf angle gene, which can be used to identify the leaf angle size gene of watermelon under flooding conditions and auxiliary breeding of watermelon resistant to flooding. The ZJU087 watermelon, a large leaf angle gene donor under flooding conditions, and the ZJU003 watermelon, a small leaf angle gene donor under flooding conditions, are hybridized, and then backcrossing and selfing are combined with marker-assisted selection. The present invention can replace the phenotypic screening of large-scale flooding adversity treatment, reduce the field workload and the plant loss caused by adversity treatment, and greatly improve the accuracy and efficiency of screening.

Description

Technical Field

[0001] The invention belongs to the technical field of vegetable agronomic trait molecular marker development and molecular marker-assisted breeding, and particularly relates to a KASP molecular marker for a watermelon flooding-resistant leaf angle trait and a use thereof. Background Art

[0002] With the acceleration of global warming and the frequent occurrence of extreme weather, waterlogging has become one of the most serious abiotic adversities that threaten plant growth. In the process of continuous evolution, plants have formed a variety of external morphological and internal structural adaptation mechanisms, such as the elongation of petioles and internodes, changes in leaf and root morphology and anatomical structure, the occurrence of lateral roots and adventitious roots, the formation of aerenchyma in roots, and the formation of radial oxygen loss barriers (Jackson, 2003; Visser and Voesenek, 2005; Bailey-Serres and Voesenek, 2008; Watanabe et al., 2017; Qi et al., 2019; Pederssen et al., 2021).

[0003] In general, the root system of plants is the main part affected by waterlogging. However, in actual production, the waterlogging of the underground parts of plants cannot be observed, while the waterlogging symptoms of the aboveground parts such as stems and leaves are relatively easy to observe. After being completely flooded, some plants accumulate ethylene, cells enlarge, internodes elongate, leaves grow upward, and some tissues extend out of the water, promoting contact between plants and air for gas exchange. This is a common escape mechanism for plants. Leaf angle refers to the angle between adjacent true leaves of a plant or between leaves and stems. Flooding causes differences in the growth of the base of the petiole, resulting in the concave movement of the petiole. The elongation of the submerged petiole depends on the threshold of the petiole angle, which is achieved by low curvature. This process also requires the presence of ethylene and auxin (Cox et al., 2003; 2004). Under flooding conditions, marsh reeds adopt an escape strategy of first changing the direction of the leaves from horizontal to vertical and then rapidly elongating the petiole. The size of the leaf angle can well represent the waterlogging resistance of plants, and has the advantages of being easy to observe and measure, which is of great significance in production.

[0004] Watermelon [Citrullus lanatus (Thunb.) Matsum. & Nakai] is an important economic crop with a wide cultivation area and significant economic benefits.

[0005] Watermelon originated in Africa and is a drought-tolerant crop. It lacks an effective defense mechanism against flooding and is therefore very sensitive to waterlogging. In recent years, watermelon production has suffered from decreased sugar content, rotten melons, and even total crop failure due to waterlogging in the southeastern coastal areas. Waterlogging has become an important factor causing watermelon production reduction and quality decline. Waterlogging-tolerant breeding is one of the effective ways to solve the problems of yield loss and quality decline caused by waterlogging and other crops. However, the lack of efficient and accurate phenotypic evaluation technology for measuring watermelon's waterlogging resistance and the lack of molecular markers available for breeding have seriously restricted the progress of watermelon molecular breeding for waterlogging resistance.

[0006] The references mentioned above are as follows:

[0007] MB JACKSON, et al. (2003) Physiological and molecular basis ofsusceptibility and tolerance of rice plants to complete submergence. AnnalsOf Botany, 91: 227-241.

[0008] EJW VISSER, et al. (2005) Acclimation to soil flooding - sensingand signal-transduction[J]. Plant And Soil, 274: 197-214.

[0009] J. Bailey-Serres, et al. (2008) Flooding Stress: Acclimations andGenetic diversity. Annual Review of Plant Biology, 59:313–319.

[0010] K. Watanabe et al. (2017) A major locus involved in the formation of the radial oxygen loss barrier in adventitious roots of teosinte Zeanicaraguensis is located on the short-arm of chromosome 3. Plant CellEnvironment, 40:304-316.

[0011] X. Qi, et al. (2019) Waterlogging-induced adventitious root formation in cucumber is regulated by ethylene and auxin through reactive oxygenspecies signaling. Plant Cell Environment, 42: 1458–1470.

