A detection method for SNP of METAP1D gene in Tibetan sheep and its application in early screening of immune traits

Abstract

The present invention relates to the field of biological detection technology, and in particular to a detection method for SNP of the METAP1D gene of Tibetan sheep and its application in early screening of immune traits. The present invention provides a SNP molecular marker for early screening of immune traits of Tibetan sheep, wherein the SNP molecular marker is located at the 297th position of the METAP1D gene fragment, and the mutant base is G or A; the METAP1D gene is shown in SEQ ID NO.1. The SNP molecular marker of the present invention can be used to obtain the content of immunoglobulin A, immunoglobulin G, and immunoglobulin M of Tibetan sheep individuals, providing a new molecular marker resource for marker-assisted selection of Tibetan sheep immune traits for non-diagnostic purposes. It provides a basis for breeding Tibetan sheep with high immunity.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a detection method for SNP of a Tibetan sheep METAP1D gene and application thereof in early screening of immune traits. Background Art

[0002] Immune indicators usually include antibody levels, immune cell numbers and functions, etc. Antibodies are protein molecules produced by B cells that can specifically bind to and neutralize pathogens, enhancing the effect of immune responses. The number and function of immune cells are also indicators of the state of the immune system. When the immune system is challenged, immune cells are activated and begin to proliferate to fight invading pathogens. These cells will further differentiate into more effector cells, such as macrophages and cytotoxic T cells, to eliminate pathogens.

[0003] Therefore, immune indicators can be used as an important reference to evaluate the disease resistance and health status of animals. By monitoring the changes in immune indicators, it is possible to detect animal immune problems in a timely manner and take corresponding measures to improve the animal's disease resistance, prevent and treat diseases.

[0004] With the rapid development of molecular marker technology, in Tibetan sheep breeding, the mutation sites in genes are searched at the gene level, and the relationship between genes and traits is discovered through association analysis with traits, so that early selection can be carried out to improve the efficiency and accuracy of seed selection, which has broad application value. Therefore, molecular markers provide a basis for people to study the genetic mechanism of Tibetan sheep immunity at the molecular level, and screening corresponding molecular markers for more efficient use in Tibetan sheep breeding is an important issue in this field. There are not many molecular markers related to Tibetan sheep immunity in the prior art for molecular marker-assisted selection related to immunity. It is urgent to provide a molecular marker related to the immune traits of Tibetan sheep, so as to be used in Tibetan sheep molecular marker-assisted breeding, and screen Tibetan sheep with high disease resistance. Summary of the invention

[0005] The purpose of the present invention is to provide a method for detecting SNP of METAP1D gene of Tibetan sheep and application thereof in early screening of immune traits.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a SNP molecular marker for early screening of immune traits of Tibetan sheep, wherein the SNP molecular marker is located at the 297th position of the METAP1D gene fragment, and the mutant base is G or A;

[0008] The METAP1D gene is shown as SEQ ID NO.1.

[0009] Preferably, the SNP molecular marker is located at the 136665315th base on chromosome 2 of the sheep reference genome Oar_v4.0 version.

[0010] Preferably, when the mutant base is G, the genotype of the Tibetan sheep is GG or GA;

[0011] When the mutated base is A, the genotype of Tibetan sheep is AA;

[0012] The immunoglobulin content in Tibetan sheep with genotype AA was significantly higher than that in Tibetan sheep with genotype GG or GA.

[0013] There was no significant difference in the immunoglobulin content between the Tibetan sheep with genotype GG and the Tibetan sheep with genotype GA.

[0014] The immunoglobulin is one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.

[0015] The present invention also provides the use of the SNP molecular marker in the early screening of immune traits of Tibetan sheep for non-diagnostic purposes.

[0016] The present invention also provides application of the SNP molecular marker in Tibetan sheep assisted breeding.

[0017] The present invention also provides a primer pair for amplifying the SNP molecular marker, and the primer pair is shown in SEQ ID NO. 2-3.

[0018] The present invention also provides the use of the primer pair in early screening of Tibetan sheep immune traits for non-diagnostic purposes and / or in Tibetan sheep assisted breeding.

[0019] The present invention also provides a method for detecting a SNP molecular marker of a Tibetan sheep METAP1D gene, comprising the following steps:

[0020] (1) Extracting Tibetan sheep genomic DNA;

[0021] (2) using the genomic DNA obtained in step (1) as a template and using the primer pair to amplify to obtain the METAP1D gene;

[0022] (3) performing genotyping analysis on the polymorphic sites of the METAP1D gene obtained in step (2);

[0023] The amplification system in step (2) is: 21-23 μL of gold mix (green), 0.8-1.2 μL of upstream and downstream primers, and 0.8-1.2 μL of template;

[0024] The amplification program in step (2) is: 98°C for 2 min; 98°C for 10 s, 58°C for 10 s, 72°C for 10 s, for a total of 40 cycles; and extension at 72°C for 2 min.

