Construction and application of aldehyde oxidase Aox1 gene knockout animal model

Abstract

The present invention relates to a method for constructing and applying an aldehyde oxidase Aox1 gene knockout animal model, and belongs to the field of biomedical technology. The method first designs and synthesizes two sgRNA sequences, and then injects the two synthesized sgRNAs and Cas9 mRNA into the fertilized eggs of mice, and then transplants the surviving fertilized eggs after injection into the uterus of pseudo-pregnant mother mice to obtain F0 generation mice, and then mates with wild-type mice of the opposite sex, and the genotype of the offspring is identified to obtain F1 generation heterozygous gene knockout mice; F1 generation heterozygous mice are inbred, and the genotype of the offspring is identified to obtain F2 generation homozygous gene knockout mice, that is, aldehyde oxidase Aox1 gene knockout animal model. The present invention studies the effect of Aox1 on the upregulation of physical performance induced by exercise training, and reveals that inhibiting Aox1 can target and control exercise ability, which provides a new idea for the research and development of products that enhance exercise ability and anti-fatigue.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and in particular relates to a method for constructing an aldehyde oxidase Aox1 gene knockout animal model and an application thereof. Background Art

[0002] Increasing physical fitness has been shown to have a positive effect in preventing and improving a range of diseases, such as Alzheimer's disease, cancer, diabetes, and cardiovascular disease. Aerobic exercise is widely considered to have a positive effect on health and fitness, such as running, swimming, and cycling. Regular participation in aerobic exercise can improve cardiovascular function, enhance endurance, control weight, and reduce the risk of chronic diseases and age-related syndromes. Mitochondrial function plays a key role in aerobic performance because it is responsible for producing most of the ATP energy required during exercise. Mitochondrial function is affected by many factors, especially the electron transport chain (ETC), which is a series of protein complexes located on the inner membrane of mitochondria. Many research reports have shown that increasing the content of mitochondrial complexes can enhance aerobic capacity, such as succinate dehydrogenase. In addition, the activation of certain key signaling pathways can also improve aerobic performance, such as the AMPK-peroxisome proliferator-activated receptor-δ pathway; these signaling pathways are involved in regulating the biogenesis and function of mitochondria, thereby increasing the number and activity of mitochondria.

[0003] Skeletal muscle is the most abundant and adaptable tissue in the human body and plays a vital role in regulating athletic ability. It is composed of two types of muscle fibers, type I and type II, each with different characteristics and functions. Type I fibers, also known as slow-twitch or red fibers, are rich in mitochondria and have a high oxidative capacity; these fibers are well suited for endurance activities and sustained contractions because they are able to produce ATP through aerobic metabolism. On the other hand, type II fibers, also known as fast-twitch or white fibers, have a lower mitochondrial density and rely primarily on anaerobic glycolysis to produce ATP. These fibers are better suited for high-intensity contractions and explosive movements. The ratio of type I and type II fibers in skeletal muscle can vary based on factors such as genetics and training. People with a higher proportion of type I fibers tend to have greater aerobic endurance, while people with a higher proportion of type II fibers excel in activities that require strength and speed.

[0004] Aldehyde oxidase 1 (Aox1) is a member of the molybdenum flavin enzyme family, which can catalyze the hydroxylation of heterocycles and oxidize aldehydes to the corresponding carboxylic acids. It is widely expressed in human and other mammalian tissues, mainly in adipose tissue, liver and adrenal glands. The enzyme has a wide range of substrates and can catalyze the hydroxylation of heterocycles and the oxidation of aldehydes, converting them into the corresponding carboxylic acids. At present, the research on Aox1 is relatively limited. Studies have shown that Aox1 can promote the proliferation of prostate cancer cells, which has attracted people's attention. In addition, studies have found that Aox1 promotes the proliferation and development of colorectal cancer cells by upregulating the expression of CD133. Recent studies have also shown that inhibiting Aox1 may help alleviate the symptoms of liver fibrosis. Given that Aox1 has a wide range of substrates and is widely expressed in various tissues and organs, it is of great physiological significance to expand our understanding of the function of Aox1. However, there is currently no research on aldehyde oxidase 1 (Aox1) in exercise. Summary of the invention

[0005] The purpose of the present invention is to solve the deficiencies of the prior art and provide a method for constructing an aldehyde oxidase Aox1 gene knockout animal model and its application.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] The first aspect of the present invention provides a method for constructing an aldehyde oxidase Aox1 gene knockout animal model, comprising the following steps:

[0008] Step (1), design and synthesize two sgRNA sequences, sgRNA-1 and sgRNA-2; the sequences are as follows:

[0009] sgRNA-1: 5′-caggacaaagccaactctag-3′;

[0010] sgRNA-2: 5′-agattacccctgatcgacag-3′;

[0011] Step (2), injecting the two synthesized sgRNAs and Cas9 mRNA into the fertilized eggs of mice, and then transplanting the surviving fertilized eggs after injection into the uterus of pseudo-pregnant female mice to obtain F0 generation mice;

[0012] Step (3), F0 generation mice are mated with wild-type mice of the opposite sex, and the offspring genotypes are identified to obtain F1 generation heterozygous gene knockout mice; F1 generation heterozygous mice are inbred, and the offspring genotypes are identified to obtain F2 generation homozygous gene knockout mice, which are aldehyde oxidase Aox1 gene knockout animal models.