[0012] COX MCH, BENSCHOP JJ, VREEBURG R a. M, et al. The roles of ethylene, auxin, abscisic acid, and gibberellin in the hyponastic growth ofsubmerged Rumex palustris petioles[J]. Plant Physiology, 2004, 136(2): 2948-2960.

[0013] COX MCH, PEETERS AJM, VOESENEK L. The stimulating effects of ethylene and auxin on petiole elongation and on hyponastic curvature areindependent processes in submerged Rumex palustris[J]. Plant Cell andEnvironment, 2006, 29(2): 282-290. Summary of the invention

[0014] The purpose of the present invention is to provide a KASP molecular marker for the watermelon flooding-resistant leaf angle trait and its use in view of the deficiencies in the prior art. The molecular marker LAS (Leaf Angle Size) obtained by the present invention is a KASP marker for the watermelon flooding-resistant response control leaf angle gene, which can be used for auxiliary breeding of watermelon flooding-resistant and non-waterlogging-resistant watermelons.

[0015] In order to achieve the above object, as a first aspect of the present invention, a KASP molecular marker for watermelon flooding resistance leaf angle trait is provided, which is located at 2463507bp of chromosome 2 of the watermelon genome, and the sequence of the previous and next 50bp is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0016] Furthermore, the KASP molecular marker genotype is G or C; the sequence of 50 bp before and after the G genotype is shown in SEQ ID NO.1, and the corresponding phenotype is waterlogging-tolerant; the sequence of 50 bp before and after the C genotype is shown in SEQ ID NO.2, and the corresponding phenotype is non-waterlogging-tolerant.

[0017] The second aspect of the present invention provides a use of the KASP molecular marker in identifying the leaf angle gene of watermelon under flooding conditions.

[0018] Further, the molecular marker primer is selected from the following primer pair, wherein the nucleotide sequence is 5'-3':

[0019] The forward primer F-HEX is shown in SEQ ID NO.3:

[0020] GAAGGTGACCAAGTTCATGCTTGGCCAGCATGATCATCCTAAAG;

[0021] The forward primer F-FAM is shown in SEQ ID NO.4:

[0022] GAAGGTCGGAGTCAACGGATTTGGCCAGCATGATCATCCTAAAC;

[0023] The reverse primer R is shown in SEQ ID NO.5:

[0024] CATGGTAACGACTCCAACAGC.

[0025] Furthermore, the use of the KASP molecular marker in identifying the leaf angle gene of watermelon under flooding conditions specifically includes the following steps:

[0026] 1) Extract genomic DNA of the watermelon variety to be tested;

[0027] 2) using the KASP molecular marker to perform PCR amplification on watermelon genomic DNA;

[0028] 3) According to the difference in fluorescence signals of the PCR amplification results, the genotype of the watermelon to be tested was identified by Kraken software: blue dots were homozygous CC genotypes; red dots were homozygous GG genotypes; and green dots were heterozygous CG genotypes.

[0029] Furthermore, in step 2), the PCR reaction system used for the PCR amplification is: 5.0 μl of 20-50 ng / μl watermelon genomic DNA, 5.0 μl of KASP Master Mix, and 0.14 μl of KASP Assay Mix; the KASP Assay Mix contains forward primer F-HEX, forward primer F-FAM, and reverse primer R, and the molar concentration ratio of F-HEX:F-FAM:R is 2:2:5, for a total of 10.14 μl; the PCR program is: pre-denaturation at 94°C for 15 minutes; denaturation at 94°C for 20 seconds; annealing at 61°C, -0.6°C / cycle for 60 s, for a total of 10 cycles; denaturation at 94°C for 20 s, annealing at 55°C for 60 s, for 29 cycles.

[0030] The third aspect of the present invention provides a use of the KASP molecular marker in molecular assisted breeding of leaf angles of watermelons under flooding conditions.

[0031] The beneficial effects of the present invention are as follows:

[0032] 1. Early screening: The marker genotype can be detected in advance during the seedling stage to predict the leaf angle phenotype of the plant's resistance to flooding in the later stage.

[0033] 2. Alternative phenotypic screening: Use marker screening to replace phenotypic screening for large-scale flooding stress treatments, reducing field workload and plant losses caused by stress treatments.