[0025] The present invention also provides the application of the detection method in the early screening of Tibetan sheep immune traits for non-diagnostic purposes and / or Tibetan sheep assisted breeding.

[0026] The invention also provides a kit for early screening of immune traits of Tibetan sheep, comprising the SNP molecular marker or the primer pair.

[0027] The present invention provides a detection method for SNP of the METAP1D gene of Tibetan sheep and its application in early screening of immune traits, and relates to a SNP molecular marker for early screening of immune traits of Tibetan sheep, wherein the SNP molecular marker is located at the 297th position of the METAP1D gene fragment and at the 136665315th base on chromosome 2 of the sheep reference genome Oar_v4.0 version. The mutant base is G or A; the METAP1D gene is shown in SEQ ID NO.1. When the mutated base is G, the genotype of the Tibetan sheep is GG or GA; when the mutated base is A, the genotype of the Tibetan sheep is AA; through the association analysis between different genotypes and the content of immunoglobulin A, immunoglobulin G, and immunoglobulin M, it is found that the content of immunoglobulin A, immunoglobulin G, and immunoglobulin M in Tibetan sheep individuals with genotype AA is significantly higher than that in Tibetan sheep individuals with genotype GG or GA (p<0.05); the content of immunoglobulin A, immunoglobulin G, and immunoglobulin M in Tibetan sheep individuals with genotypes GG and GA is not significantly different. The present invention also provides a primer pair that can amplify the METAP1D gene fragment. Using the primer pair and the detection method of the Tibetan sheep METAP1D gene SNP molecular marker, the content of immunoglobulin A, immunoglobulin G, and immunoglobulin M in Tibetan sheep individuals can be obtained, providing a new molecular marker resource for the marker-assisted selection of Tibetan sheep immune traits for non-diagnostic purposes. Provide a basis for breeding Tibetan sheep with high immunity and high disease resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 is the PCR amplification product; M represents Marker; 1, 2, and 3 represent three groups of repetitions.

[0029] Figure 2 The peak diagram and sequence are obtained after the PCR product is purified and sequenced. DETAILED DESCRIPTION

[0030] The present invention provides a SNP molecular marker for early screening of immune traits of Tibetan sheep, wherein the SNP molecular marker is located at the 297th position of the METAP1D gene fragment, and the mutant base is G or A;

[0031] The METAP1D gene is shown as SEQ ID NO.1.

[0032] SEQ ID NO.1: CTGATTTCTGCCCAATTGTGTGGTCATTCGTTCATCTTAAGATGTTTCAGAAATTGAAAAAAATGTTGAAGGCACTAGGAAAAATTTTACAGATTACTATATTGTGAAAATGAGACTAAGCATAAAAGCAAGAAGGCTTTTTCTGGT TTCTGTAGCAAACACAATGTCTAAGTAGGCAGCTATGGATTCACTGTGAAAGCTTTAAAAGCCTAACCTAGAAAAGGAAAAATCCATGATGAGAAGGAGAAAGTTCTTCCATGAACTACTTACTAAGTCAAAATACAGGGCTCTCCCTAGGTAAGAATAGCTCTCAGCTGCTAACATGACA TAAAGAGAGATAAACAGACATGTGCCTTCTGATGGAAGGATATGACATTACCAATGGTGCATTTTAGTCCCCAAATTGAACTTTAATCTGATCAAACTTCAGGATGGAAGTGGTGGAATTTATAGGATACACAGGGGAAAGAAAATGATAAATGACATCATGGGGATAAAATCAGAAAAT.

[0033] In the present invention, the SNP molecular marker is located at the 136665315th base on chromosome 2 of the sheep reference genome Oar_v4.0 version.

[0034] In the present invention, when the mutant base is G, the genotype of the Tibetan sheep is GG or GA;

[0035] When the mutated base is A, the genotype of Tibetan sheep is AA;

[0036] The immunoglobulin content in Tibetan sheep with genotype AA was significantly higher than that in Tibetan sheep with genotype GG or GA.

[0037] There was no significant difference in the immunoglobulin content between the Tibetan sheep with genotype GG and the Tibetan sheep with genotype GA.

[0038] The immunoglobulin is one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.

[0039] The present invention also provides the use of the SNP molecular marker in the early screening of immune traits of Tibetan sheep for non-diagnostic purposes.

