Identification of a QTL for total root surface area at the seedling stage of wheat under drought stress and its linked KASP marker

Abstract

The present invention discloses a QTL for root surface area of ​​wheat seedling root system under drought stress QDTRS.daas‑4AL and its linkage markers available for breeding; the QTL is located on chromosome 4A of wheat, and the KASP marker closely linked to it is Kasp_4AL_DTRS , which can be used to QDTRS.daas‑4AL The KASP primer sequences used for auxiliary selection and amplification of markers are detailed in the text; the method for screening genes containing root surface area of ​​seedling roots under drought stress is to use the wheat genomic DNA to be tested as a template, perform PCR amplification with the KASP primers in the sequence list, and identify markers in the amplified products that are closely linked to the QTL Kasp_ 4AL_DTRS The genotype was determined, and 4 µl of the amplification reaction was used. The reaction system was as follows: 0.048 μl Primer Mix, 2.0 μl Master Mix, 1.952 μl Template DNA (50 ng / μl). The ratio of Primer Mix was: 12% HEX primer, 12% FAM primer, 30% Common primer. A 384-well PCR instrument was used for amplification.

Description

Technical Field

[0001] The invention comprises the identification of QTL of total root surface area of ​​wheat root system at seedling stage under drought stress and its linked KASP marker. Background Art

[0002] Common wheat is a major food crop in the world and is severely affected by abiotic stresses. Therefore, cultivating varieties that can maintain high yields under abiotic stress conditions has become one of the key goals of wheat breeding. The root structure in the seedling stage not only plays a core role in the plant's absorption of nutrients and water from the soil, but is also extremely critical for improving the plant's adaptability to environmental stresses. The morphological characteristics of the seedling root system include parameters such as root length, root surface area, and root volume. Among them, the root surface area has a significant correlation with the plant's ability to absorb nutrients and water. The seedling root system is hidden underground and cannot be directly used for high-throughput phenotyping in the field. Traditional breeding methods often focus on the selection of aboveground traits, but ignore the optimization of seedling root-related characteristics. The total root surface area of ​​wheat seedling roots is controlled by micro-effect genes and is significantly affected by environmental factors.

[0003] KASP markers have been widely used in genotyping of crops such as wheat, rice, and corn to achieve high-throughput genotyping; by utilizing the genotype data of the wheat SNP chip, QTL positioning and genome-wide association analysis are performed, and then the relevant SNPs are converted into KASP markers, which can be directly applied to the breeding process of molecular marker-assisted selection; therefore, discovering the sites that control the total root surface area of ​​wheat roots at the seedling stage and developing corresponding KASP markers are of great significance for promoting the breeding of high-yield and stable varieties. Summary of the invention

[0004] The invention relates to a QTL gene for total root surface area of ​​root system at seedling stage under drought stress and a molecular marker linked thereto, which can be used for molecular marker-assisted selection of total root surface area of ​​root system at seedling stage in breeding in arid areas.

[0005] The present invention provides a tightly linked KASP marker for screening QTLs for total root surface area of ​​seedling roots under drought stress Kasp_4AL_DTRS , the sequence is as follows:

[0006] Primer A: GAAGGTGACCAAGTTCATGCTCATTGCCAAATGTTTGCTGTATT

[0007] Primer B: GAAGGTCGGAGTCAACGGATTCATTGCCAAATGTTTGCTGTATC

[0008] Primer C: CATTATCAGATGATACCACGTCG

[0009] Note: GAAGGTGACCAAGTTCATGCT is the tag sequence FAM,

[0010] GAAGGTCGGAGTCAACGGATT is the tag sequence HEX;

[0011] SNP marker sequence: wsnp_Ex_c7280_12498193 (No. 101)

[0012] TTCGGGCCGCCGTGCCGTTCCTTGATCCACTTGAAGCACTGCAGCTTCCCCGATTCCCACGAGCTGTAAACATTATCAGATGATACCACGTCGTCCAGGC[A] / [G]ATACAGCAAACATTTGGCAATGCTCGGAACCAGGGACCCTGAAGTCACTATGCAATTGATACTTGAAGATTTGACAGCAGGCTCAGGTGTTGATTTACCC.