[0034] 3. Improve screening efficiency and accuracy: The waterlogging resistance phenotype of plants is the comprehensive result of the interaction between genotype and environment. Screening for waterlogging resistance based on phenotypes will lead to selection errors due to environmental differences. Combining molecular markers to screen genotypes can greatly improve the accuracy and efficiency of screening. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0036] Figure 1 The leaf angle phenotypes of different flooding-resistant materials ZJU003 and ZJU087 after flooding, among which (a) is the plant phenotype of flooding-resistant material ZJU003 (left) and flooding-sensitive material ZJU087 (right) after 14 days of flooding, and (b) is the leaf angle data of ZJU003 and ZJU87 after 14 days of flooding;

[0037] Figure 2This is the marker typing diagram of donor ZJU087 watermelon and donor ZJU003 watermelon (parent typing), in which blue dots represent homozygous CC genotype; red dots represent homozygous GG genotype; green dots represent heterozygous CG genotype; black crosses represent blank controls without samples;

[0038] Figure 3 This is the LAS marker typing diagram of the hybrid offspring of donor ZJU087 watermelon and donor ZJU003 watermelon; among them, blue dots represent homozygous CC genotype; red dots represent homozygous GG genotype; green dots represent heterozygous CG genotype; black crosses represent blank controls with no samples. DETAILED DESCRIPTION

[0039] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0040] Example 1: Identification of leaf angles of watermelon after flooding

[0041] The leaf angle of 178 watermelon materials was identified after the semi-flooding treatment (water covered the soil surface by 3 cm) was selected. The plants were photographed 14 days after flooding, and the angle was measured using image J software. The measured angle was the angle between the first and second true leaves, which is the leaf angle.

[0042] The identification of watermelon waterlogging leaf angles showed that ZJU87 had a large leaf angle and poor waterlogging resistance, while ZJU003 had a small leaf angle and good waterlogging resistance. Figure 1 .

[0043] Example 2: Positioning of the major QTL for watermelon leaf angle trait

[0044] Watermelon germplasm leaf materials were selected, and DNA was extracted and sequenced using the CTAB (Hexadecyl trimethylammonium bromide) method; the resequencing file (VCF) of the watermelon material was obtained. Through Genome-Wide Association Studies (GWAS) analysis, a QTL related to leaf angle under flooding conditions was located in the 2450000-2600000 interval of chromosome 2.

[0045] Example 3: Design of molecular marker LAS

[0046] The molecular marker LAS related to the leaf angle of watermelon under flooding conditions of the present invention is specifically obtained by the following method:

[0047] 1) Use the CTAB method to extract genomic DNA from watermelon parent seedlings and hybrid offspring seedlings;

[0048] 2) Screening of gene markers related to leaf angle of watermelon flooding resistance by PCR method;

[0049] 3) A KASP marker LAS was developed. After polymorphism detection, it was found that it was significantly correlated with the leaf angle of watermelon under flooding conditions. This marker can be used to identify the strength of the watermelon leaf angle under flooding conditions.

[0050] The molecular marker is located at 2463507bp of chromosome 2 of the watermelon genome (Cla97Chr02:2463507), and the sequence of 50bp before and after the molecular marker site is:

[0051] ATGGGAAGATCACAGACACTGTTTACTTTGGCCAGCATGATCATCCTAAAGCTCAACCTCACATTCCAGTTGCTGTTGGAGTCGTTACCATGGTTGAAGAA (SEQ ID NO.1)

[0052] or

[0053] ATGGGAAGATCACAGACACTGTTTACTTTGGCCAGCATGATCATCCTAAACCTCAACCTCACATTCCAGTTGCTGTTGGAGTCGTTACCATGGTTGAAGAA (SEQ ID NO. 2)

[0054] Among them, the sequence of 50 bp before and after the G genotype is shown in SEQ ID NO.1, and the corresponding phenotype is waterlogging-tolerant; the sequence of 50 bp before and after the C genotype is shown in SEQ ID NO.2, and the corresponding phenotype is non-waterlogging-tolerant.