[0040] The present invention also provides application of the SNP molecular marker in Tibetan sheep assisted breeding.

[0041] The present invention also provides a primer pair for amplifying the SNP molecular marker, and the primer pair is shown in SEQ ID NO. 2-3.

[0042] SEQ ID NO.2 is an upstream primer, and the specific sequence is: 5'-CTGATTTCTGCCCAATTGTG-3'; SEQ ID NO.3 is a downstream primer, and the specific sequence is: 5'-ATTTTCTGATTTTATCCCCATG-3'. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0043] The present invention also provides the use of the primer pair in early screening of Tibetan sheep immune traits for non-diagnostic purposes and / or in Tibetan sheep assisted breeding.

[0044] The present invention also provides a method for detecting a SNP molecular marker of a Tibetan sheep METAP1D gene, comprising the following steps:

[0045] (1) Extracting Tibetan sheep genomic DNA;

[0046] (2) using the genomic DNA obtained in step (1) as a template and using the primer pair to amplify to obtain the METAP1D gene;

[0047] (3) performing genotyping analysis on the polymorphic sites of the METAP1D gene obtained in step (2);

[0048] The amplification system in step (2) is: 21-23 μL of gold mix (green), preferably 22 μL; 0.8-1.2 μL of upstream and downstream primers, preferably 1.0 μL; 0.8-1.2 μL of template, preferably 1.0 μL; in the present invention, the amplification system is preferably 25 μL.

[0049] The amplification program in step (2) is: 98°C for 2 min; 98°C for 10 s, 58°C for 10 s, 72°C for 10 s, for a total of 40 cycles; and extension at 72°C for 2 min.

[0050] The present invention also provides the application of the detection method in the early screening of Tibetan sheep immune traits for non-diagnostic purposes and / or Tibetan sheep assisted breeding.

[0051] The invention also provides a kit for early screening of immune traits of Tibetan sheep, comprising the SNP molecular marker or the primer pair.

[0052] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0053] Example 1

[0054] 1. Sample collection

[0055] The samples came from Tibetan sheep populations under natural grazing conditions, including 48 samples from Gannan Tibetan Autonomous Prefecture, Gansu Province, 50 samples from Yushu Prefecture, Qinghai Province, and 40 samples from Shigatse City, Tibet Autonomous Region. 5 mL of blood samples were collected from 138 fasting Tibetan sheep in a clean pro-coagulant vacuum blood collection tube, left to stand for 30 minutes, and then centrifuged at 3500r / min for 15 minutes. The supernatant was aspirated into a clean PE tube, which was sealed and stored in a -20℃ low-temperature refrigerator. Another 5 mL of blood sample was collected in a blood collection tube with EDTA-K2 anticoagulant added. After the blood sample was collected, it was quickly mixed and temporarily stored in a sampling box containing ice packs. After being transported back to the laboratory, it was frozen in a -20℃ refrigerator for DNA extraction.

[0056] 2 Main reagents and instruments

[0057] Blood collection tubes with EDTA-K2 anticoagulant were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; the blood genomic DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; NanoDrop2000 spectrophotometer was purchased from ThermoFisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dyes were purchased from Beijing Solebow Technology Co., Ltd.; Gold Medal Mix (green) was purchased from Beijing Qingke Biotechnology Co., Ltd.; electrophoresis instrument was purchased from Beijing Liuyi Instrument Factory; PCR instrument was purchased from BioRad. Immunoglobulin A (IgA) (E027-1-1), immunoglobulin G (IgG) (E026-1-1), and immunoglobulin M (IgM) (E025-1-1) detection kits were purchased from Nanjing Jiancheng Bioengineering Institute.

[0058] 3 Methods

[0059] 3.1 Immunoglobulin IgA, IgG, and IgM detection

[0060] According to the IgA, IgG, and IgM detection kits of Nanjing Jiancheng Bioengineering Institute, the determination was performed using a spectrophotometer. First, a standard curve was established using a standard product; secondly, distilled water, a standard solution, and 7 μL of the sample to be tested were added to the blank tube, standard tube, and measurement tube, respectively, and R1 solution was added to 900 μL, incubated at 37°C for 5 minutes, and the reading at a wavelength of 340 nm was recorded as A1; then 180 μL of R2 solution was added to each tube, incubated at 37°C for 5 minutes, and the reading at a wavelength of 340 nm was recorded as A2; finally, △A was calculated as A2-A1, and △A was substituted into the standard curve equation to calculate the sample IgA, IgG, and IgM concentrations.