[0013] Furthermore, preferably, in step (2), the injection concentration of Cas9 mRNA is 50 ng / μL, the injection concentration of sgRNA-1 is 20 ng / μL, and the injection concentration of sgRNA-2 is 20 ng / μL.

[0014] The second aspect of the present invention provides the aldehyde oxidase Aox1 gene knockout animal model constructed by the method for constructing the above-mentioned aldehyde oxidase Aox1 gene knockout animal model.

[0015] The third aspect of the present invention provides the use of the above-mentioned aldehyde oxidase Aox1 gene knockout animal model in the preparation or screening of drugs for enhancing exercise capacity or resisting fatigue.

[0016] The fourth aspect of the present invention provides an aldehyde oxidase Aox1 gene knockout kit, comprising: sgRNA-1, sgRNA-2 and Cas9 mRNA; wherein the sequences of sgRNA-1 and sgRNA-2 are as follows:

[0017] sgRNA-1: 5′-caggacaaagccaactctag-3′;

[0018] sgRNA-2: 5′-agattacccctgatcgacag-3′.

[0019] The fifth aspect of the present invention provides the use of an inhibitor of aldehyde oxidase Aox1 in the preparation of a drug for enhancing exercise capacity or resisting fatigue; wherein the inhibitor of aldehyde oxidase Aox1 is norharman or small interfering RNA;

[0020] The small interfering RNA is a siRNA-Aox1-450 primer set or a siRNA-Aox1-793 primer set;

[0021] Among them, the siRNA-Aox1-450 primer set sequence is as follows:

[0022] siRNA-Aox1-450 forward sequence: 5′-cucuagaucaguuaacugatt-3′;

[0023] siRNA-Aox1-450 reverse sequence: 5′-ucaguuaacugaucuagagtt-3′;

[0024] The siRNA-Aox1-793 primer set sequence is as follows:

[0025] siRNA-Aox1-793 forward sequence: 5′-ggaacuuguggaagcuaaatt-3′;

[0026] siRNA-Aox1-793 reverse sequence: 5′-uuuagcuuccacaaguucctt-3′.

[0027] The sixth aspect of the present invention provides a drug for enhancing exercise ability or resisting fatigue, comprising a pharmaceutically acceptable carrier and an inhibitor of aldehyde oxidase Aox1;

[0028] The inhibitor of aldehyde oxidase Aox1 is nor-harman or small interfering RNA;

[0029] The small interfering RNA is a siRNA-Aox1-450 primer set or a siRNA-Aox1-793 primer set;

[0030] Among them, the siRNA-Aox1-450 primer set sequence is as follows:

[0031] siRNA-Aox1-450 forward sequence: 5′-cucuagaucaguuaacugatt-3′;

[0032] siRNA-Aox1-450 reverse sequence: 5′-ucaguuaacugaucuagagtt-3′;

[0033] The siRNA-Aox1-793 primer set sequence is as follows:

[0034] siRNA-Aox1-793 forward sequence: 5′-ggaacuuguggaagcuaaatt-3′;

[0035] siRNA-Aox1-793 reverse sequence: 5′-uuuagcuuccacaaguucctt-3′.

[0036] The seventh aspect of the present invention provides a non-therapeutic method for enhancing exercise capacity, wherein an inhibitor of aldehyde oxidase Aox1 is used to inhibit aldehyde oxidase Aox1; the inhibitor of aldehyde oxidase Aox1 is norharman or small interfering RNA;

[0037] The small interfering RNA is a siRNA-Aox1-450 primer set or a siRNA-Aox1-793 primer set;

[0038] Among them, the siRNA-Aox1-450 primer set sequence is as follows:

[0039] siRNA-Aox1-450 forward sequence: 5′-cucuagaucaguuaacugatt-3′;

[0040] siRNA-Aox1-450 reverse sequence: 5′-ucaguuaacugaucuagagtt-3′;

[0041] The siRNA-Aox1-793 primer set sequence is as follows:

[0042] siRNA-Aox1-793 forward sequence: 5′-ggaacuuguggaagcuaaatt-3′;

[0043] siRNA-Aox1-793 reverse sequence: 5′-uuuagcuuccacaaguucctt-3′.

[0044] In the present invention, it is common knowledge that norharman is an inhibitor of aldehyde oxidase Aox1.

[0045] The present invention has found through research that Aox1 knockout can enhance athletic ability, and the sgRNA sequences for inducing knockout are sgRNA-1: 5′-caggacaaagccaactctag-3′, sgRNA-2: 5′-agattacccctgatcgacag-3′;

[0046] Aox1 is used as a target in regulating athletic ability or anti-fatigue. Specifically, Aox1 expression is reduced, athletic ability is enhanced, and fatigue is resisted. The NCBI Gene ID of the Aox1 gene when the species is human is 316.

[0047] Specifically, Aox1-deficient mice have enhanced aerobic exercise capacity.

[0048] The Aox1 inhibitor includes a nucleic acid molecule, a protein molecule or a compound.