[0055] The molecular marker primers are selected from the following primer pairs, wherein the nucleotide sequence is 5'-3':

[0056] Forward Primer (F-HEX):

[0057] GAAGGTGACCAAGTTCATGCTTGGCCAGCATGATCATCCTAAAG (SEQ ID NO.3)

[0058] Forward Primer (F-FAM):

[0059] GAAGGTCGGAGTCAACGGATTTGGCCAGCATGATCATCCTAAAC (SEQ ID NO.4)

[0060] Reverse primer (R):

[0061] CATGGTAACGACTCCAACAGC (SEQ ID NO.5)

[0062] Example 4: Using molecular markers to identify sequence differences between watermelons with small leaf angles and watermelons with large leaf angles under flooding conditions

[0063] The present invention also provides a method for identifying the leaf angle gene of watermelon under flooding conditions using the molecular marker LAS, comprising the following steps:

[0064] (1) Extracting genomic DNA of the watermelon variety to be tested;

[0065] (2) PCR amplification of watermelon genomic DNA using molecular marker LAS;

[0066] (3) Based on the difference in fluorescence signals of PCR products, the genotype of each watermelon to be tested was identified using Kraken software, that is, the homozygous GG genotype (ZJU003), the homozygous CC genotype (ZJU087), the heterozygous CG genotype ( Figure 1 ).

[0067] In this example, the PCR reaction was directly carried out on the ABI Stepone fluorescence quantitative PCR instrument, which has its own fluorescence analysis software, so that the analysis results can be directly obtained. The results are as follows: Figure 2 That is, the software automatically divides the test samples into homozygous CC genotype, homozygous GG genotype and heterozygous CG genotype according to different genotypes.

[0068] The PCR reaction system was: 20-50 ng / μl watermelon genomic DNA 5.0 μl, KASP Master Mix 5.0 μl, KASP Assay Mix (F-HEX: F-FAM: R = 2:2:5 molar concentration ratio) 0.14 μl, a total of 10.14 μl;

[0069] The PCR program was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s; annealing at 61°C (-0.6°C / cycle) for 60 s, for 10 cycles; denaturation at 94°C for 20 s, and annealing at 55°C for 60 s, for 29 cycles.

[0070] When the software analyzes that a dot of the same color as ZJU003 appears, it means that the genotype of the material corresponding to the dot is GG; when a dot of the same color as ZJU087 appears, it means that the material corresponding to the dot is CC.

[0071] Two forward primers are each provided with a fluorescent connector (in different colors), corresponding to F-HEX and F-FAM respectively. If the material to be tested is a homozygous genotype, only one of the corresponding primers will be selected for amplification during amplification (for example, the homozygous aa type can only react with F-HEX). Based on the difference in fluorescence, it can be determined whether the material to be tested is aa or bb. If the material to be tested is a heterozygous type, both primers will be used during amplification, and the fluorescence generated will be different from that of the homozygous genotype material, thereby achieving the distinction between heterozygous genotypes.

[0072] Experiment 1: The different watermelon germplasms described in Table 1 were tested according to the method described in Example 2. The results are shown in Table 1.

[0073] The results showed that the genotyping of LAS markers in F2, F3, and F4 populations was linked to the leaf angle phenotype under flooding conditions, and the next step of breeding could be carried out by selecting hybrid or backcross offspring of the GG gene. This indicated that LAS markers could assist in the selection and breeding of watermelon flood-resistant lines or their offspring.

[0074] Table 1: Results of the F2-F4 populations measured in Example 2 and Example 3 and classification statistics of leaf angles