[0061] 3.2 Extraction of genomic DNA from blood

[0062] The blood genome extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration was greater than 20 ng / μL and OD260 / OD280 was between 1.7 and 1.9, which met the experimental requirements. It was stored at -20°C for future use.

[0063] 3.3 Primer design

[0064] Referring to the chromosome 2 gene sequence of the international sheep genome Oar_v4.0 version (GenBank accession number: NC_019459.2), a pair of specific primers were designed using primerpremier5.0 software, including the g136665315G>A SNP site. The nucleotides of the primer pair are shown in SEQ ID NO.2-3. SEQ ID NO.2 is the upstream primer, and its sequence is: 5'-CTGATTTCTGCCCAATTGTG-3'; SEQ ID NO.3 is the downstream primer, and its sequence is: 5'-ATTTTCTGATTTTATCCCCATG-3'.

[0065] The length of the amplified fragment was 508 bp, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0066] 3.4 PCR amplification and sequencing

[0067] PCR amplification system 25 μL: Gold Mix (green) 22 μL, upstream and downstream primers 1 μL each, template DNA 1 μL.

[0068] PCR amplification program: 98°C for 2 min; 98°C for 10 s, 58°C for 10 s, 72°C for 10 s, for a total of 40 cycles; extension at 72°C for 2 min.

[0069] The PCR product was detected by 1.5% agarose gel electrophoresis. After the PCR product was qualified by agarose gel electrophoresis, it was sequenced by direct sequencing, and the sequencing was completed by Beijing Qingke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID NO.1, and the SNP marker is located at position 297 of the nucleotide sequence described in SEQ ID NO.1. The amplified fragment is the METAP1D gene.

[0070] The biological analysis software MEGA6.0 was used to compare the sequencing results of PCR products, analyze the sequencing peak graph, and complete the typing.

[0071] SEQ ID NO.1:

[0072] CTGATTTCTGCCCAATTGTGTGGTCATTCGTTCATCTTAAGATGTTTCAGAAATTGAAAAAAATGTTGAAGGCACTAGGAAAAATTTTACAGATTACTATATTGTGAAAATGAGACTAAGCATAAAAGCAAGAAGGCTTTTCTGGTTTCTGTAGCAAACACAATGTCTAAGTAGGCAGCTATGGATTCACTGTGAAAGCTTTAAAAGCCTAACCTAGAAAAGGAAAAATCCATGATGAGAAGGAGAAAGTTCTT CCATGAACTACTTACTAAGTCAAAATACAGGGCTCTCCCTAGGTAAGAATAGCTCTCAGCTGCTAACATGACATAAAGAGAGATAAACAGACATGTGCCTTCTGATGGAAGGATATGACATTACCAATGGTGCATTTTAGTCCCCAAATTGAACTTTAATCTGATCAAACTTCAGGATGGAAGTGGTGGAATTTATAGGATACACAGGGGAAAGAAAAATGATAAATGACATCATGGGGATAAAATCAGAAAAT.

[0073] 4 Statistical analysis

[0074] According to the genotyping results, the number of individuals with different genotypes at each site was counted. Popgen32 software was used to calculate the g136665315G>A gene frequency, genotype frequency, effective allele number (Ne), site heterozygosity (He), and Hardy-Weinberg equilibrium test, and PIC (polymorphism information content, referred to as PIC) calculation software was used to calculate the polymorphic information content. The general linear model in IBM SPSS Statistics 22 software was used to analyze the association between different genotypes of Tibetan sheep and immunoglobulins IgA, IgG, and IgM, and the results were expressed as "mean ± standard error".

[0075] 5 Results

[0076] 5.1 PCR amplification and sequencing results

[0077] The amplified product of the g136665315G>ASNP site of the second chromosome of Tibetan sheep was detected by 1.5% agarose gel (see Figure 1 ), the bands were clear without any other bands, the specificity was good, and the PCR product fragment size was 508bp, which was in line with the expected size, so the next step of the experiment could be carried out.

[0078] The peak diagram and sequence obtained after the PCR product was purified and sequenced are shown in Figure 2 .Depend on Figure 2 It can be seen that the GA mutation occurred at the g136665315G>ASNP site, and there are three genotypes: GG, GA, and AA.

[0079] 5.2 Statistical analysis results

[0080] The genotype and allele frequencies of the g136665315G>ASNP locus on chromosome 2 of Tibetan sheep were analyzed from the perspective of population genetics. As shown in Table 1, at the g136665315G>ASNP locus, the GG genotype frequency was the highest, which was the dominant genotype, and the G allele frequency was 91.3%, which was a dominant allele. The χ2 fitness test showed that the SNP locus significantly deviated from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of this locus was 1.189, the PIC was 0.146, and the PIC was <0.25, which was a low degree of polymorphism.