[0049] Compared with the prior art, the present invention has the following beneficial effects:

[0050] The present invention studies the effect of Aox1 on the upregulation of physical performance induced by exercise training. Compared with the control group mice, after the whole body knockout of Aox1, the exercise duration and exercise distance increased significantly, showing better exercise ability, and the expression of succinate dehydrogenase (SDH) in the soleus and gastrocnemius muscles was increased. The oxidative fibers of the soleus muscle increased significantly and the expression of mitochondrial complex proteins in the gastrocnemius muscle was increased. In in vitro experiments, the oxygen consumption rate of primary myotubes of Aox1 knockout mice was significantly enhanced when there was no difference in the extracellular acidification rate. The present invention reveals that inhibiting Aox1 can target and control exercise capacity, providing a new idea for the research and development of products that enhance exercise capacity and resist fatigue. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1Figure 1 is the knockout strategy and identification of Aox1 knockout mice; A is the knockout strategy of Aox1 knockout mice; B is the genotype identification result of wild-type mice and Aox1 knockout mice, in which M is 250bp DNA Ladder, WT is wild-type mice, Aox1 - / - A is an Aox1 knockout mouse; C is a comparison chart of the sequencing results of Aox1 knockout mice and non-knockout sequences;

[0052] Figure 2 The motor ability of Aox1 knockout mice is enhanced; A is a schematic diagram of the mouse running program; B is the running time of Aox1 knockout mice (n=8) and wild-type mice (n=7) on the electric treadmill; C is the running distance of Aox1 knockout mice (n=8) and wild-type mice (n=7) on the electric treadmill; all results are expressed as mean ± SD, and the results are tested by unpaired t-test;

[0053] Figure 3 The positive proportion of SDH staining in Aox1 knockout mice increased; A is the quantification of SDH staining in Sol muscle sections after SDH staining (wild-type mice n=6, Aox1 knockout mice n=5); B is the quantification of SDH staining in GA muscle sections after SDH staining (wild-type mice n=7, Aox1 knockout mice n=6); all results are expressed as mean ± SD, and the results were analyzed by unpaired t test;

[0054] Figure 4 The percentage of oxidative myofibers in Aox1 knockout mice was increased; the percentage of type I and type IIA myofibers in Sol muscle was quantified (wild-type mice n=5, Aox1 knockout mice n=6); all results are expressed as mean ± SD, using unpaired t-test;

[0055] Figure 5Figure 1 shows that mitochondrial respiratory function in skeletal muscle of Aox1 knockout mice is enhanced; A is a representative Western blot analysis of OxPhos complex using GA muscle lysate, lanes 1-5 are GA protein samples of wild-type mice, lanes 6-11 are GA protein samples of Aox1 knockout mice, CⅤ-ATP5A is mitochondrial complex V, CⅢ-UQCRC2 is mitochondrial complex III, CⅡ-SDHB is mitochondrial complex II, and CⅠ-NDUFB8 is mitochondrial complex I; B is the quantification of OxPhos complex in A (wild-type mice n=5, Aox1 knockout mice n=6); C is the oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) of GA isolated muscle fibers of wild-type mice and Aox1 knockout mice measured by Seahorse XF analyzer, and principal component analysis (PCA) of the two groups of data after muscle fiber normalization (n=5); D is the oxygen consumption rate (OCR) of GA isolated muscle fibers measured by Seahorse XF analyzer; E is the oxygen consumption rate (OCR) of GA isolated muscle fibers measured by Seahorse XF analyzer. The extracellular acidification rate (ECAR) of GA isolated muscle fibers was measured by XF analyzer (n=5); all results are expressed as mean±SD and analyzed by unpaired t-test;

[0056] Figure 6 si-RNA reduces Aox1 expression; A is the Aox1 mRNA level in cells after si-RNA treatment, ** indicates p≤0.01, *** indicates p≤0.001, all results are expressed as mean±SD, and unpaired t-test was performed; B is the Western blot experiment to prove the Aox1 protein expression in cells after si-RNA treatment; DETAILED DESCRIPTION

[0057] The present invention is further described in detail below in conjunction with embodiments.

[0058] Those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the art or the product specifications are used. If the manufacturer of the materials or equipment used is not specified, they are all conventional products that can be purchased.

[0059] Example 1 Aox1 knockout mice have enhanced motor ability

[0060] This example found that the exercise capacity of aldehyde oxidase 1 (Aox1) knockout mice was significantly enhanced, as shown in exercise time and exercise distance. Studies on skeletal muscle of Aox1 knockout mice showed that their mitochondrial function was significantly enhanced. These results suggest that Aox1 is negatively correlated with exercise capacity. The following examples further illustrate the present invention in detail.

[0061] 1. Construction of Aox1 knockout mice

[0062] For the Aox1 gene sequence (sequence as shown in SEQ ID NO.1), two sgRNA sequences were designed:

[0063] sgRNA-1: 5′-caggacaaagccaactctag-3′; (SEQ ID NO. 2)

[0064] sgRNA-2: 5′-agattacccctgatcgacag-3′. (SEQ ID NO.3)

[0065] The target of sgRNA-1 is the 408th to 427th nucleotides of the Aox1 gene sequence, and the target of sgRNA-2 is the 9923rd to 9942nd nucleotides of the Aox1 gene sequence. Figure 1 A in.