[0075] ID genotype Leaf angle Waterlogging resistance ZJU87 CC 160 Sensitive ZJU87 CC 160 Sensitive ZJU003 GG 50 Tolerant ZJU003 GG 50 Tolerant F1 CG 150 Sensitive F1 CG 150 Sensitive F2-20 CC 180 Sensitive F2-29 CC 100 Sensitive F2-33 CC 100 Sensitive F2-34 CC 110 Sensitive F2-5 CC 100 Sensitive F2-72 CC 120 Sensitive F2-88 CC 110 Sensitive F2-91 CC 120 Sensitive F2-1 CG 170 Sensitive F2-12 CG 80 Sensitive F2-17 CG 110 Sensitive F2-22 CG 95 Sensitive F2-28 CG 100 Sensitive F2-3 CG 100 Sensitive F2-30 CG 120 Sensitive F2-32 CG 120 Sensitive F2-35 CG 110 Sensitive F2-50 CG 120 Sensitive F2-57 CG 100 Sensitive F2-58 CG 105 Sensitive F2-62 CG 125 Sensitive F2-64 CG 90 Sensitive F2-67 CG 90 Sensitive F2-7 CG 100 Sensitive F2-70 CG 90 Sensitive F2-77 CG 120 Sensitive F2-8 CG 100 Sensitive F2-80 CG 110 Sensitive F2-83 CG 120 Sensitive F2-85 CG 100 Sensitive F2-38 GG 85 Tolerant F2-4 GG 75 Tolerant F2-68 GG 70 Tolerant F2-79 GG 80 Tolerant F2-81 GG 75 Tolerant F4-20 GG 70 Tolerant F2-26 CG 130 Sensitive F2-76 CG 150 Sensitive F2-188-F3-F4-5 CG 130 Sensitive F2-341-F3-6 CG 150 Sensitive F2-383-F3-1 CG 100 Sensitive F2-47-F3-F4-1 CG 110 Sensitive F2-188-F3-F4-1 CG 160 Sensitive F2-52-F3-4 CG 110 Sensitive F2-52-F3-7 CG 140 Sensitive F2-188-F3-F4-3 CG 130 Sensitive F2-188-F3-F4-4 CG 160 Sensitive F2-52-F3-2 CG 140 Sensitive F2-188-F3-1 CG 100 Sensitive F2-52-F3-F4-1-1 CG 110 Sensitive F2-188-F3-8 CG 110 Sensitive F2-334-F3-F4-20 GG 70 Tolerant F2-334-F3-F4-1-17 GG 70 Tolerant F2-334-F3-F4-1-6 GG 90 Tolerant F2-350-F3-F4-1 GG 90 Tolerant F2-141-F3-6 GG 95 Tolerant F2-334-F3-F4-1-2 GG 80 Tolerant F2-334-F3-8 GG 80 Tolerant F2-151-F3-2 GG 90 Tolerant F2-334-F3-F4-1-7 GG 80 Tolerant F2-334-F3-F4-1-12 GG 85 Tolerant F2-334-F3-3 GG 95 Tolerant F2-334-F3-7 GG 90 Tolerant F2-334-F3-F4-1-13 GG 85 Tolerant

[0076] Example 5: DNA polymorphism analysis of LAS markers in natural population materials with different watermelon genotypes

[0077] According to the nucleotide sequence of the LAS gene, the molecular marker LAS was designed and developed to detect the polymorphism of watermelon genotypes with different leaf angles under flooding conditions. The primers (molecular markers) can be commissioned to Shanghai Sunny Biotechnology Co., Ltd. for synthesis, PCR amplification can be performed on the ABI Veriti96 PCR instrument, and the fluorescence signal can be detected and the genotyping can be analyzed using the ABI company's Stepone fluorescence quantitative PCR instrument.

[0078] The PCR reaction system was: 20~50 ng / μl watermelon genomic DNA 5.0 μl, KASP Master Mix 5.0 μl, KASP Assay Mix (F-HEX: F-FAM: R = 2:2:5, the molar concentrations of these three were 2.2 ng / l, 2.2 ng / l, and 5.5 ng / l, respectively) 0.14 μl, a total of 10.14 μl.

[0079] The specific procedure is: 94℃ pre-denaturation, 15 minutes; 94℃, 20 seconds (denaturation) - 61℃~55℃, 1 minute (renaturation & extension: 10 cycles of amplification with touch down program, 0.6℃ lowered for each cycle); 94℃, 20 seconds (denaturation) - 55℃, 60 seconds for 29 cycles. After amplification, use the BMG PHERAstar instrument to detect the fluorescence signal and check the typing. If the typing is not sufficient, continue amplification and check the typing every 3 cycles until the typing is complete, and export the experimental results from the Kraken software.

[0080] According to the setting of the present invention, 29 cycles of amplification can achieve complete typing.

[0081] The genotyping results show that each set of primers has a good typing effect on the tested watermelon. The typing effect of primers on DNA samples is shown in the figure below. Figure 2 As shown in the figure, each dot represents a material to be tested, where the red dot indicates that the site is a homozygous genotype "GG"; the blue dot indicates that the site is a homozygous genotype "CC"; the green dot indicates that the site is a heterozygous genotype "CG" or "GC"; the coordinate original position is the water control. The typing result graphic partition boundary is clear, indicating that the KASP marker typing is reliable.