[0081] Table 1 Polymorphism of g136665315G>ASNP locus on chromosome 2 of Tibetan sheep

[0082]

[0083] 5.3 Association analysis between different genotypes and IgA, IgG, and IgM

[0084] The general linear model in IBMSPSSStatistics22 software was used to analyze the association between different genotypes of Tibetan sheep and the content of immunoglobulins IgA, IgG, and IgM. The results showed that the immunoglobulins IgA, IgG, and IgM of Tibetan sheep individuals with AA genotype were significantly higher than those of individuals with GG and GA genotypes (p<0.05), and the immunoglobulins IgA, IgG, and IgM of Tibetan sheep individuals with GG and GA genotypes were not significantly different. This indicates that the bases of the g136665315G>ASNP site on chromosome 2 of Tibetan sheep are significantly correlated with IgA, IgG, and IgM of Tibetan sheep, and are SNP markers related to IgA, IgG, and IgM of Tibetan sheep. The results are shown in Table 2.

[0085] Table 2 Relationship between different genotypes and immunoglobulins A, G and M

[0086]

[0087] Note: Different lowercase letters between data in the same row indicate significant differences (P<0.05).

[0088] The present invention provides a detection method for SNP of the METAP1D gene of Tibetan sheep and its application in early screening of immune traits, and relates to a SNP molecular marker for early screening of immune traits of Tibetan sheep, wherein the SNP molecular marker is located at the 297th position of the METAP1D gene fragment and at the 136665315th base on chromosome 2 of the sheep reference genome Oar_v4.0 version. The mutant base is G or A; the METAP1D gene is shown in SEQ ID NO.1. When the mutated base is G, the genotype of the Tibetan sheep is GG or GA; when the mutated base is A, the genotype of the Tibetan sheep is AA; through the association analysis between different genotypes and the content of immunoglobulin A, immunoglobulin G, and immunoglobulin M, it is found that the content of immunoglobulin A, immunoglobulin G, and immunoglobulin M in Tibetan sheep individuals with genotype AA is significantly higher than that in Tibetan sheep individuals with genotype GG or GA (p<0.05); the content of immunoglobulin A, immunoglobulin G, and immunoglobulin M in Tibetan sheep individuals with genotypes GG and GA is not significantly different. The present invention also provides a primer pair that can amplify the METAP1D gene fragment. Using the primer pair and the detection method of the Tibetan sheep METAP1D gene SNP molecular marker, the content of immunoglobulin A, immunoglobulin G, and immunoglobulin M in Tibetan sheep individuals can be obtained, providing a new molecular marker resource for the marker-assisted selection of Tibetan sheep immune traits for non-diagnostic purposes. Provide a basis for breeding Tibetan sheep with high immunity and high disease resistance.

[0089] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting SNP molecular markers of the Tibetan sheep METAP1D gene in the preparation of a product for early screening of Tibetan sheep immune traits for non-diagnostic purposes, characterized in that: The SNP molecular marker is located at the 297th position of the METAP1D gene fragment, at the 136665315th base on chromosome 2 of the sheep reference genome Oar_v4.0 version, and the mutant base is G or A; The METAP1D gene is shown in SEQ ID NO.1; According to the molecular marker alleles, Tibetan sheep have three genotypes: GG, GA or AA; The immunoglobulin content in Tibetan sheep with genotype AA was significantly higher than that in Tibetan sheep with genotype GG or GA. There was no significant difference in the immunoglobulin content between the Tibetan sheep with genotype GG and the Tibetan sheep with genotype GA. The reagent is a primer pair, and the primer pair is shown as SEQ ID NO.2-3.

2. Use of a reagent for detecting SNP molecular markers of the Tibetan sheep METAP1D gene in the preparation of a product for assisting breeding of Tibetan sheep with high immunity, characterized in that: The SNP molecular marker is located at the 297th position of the METAP1D gene fragment, at the 136665315th base on chromosome 2 of the sheep reference genome Oar_v4.0 version, and the mutant base is G or A; The METAP1D gene is shown in SEQ ID NO.1; According to the molecular marker alleles, Tibetan sheep have three genotypes: GG, GA or AA; The immunoglobulin content in Tibetan sheep with genotype AA was significantly higher than that in Tibetan sheep with genotype GG or GA. There was no significant difference in the immunoglobulin content between the Tibetan sheep with genotype GG and the Tibetan sheep with genotype GA. The reagent is a primer pair, and the primer pair is shown as SEQ ID NO.2-3.

3. The use according to claim 1 or 2, characterized in that: The immunoglobulin is one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.

Images