[0066] C57 / BL6 female mice with vaginal plugs were humanely killed, laparotomy was performed, and the ovaries and part of the uterine horns were removed. The removed tissues were washed with M2 medium (Sigma M7167) and placed in new M2 medium. Under a stereomicroscope, the oviduct was cut open with a sharp instrument to allow the fertilized eggs to flow out of the oviduct. The fertilized eggs with granulosa cells were transferred to 1mg / mL hyaluronidase (Sigma 37326-33-3) with a pipette for digestion to remove the granulosa cells. After digestion, the fertilized eggs with two pronuclei and good morphology were selected after washing several times with M2 medium, and transferred to M16 medium (Sigma M7292) and placed in a 37°C, 5% CO2, 5% O2, saturated humidity incubator for use.

[0067] After the corresponding sgRNA was synthesized, the collected fertilized eggs were microinjected. The injection concentration of Cas9mRNA (Thermo Fisher A29378) was 50 ng / μL, and the injection concentration of the two sgRNAs was 20 ng / μL. The two were mixed and injected together. After the injection, the surviving fertilized eggs were transferred to M16 culture medium and placed in a 37°C, 5% CO2, 5% O2, saturated humidity incubator for 30 to 60 minutes before transplantation.

[0068] The fertilized eggs that survived the microinjection and culture were transplanted into the pseudo-pregnant female mice through the fimbria of the fallopian tube to obtain F0 mice; the specific method is: take the recipient mice with thrombosis on the same day, remove the ovaries from the lateral abdomen through surgery after anesthesia, tear the ovarian serosa with forceps, find the ampulla of the fallopian tube, insert the transplantation needle containing 25 injected fertilized eggs into it, transplant the fertilized eggs into the fallopian tube, and then return the ovaries and fallopian tubes to the recipient mice and suture them.

[0069] F0 generation mice were mated with wild-type mice of the opposite sex, and the offspring genotypes were identified to obtain F1 generation heterozygous gene knockout mice; F1 generation heterozygous mice were inbred between male and female, and the offspring genotypes were identified to obtain F2 generation homozygous gene knockout mice.

[0070] The tails of mice born on day 21 were cut and placed in a centrifuge tube. 250 μL of 50 mM NaOH solution was added to the centrifuge tube, and the tube was placed in a metal bath at 100°C for 30 min, then centrifuged at 500 rpm for 2 min, 30 μL of 1 M Tris HCl was added, mixed, and then centrifuged at 500 rpm for 2 min. The supernatant was the crude extracted DNA, and PCR was used for genotyping screening. The genotyping PCR reaction system is shown in Tables 1 and 2. The genotyping PCR reaction procedures of the two PCR reaction systems are shown in Table 3.

[0071] Table 1

[0072]

[0073] Table 2

[0074]

[0075] Table 3

[0076]

[0077] The primers used are as follows:

[0078] Genotyping F1:5′-agctggtcccctcttctgctct-3′; (SEQ ID NO.4)

[0079] Genotyping R1:5′-aagagtcacaggcacagttccaaatg-3′. (SEQ ID NO.5)

[0080] Genotyping F2:5′-cgagtccatgtgtctgtgagtgtt-3′; (SEQ ID NO.6)

[0081] Genotyping R2:5′-cccacaaactcacatacaccc-3′. (SEQ ID NO.7)

[0082] The PCR products were electrophoresed on a 2% agarose gel at 140V for 30 minutes, and the bands were observed to determine the genotype. When the PCR product Genotyping F1 / R1 system using the same crude DNA as a template had no bands, but the Genotyping F2 / R2 system had bands, the genotype of the mouse tested was wild type; when the PCR product Genotyping F1 / R1 system using the same crude DNA as a template had bands, but the Genotyping F2 / R2 system had no bands, the genotype of the mouse tested was Aox1 knockout mouse.

[0083] The results of mouse genotyping were as follows Figure 1 B in Figure 2. Lanes 2 to 8 show wild-type mice, and lanes 9 to 16 show Aox1 knockout mice. Figure 1 C. Comparison of the knockout DNA sequence with the Aox1 gene sequence (SEQ ID NO. 1) can be seen.

[0084] The sequenced DNA sequence is catagactcttgagtggtaccaacaagtcttccattattgtcctataactcccaggaacagtggagctctgcagactgactgcccaggaagagcctgctagggtaaggatcagccatctcctgagaccaggttctcagcttggtagataa acatccgttgacatcaatgaagattacccctgatcgatagaggaacatgcagtacagacgagcatcctgcaagccatgcttctttctgtctgctctggtctgtgaatgccaagggaatctcaaatgcatggggcatgagagcagaagaggggggaccagcta. (SEQ ID NO.18)

[0085] 2. Mouse Housing Conditions and Running Test

[0086] (1) Mouse breeding conditions

[0087] Both the constructed Aox1 knockout mice and wild-type mice were subjected to a 12-h light-dark cycle (i.e., a photoperiod of 12 h light: 12 h dark) for 3 months and were allowed free access to water and food.