[0082] Example 6: Using LAS molecular markers to carry out assisted selection breeding of watermelon leaf angle under flooding conditions

[0083] The ZJU087 watermelon, a gene donor for large leaf angle under flooding conditions, was hybridized with the ZJU003 watermelon, a gene donor for small leaf angle under flooding conditions, and then backcrossed and selfed with marker-assisted selection. The F2, F3, and F4 populations were obtained through hybridization, and the leaf angle was tested by flooding treatment. Figure 3 As shown, blue dots represent homozygous CC genotypes; red dots represent homozygous GG genotypes; green dots represent heterozygous CG genotypes; black crosses represent blank controls without samples (the typing results are clearly distinguished by color, indicating that the KASP marker typing is reliable); it was found that the leaf angle size of all homozygous GG genotype watermelon F3 offspring populations was significantly smaller than that of homozygous CC gene watermelon F3 offspring populations, while the leaf angle size of the heterozygous population showed an intermediate type. This result once again verified the high linkage between the LAS molecular marker and the leaf angle size under flooding ( Figure 3 ), which can be used for molecular-assisted breeding of leaf angle size in watermelon under flooding conditions.

[0084] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. A KASP molecular marker reagent for detecting the leaf angle trait of watermelon flooding resistance in identifying the leaf angle of watermelon under flooding conditions, characterized in that: The KASP molecular marker corresponds to 2463507bp of chromosome 2 of the watermelon reference genome version 97103V2; the polymorphism of the KASP molecular marker is G or C; the phenotype corresponding to the GG genotype is waterlogging-tolerant; the phenotype corresponding to the CC genotype is non-waterlogging-tolerant.

2. The use according to claim 1, characterized in that The reagents for detecting the KASP molecular marker for the water-flooding resistance leaf angle trait of watermelon include the following primer pairs, wherein the nucleotide sequence is 5'-3': The forward primer F-HEX is shown in SEQ ID NO.3: GAAGGTGACCAAGTTCATGCTTGGCCAGCATGATCATCCTAAAG The forward primer F-FAM is shown in SEQ ID NO.4: GAAGGTCGGAGTCAACGGATTTGGCCAGCATGATCATCCTAAAC The reverse primer R is shown in SEQ ID NO.5: CATGGTAACGACTCCAACAGC.

3. The use according to claim 2, characterized in that: The following steps are involved: (1) Extracting genomic DNA of the watermelon variety to be tested; (2) using the primer pair to perform PCR amplification on watermelon genomic DNA; (3) According to the difference in the fluorescence signal of the PCR amplification result, the genotype of the watermelon to be tested is identified by Kraken software: if the color of the fluorescence signal of the PCR amplification result is consistent with the color of the fluorescence linker of the forward primer F-HEX, the watermelon to be tested is a homozygous genotype GG, and the phenotype is waterlogging-tolerant; if the color of the fluorescence signal of the PCR amplification result is consistent with the color of the fluorescence linker of the forward primer F-FAM, the watermelon to be tested is a homozygous genotype CC, and the phenotype is non-waterlogging-tolerant; if the color of the fluorescence signal of the PCR amplification result is different from the color of the fluorescence linkers of both the forward primer F-HEX and the forward primer F-FAM, the watermelon to be tested is a heterozygous genotype CG.

4. The use according to claim 3, characterized in that In step (2), the PCR reaction system used for the PCR amplification is: 5.0 μl of 20-50 ng / μl watermelon genomic DNA, 5.0 μl of KASP Master Mix, and 0.14 μl of KASP Assay Mix; the KASP Assay Mix contains forward primer F-HEX, forward primer F-FAM, and reverse primer R, and the molar concentration ratio of F-HEX:F-FAM:R is 2:2:5, for a total of 10.14 μl; the PCR program is: pre-denaturation at 94°C for 15 minutes; denaturation at 94°C for 20 seconds; annealing at 61°C for 60 seconds, for a total of 10 cycles; denaturation at 94°C for 20 seconds, and annealing at 55°C for 60 seconds, for a total of 29 cycles.

5. Use of a KASP molecular marker reagent for detecting the leaf angle trait of watermelon flooding resistance in molecular assisted breeding of leaf angle size of watermelon under flooding conditions, characterized in that: The KASP molecular marker corresponds to 2463507bp of chromosome 2 of the watermelon reference genome version 97103V2; the polymorphism of the KASP molecular marker is G or C; the phenotype corresponding to the GG genotype is waterlogging-tolerant; the phenotype corresponding to the CC genotype is non-waterlogging-tolerant.

Images