[0088] (2) Running test

[0089] Aox1 knockout mice and their wild-type mice at 3 months of age were tested for running. The mice were allowed to run on a treadmill at a speed of 8 m / min for 5 minutes and adapted for 5 days. On the day of the exercise test, the mice first ran at a speed of 8 m / min for 15 minutes, and then increased the speed by 4 m / min every 15 minutes until they reached 16 m / min. They ran at a speed of 16 m / min for 30 minutes, and then linearly increased the speed from 16 m / min to 24 m / min in 45 minutes, and ran for another 45 minutes until the mice were exhausted. The standard definition of exhaustion is that the mouse cannot run on the treadmill for 10 seconds even if the mouse is stimulated by the hand given. All mice were exhausted within the experimental time. The exercise time and distance of each mouse were recorded.

[0090] Results Figure 2 Compared with 3-month-old wild-type mice, 3-month-old Aox1 knockout mice had significantly longer exercise time and distance on the treadmill under the same running program.

[0091] 3. Succinate dehydrogenase (SDH) staining of muscle tissue

[0092] After the exercise test, the mice were killed and their gastrocnemius (GA) and soleus (Sol) muscles were obtained for subsequent studies.

[0093] (1) Anesthetize mice, remove gastrocnemius (GA) and soleus (Sol) muscles, place them vertically in OCT, and store them at -80°C;

[0094] (2) GA and Sol placed vertically in OCT were transferred from -80°C storage to a -20°C cryostat. 7 μm thick cross sections were obtained from the mid-belly of the gastrocnemius muscle at -20°C using a cryostat and then stored at -80°C until succinate dehydrogenase (SDH) staining was performed;

[0095] (3) The sections were air-dried at room temperature for 30 min and then stained in nitro blue tetrazolium (Solarbio G2000) for 25 min in a 37°C incubator. The sections were rinsed with deionized water for 3 min and then sealed with neutral gum (Solarbio G8590).

[0096] (4) Each slice was digitally photographed under a Zeiss optical microscope using a 20x magnification lens, and fiber quantification was performed using imaging software (Image J, NIH). ImageJ software 1.53a was used to calculate the percentage of SDH-positive areas in muscle fibers. All experimental steps were performed on the same day, with consistent camera acquisition parameters.

[0097] Test results see Figure 3, The results of quantitative analysis of muscle section staining showed that the SDH-positive ratio in GA and Sol of Aox1 knockout mice was significantly higher than that of wild-type mice.

[0098] 4. Myofiber Immunostaining

[0099] Dissected soleus muscles (Sol) with OCT longitudinal positioning were transferred from -80°C storage to a -20°C cryostat. 7 μm thick cross sections were obtained from the mid-belly of the soleus muscle at -20°C using a cryostat and subsequently stored at -80°C. To stain myosin heavy chain isoforms, muscle sections were mixed with the following antibodies: MyHC1 (BA-D5, DSHB), MyHC2a (SC-71, DSHB), MyHC2b (BF-F3, DSHB) primary antibodies and incubated overnight at 4°C. The dilution ratios of the primary antibodies for MyHC1 (BA-D5, DSHB), MyHC2a (SC-71, DSHB), and MyHC2b (BF-F3, DSHB) were 1:100, 1:100, and 1:50, respectively.

[0100] After washing the sections three times with PBST, the sections were mixed and incubated at room temperature with three different fluorescently labeled secondary antibodies: Alexa Fluor350-conjugated goat anti-mouse IgG2b, Alexa Fluor 488-conjugated goat anti-mouse IgG1, and Alexa Fluor 594-conjugated goat anti-mouse IgM (Cat. No. A21140, A21121, and A21044, Thermo Fisher Scientific) for 1 hour. The dilution ratios of the three secondary antibodies were 1:100, 1:100, and 1:100, respectively.

[0101] Images were obtained using a Zesis microscope. Results are shown in Figure 4 The proportion of oxidative fibers in the soleus muscle of Aox1 knockout mice was significantly higher than that of wild-type mice.

[0102] 5. Mouse GA Protein Extraction and Western Blot Analysis

[0103] The whole GA of Aox1 knockout mice and wild-type mice were placed in different 2 mL centrifuge tubes, and 1 mL of RIPA buffer was added. Place on ice for 30 min, and vortex on a vortexer for 10 s every 10 min. Centrifuge at 12000 rpm at 4°C for 10 min, and collect 200 μL of protein supernatant. Add 40 μL of 6× Loading Buffer to the protein supernatant, place in a 100°C metal bath for 10 min, and centrifuge at 500 rpm at room temperature for 2 min to obtain protein lysate, which was stored at -80°C.

[0104] According to the instructions of the product, the rapid BCA protein detection kit (Thermo Fisher) was used for quantification. 20 μg of protein lysate was added to sodium dodecyl sulfate polyacrylamide gel electrophoresis, blotted and electrotransferred to polyvinylidene difluoride membrane (Millipore), and 5% BSA (Solarbio A8020) was prepared with 1× PBS as the blocking solution. The membrane was blocked at room temperature for 2 hours and washed with PBS three times, each time for 5 minutes. At 4°C, it was incubated with the primary antibody OxPhos (45-8099, Invitrogen, dilution ratio of 1:1000) for 12 hours, washed with PBST three times, incubated with goat anti-mouse (Servicebio GB23301, dilution ratio of 1:10000) at room temperature for 2 hours, washed with PBST three times, and photographed by HRP-ECL luminescence method to detect mitochondrial expression. The membrane was washed 3 times with membrane regeneration solution (formula: 15g glycine, 1g SDS, 10mL Tween-20, adjusted to pH 2.2, and fixed to 1L with ddH2O) preheated at 65℃, 8min each time; 3 times with PBS, 8min each time; 3 times with PBST, 8min each time. At room temperature, the membrane was incubated with primary antibody β-actin (66009-1-IgProteintech, dilution ratio of 1:10000) for 1h, washed 3 times with PBST, 8min each time, washed 3 times with PBST, incubated with goat anti-mouse (Servicebio GB23301, dilution ratio of 1:10000) at room temperature for 2h, washed 3 times with PBST, and photographed by HRP-ECL luminescence method to detect β-actin expression. Band intensity was quantified using Image J software. Mitochondrial protein results are shown in Figure 5 A in Figure 5 In B, compared with the corresponding internal reference protein β-actin, the expression levels of mitochondrial oxidative phosphorylation-related proteins in GA muscle of Aox1 knockout mice were significantly higher than those in wild-type mice.

[0105] 6. Mitochondrial respiration

[0106] (1) Isolation of primary myotubes

[0107] Whole-piece GA from 3-month-old wild-type mice and Aox1 knockout mice was digested with 400 U / ml collagenase type II (9001-12-1, Gibco) in a shaking water bath at 37°C for 90 min. The digested muscles were blocked with 10% fetal bovine serum. Individual myofibers were released by applying gentle pressure to the muscles, washed several times with 2% horse serum, and collected for hippocampal analysis.

[0108] (2) Muscle fiber mitochondrial respiration measurement

[0109] The isolated myofibers were plated on XF24 plates, and 500 μL of DMEM medium (Biological Industries 01-052-1A) was added to each well. The plates were cultured in vitro for 24 hours for seahorse analysis (XF24, Agilent Technologies, Santa Clara). One hour before the experiment, myofibers were plated in phenol red-free DMEM medium (Agilent 103575-100) containing 10 mM glucose, 1 mM pyruvate, and 2 mM glutamine. The Seahorse XF Cell Mitochondrial Stress Test Kit (103015-100, Agilent Technologies) was then added according to the instructions, and the oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured using the instructions of the Agilent Seahorse analyzer. The data were normalized by the number of myofibers. Results are shown in Figure 5 C in Figure 5 D in Figure 5 The results of myofiber respiration assays in E and GA muscles showed that the oxygen consumption rate of Aox1 knockout mice was significantly higher than that of wild-type mice, with no significant difference in extracellular acidification rate.

[0110] 7. Cell si-RNA transfection

[0111] 1×10 per well in a 6-well plate 5 The cells were evenly plated at a density of 100 cells. After the C2C12 cells (purchased from Shanghai Cell Bank, Chinese Academy of Sciences) adhered to the wall, a differentiation medium (gibco2209550) containing 2% horse serum (Bio-Mingsai 6281S03) was added for 6 days of differentiation, and the differentiation of myotubes reached more than 50%.

[0112] The following si-RNA was designed and synthesized by General Biotech Co., Ltd. The sequence is:

[0113] si-Control forward sequence: 5′-uucuccgaacgugucacgutt-3′; (SEQ ID NO.8)

[0114] si-Control reverse sequence: 5′-acgugacacguucggagaatt-3′. (SEQ ID NO.9)

[0115] siRNA-Aox1-450 forward sequence: 5′-cucuagaucaguuaacugatt-3′; (SEQ ID NO.10)

[0116] siRNA-Aox1-450 reverse sequence: 5′-ucaguuaacugaucuagagtt-3′. (SEQ ID NO.11)

[0117] siRNA-Aox1-793 forward sequence: 5′-ggaacuuguggaagcuaaatt-3′; (SEQ ID NO.12)

[0118] siRNA-Aox1-793 reverse sequence: 5′-uuuagcuuccacaaguucctt-3′. (SEQ ID NO.13)

[0119] Each group of si-RNA was stored in the same centrifuge tube at a concentration of 20 μM, with a total of three groups. 10 μL of 20 μM si-Control was mixed with 250 μL of Opti-MEM medium (gibco 2193148) in one centrifuge tube; at the same time, 5 μL of lipo3000 (Invitrogen 2373383) was diluted with 250 μL of Opti-MEM medium in another centrifuge tube and kept at room temperature for 5 minutes; the diluted si-Control and lipo3000 were evenly mixed to obtain a mixed solution, which was placed at room temperature for 20 minutes and added to one of the wells in the 6-well plate. The same was true for the other two groups of si-RNA, with one technical replicate for each group. The time when the mixed solution was added to the well plate was recorded, and after 6 hours of addition, it was replaced with differentiation medium with a volume fraction of 2% horse serum and continued to be cultured. Cell RNA was extracted 24 hours after the addition of the mixed solution, and total cell protein was extracted 48 hours after the addition of the mixed solution.

[0120] 8.Aox1 interference efficiency detection

[0121] (1) Extraction of cellular RNA:

[0122] Cell RNA was extracted 24 h after the addition of the mixture in the previous step.

[0123] Add 500 μL RNAiso Plus (TaKaRa) to each well of a 12-well cell culture plate, and scrape the C2C12 cells and transfer them to a 2 mL centrifuge tube.

[0124] Add 200 μL of chloroform to the centrifuge tube, oscillate on a vortex to mix, and then let stand at room temperature for 10 min; then centrifuge at 4°C, 12,000 rpm, aspirate 200 μL of the supernatant, add 500 μL of isopropanol, mix by inversion, let stand on ice for 5 min, and then centrifuge at 4°C, 12,000 rpm for 15 min.

[0125] The supernatant was discarded, and the remaining precipitate was the crude RNA. 500 μL of 75% ethanol was added to wash the RNA, and 20 μL of DEPC water was added after repeated washing twice. The total RNA obtained in this step was obtained.

[0126] After reverse transcription, qPCR was performed to detect the mRNA level.

[0127] Reverse transcription of mRNA:

[0128] 1) Genomic DNA removal reaction, the reaction system is shown in Table 4.

[0129] Table 4

[0130]

[0131] Mix the above reaction reagents and incubate at 42℃ for 5 min.

[0132] 2) Reverse transcription reaction: PrimeScript™ RT reagent Kit with gDNAEraser (Perfect Real Time) (RR047A, Takara) was used. The reaction system is shown in Table 5.

[0133] Table 5

[0134]

[0135] Add the corresponding reagents according to step 2), and the reaction procedure is: 37℃ for 15 min, 85℃ for 5 s.

[0136] 3) qPCR reaction: the cDNA obtained after reverse transcription was used as a template, and the corresponding reagents were mixed according to the reaction system in Table 7. β-actin was used as an internal reference gene to detect the expression of Aox1.

[0137] The qPCR reaction primers are shown in Table 6, the reaction system is shown in Table 7, and the reaction procedure is shown in Table 8.

[0138] Table 6

[0139]

[0140] Table 7

[0141]

[0142] Table 8

[0143]

[0144] β-actin was used as an internal reference, the Livak method was used to detect the expression level of the target gene, and the graph was drawn using GraphPadPrism software.

[0145] (2) Extraction of total cell protein:

[0146] Wash the myotubes in the 6-well plate 3 times with 1×PBS (formula: 2.7 mM KCl, 2.0 mM KH2PO4, 137 mM NaCl, 10 mM Na2HPO4, pH7.4). Add 400 μL RIPA lysis buffer (formula: 150 mM NaCl, volume fraction: 1% Triton X-100, mass fraction: 0.5% sodium deoxycholate, mass fraction: 0.1% SDS, 50 mMTris, 5 mM EDTA, 10 mM sodium fluoride, 1 mM sodium vanadate, 1 mM PMSF) to each well. Scrape the myotubes in the 6-well plate and collect them into 6 2 mL centrifuge tubes separately. Place them on ice for 30 min and vortex them on a vortexer for 10 s every 10 min. Centrifuge at 12000 rpm at 4°C for 10 min and collect 200 μL protein supernatant.

[0147] Add 40 μL 6×Loading Buffer (formula: 7 mL 4×Tris-HCl pH=6.8, 0.93 g DTT, 1 g SDS, 3 mL glycerol) to the protein supernatant, incubate at 100°C metal bath for 10 min, centrifuge at 500 rpm at room temperature for 2 min to obtain protein lysate, which was stored at -80°C.

[0148] According to the instructions of the product, the rapid BCA protein detection kit (Thermo Fisher) was used for quantification. 20 μg of protein lysate was added to sodium dodecyl sulfate polyacrylamide gel electrophoresis, blotted to polyvinylidene difluoride membrane (Millipore), and 1× PBS (formula: 2.7 mM KCl, 2.0 mM KH2PO4, 137 mM NaCl, 10 mM Na2HPO4, pH7.4) was used to prepare 3% BSA (Solarbio A8020) at room temperature for 2 hours to block the membrane, and then washed with PBS three times, each time for 5 minutes. Incubate with the following primary antibodies for 12 h at 4°C: Aox1 (Abcam ab197828, dilution ratio 1:2000), GAPDH (Proteintech 10494-1-AP, dilution ratio 1:10000), and then wash the membrane three times with PBST (formula 8g NaCl, 0.2g KCl, 2.874g NaHPO4•12H2O, 0.2g KH2PO4, then add 1mL Tween-20, add ddH2O to 1L), each time for 8 min. Incubate the membrane with GAPDH as the primary antibody with goat anti-mouse (Servicebio GB23301, dilution ratio 1:10000) and the membrane with Aox1 as the primary antibody with goat anti-rabbit (Servicebio GB23303, dilution ratio 1:10000), incubate at room temperature for 2 h. Wash the membrane three times with PBST, each time for 10 min. HRP-ECL luminescence method was used to take pictures and detect the expression of Aox1. Figure 6 , Aox1 mRNA level, si-Aox1-450, si-Aox1-793 can significantly reduce Aox1 expression compared with si-Control, and this effect is also confirmed at the protein level. si-Aox1-793 reduces Aox1 expression by more than 50% at both mRNA and protein levels. In short, the results show that si-Aox1-450 and si-Aox1-793 can significantly reduce Aox1 expression.

[0149] The results of the above examples show that Aox1 is negatively correlated with exercise capacity. In view of this, Aox1 or its encoding gene can be used as a target in drugs for enhancing exercise capacity or anti-fatigue, and Aox1 can be used as a drug target at the gene level and / or protein level, such as by blocking the expression of Aox1, the corresponding inhibitors against Aox1 are used in drugs for enhancing exercise capacity or anti-fatigue, and the vectors for knocking out Aox1 by siRNA are used in the preparation of drugs for enhancing exercise capacity or anti-fatigue.

[0150] The above shows and describes the basic principles, main features and advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A method for constructing an aldehyde oxidase Aox1 gene knockout animal model, characterized in that: The steps include: Step (1), design and synthesize two sgRNA sequences, sgRNA-1 and sgRNA-2; the sequences are as follows: sgRNA⁃1:5′-caggacaaagccaactctag-3′; sgRNA⁃2: 5′-agattacccctgatcgacag-3′; Step (2), injecting the two synthesized sgRNAs and Cas9 mRNA into the fertilized eggs of mice, and then transplanting the surviving fertilized eggs after injection into the uterus of pseudo-pregnant female mice to obtain F0 generation mice; Step (3), F0 generation mice are mated with wild-type mice of the opposite sex, and the offspring genotypes are identified to obtain F1 generation heterozygous gene knockout mice; F1 generation heterozygous mice are inbred, and the offspring genotypes are identified to obtain F2 generation homozygous gene knockout mice, which are aldehyde oxidase Aox1 gene knockout animal models.

2. The method for constructing an aldehyde oxidase Aox1 gene knockout animal model according to claim 1, characterized in that: In step (2), the injection concentration of Cas9 mRNA is 50 ng / μL, the injection concentration of sgRNA-1 is 20 ng / μL, and the injection concentration of sgRNA-2 is 20 ng / μL.

3. The method for constructing the aldehyde oxidase Aox1 gene knockout animal model according to claim 1 or 2, and use of the constructed aldehyde oxidase Aox1 gene knockout animal model in screening drugs for enhancing exercise capacity or resisting fatigue.

4. Aldehyde oxidase Aox1 gene knockout kit, characterized in that: include: sgRNA-1, sgRNA-2 and Cas9 mRNA; the sequences of sgRNA-1 and sgRNA-2 are as follows: sgRNA-1: 5′-caggacaaagccaactctag-3′; sgRNA-2: 5′-agattacccctgatcgacag-3′.

5. Use of an inhibitor of aldehyde oxidase Aox1 in the preparation of a drug for enhancing athletic ability or resisting fatigue, characterized in that: The inhibitor of aldehyde oxidase Aox1 is small interfering RNA; The small interfering RNA is a siRNA-Aox1-450 primer set or a siRNA-Aox1-793 primer set; Among them, the siRNA-Aox1-450 primer set sequence is as follows: siRNA-Aox1-450 forward sequence: 5′-cucuagaucaguuaacugatt-3′; siRNA-Aox1-450 reverse sequence: 5′-ucaguuaacugaucuagagtt-3′; The siRNA-Aox1-793 primer set sequence is as follows: siRNA-Aox1-793 forward sequence: 5′-ggaacuuguggaagcuaaatt-3′; siRNA-Aox1-793 reverse sequence: 5′-uuuagcuuccacaaguucctt-3′.

6. A drug for enhancing athletic ability or resisting fatigue, characterized in that: It comprises a pharmaceutically acceptable carrier and an inhibitor of aldehyde oxidase Aox1; The inhibitor of aldehyde oxidase Aox1 is small interfering RNA; The small interfering RNA is a siRNA-Aox1-450 primer set or a siRNA-Aox1-793 primer set; Among them, the siRNA-Aox1-450 primer set sequence is as follows: siRNA-Aox1-450 forward sequence: 5′-cucuagaucaguuaacugatt-3′; siRNA-Aox1-450 reverse sequence: 5′-ucaguuaacugaucuagagtt-3′; The siRNA-Aox1-793 primer set sequence is as follows: siRNA-Aox1-793 forward sequence: 5′-ggaacuuguggaagcuaaatt-3′; siRNA-Aox1-793 reverse sequence: 5′-uuuagcuuccacaaguucctt-3′.

7. A method for non-therapeutic enhancement of athletic ability, characterized in that: The aldehyde oxidase Aox1 inhibitor is used to inhibit the aldehyde oxidase Aox1, wherein the aldehyde oxidase Aox1 inhibitor is a small interfering RNA; The small interfering RNA is a siRNA-Aox1-450 primer set or a siRNA-Aox1-793 primer set; Among them, the siRNA-Aox1-450 primer set sequence is as follows: siRNA-Aox1-450 forward sequence: 5′-cucuagaucaguuaacugatt-3′; siRNA-Aox1-450 reverse sequence: 5′-ucaguuaacugaucuagagtt-3′; The siRNA-Aox1-793 primer set sequence is as follows: siRNA-Aox1-793 forward sequence: 5′-ggaacuuguggaagcuaaatt-3′; siRNA-Aox1-793 reverse sequence: 5′-uuuagcuuccacaaguucctt-3′.

Images