[0013] KASP amplification requires two forward competitive primers (HEX and FAM complementary base sequences, other sequences differ only at the 3' end of SNP and InDel) and one reverse common primer; the PCR reaction system contains a universal sequence modified with a fluorescent group and a quenching group (Master Mix provided by LGC), and the two forward primers can emit two different colors of light. If the site in the template chain is homozygous, a single fluorescence that matches it will be emitted, and if it is heterozygous, two fluorescences will be emitted; each 4 µl PCR amplification system is as follows: 0.048 μl Primer Mix, 2.0 μl Master Mix, 1.952μl Template DNA (50 ng / μl), Primer Mix ratio: 12% HEX primer, 12% FAM primer, 30% Common primer (Shanghai Biotech); amplification uses a 384-well PCR instrument (BIO-RAD, S1000TM Thermal Cycler), and the program is as follows: 94℃ 15 min; 94℃ 20s, 65-57℃ 1 min (0.8℃ drop in each cycle), 10 cycles; 94℃ 20s, 55℃ 60s, 32 cycles; the PCR amplification product was placed in an automatic focusing fluorescence multifunctional microplate reader (PHERAstarplus SNP, BMG LABTECH) to read the final fluorescence data and imported into Klustercaller v3.4 software (LGC, Hoddesdon, UK) for typing.

[0014] The primer pairs (labels) were used for PCR amplification method. The amplification reaction was 4 µl and the reaction system was as follows: 0.048 μl PrimerMix, 2.0 μl Master Mix, 1.952 μl Template DNA (50 ng / μl). The ratio of Primer Mix was: 12% HEX primer, 12% FAM primer, 30% Common primer. A 384-well PCR instrument was used for amplification with the following program: 94°C for 15 min; 94°C for 20 s, 65-57°C for 1 min (0.8°C decrease for each cycle), 10 cycles; 94°C for 20 s, 55°C for 60 s, 32 cycles.

[0015] The method for detecting amplification products is to place the amplification products in an automatic focusing fluorescence multifunctional microplate reader to read fluorescence data, and import the data into software for genotyping.

[0016] The primer pair (marker) is used in preparing a kit for assisting in screening QTL of total root surface area of ​​wheat root system at seedling stage under drought stress.

[0017] A kit for assisting in screening QTL wheat for total root surface area of ​​root system at seedling stage under drought stress, comprising primer pairs (markers), and application of the kit in wheat breeding.

[0018] The method and the kit both belong to the protection scope of the present invention.

[0019] Beneficial effects: The present invention constructs a recombinant inbred line (RIL) population containing 249 families based on the common wheat varieties Doumai and Shi 4185. The present invention uses a genetic map constructed by a 50K chip to conduct linkage analysis on root area, and identifies a root surface area QTL on chromosome 4A, which is closely linked to wsnp_Ex_c7280_12498193 (725.6 Mb), and can explain 9.6% of the phenotypic variation, named QDTRS.daas-4AL. The KASP marker Kasp_4AL_DTRS developed from a marker closely linked to it can be used as a molecular marker-assisted breeding.

[0020] The present invention discloses a QTL QDTRS.daas-4AL for the root surface area of ​​wheat seedlings under drought stress and a linkage marker that can be used for breeding. The QTL is located on chromosome 4A of wheat, and the KASP marker that is closely linked to it is Kasp_4AL_ DTRS , which can be used to QDTRS.daas-4ALThe sequence of KASP primers used for auxiliary selection and amplification of markers is shown in the text. The method for screening genes containing root surface area of ​​seedling roots under drought stress is to use the wheat genomic DNA to be tested as a template, perform PCR amplification with KASP primers in the sequence list, and identify markers in the amplified product that are closely linked to the QTL. Kasp_4AL_DTRS genotype.

[0021] The present invention also protects a QTL gene for total root surface area of ​​wheat seedling root system and its linked molecular marker, the QTL is named QDTRS.daas-4AL , located on chromosome 4A; its closely linked SNP marker is wsnp_Ex_c7280_ 12498193 (725.6 Mb), which can explain 9.6% of the phenotypic variation. Specifically, the molecular marker can be obtained by amplifying the genomic DNA of Doumai and Shi 4185 by the primer pair. The present invention provides a marker for the total root surface area gene QTL of wheat seedling root system under drought stress, which can be used for molecular marker-assisted screening of seedling root system genes under drought stress.

[0022] The molecular marker detection is accurate and efficient, the amplification is convenient and stable, the operation is simple and easy, and the effect is fast. It can be used for molecular marker-assisted selection to improve identification efficiency.

[0023] The molecular marker can be applied to auxiliary selection of genes for total root surface area of ​​wheat root system at seedling stage under drought stress in wheat breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 KASP Mark Kasp_4AL_DTRS Genotyping results of 108 wheat varieties. DETAILED DESCRIPTION

[0025] The following examples are provided for better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples can be purchased from conventional biochemical reagent stores unless otherwise specified.

[0026] Example 1, discovery of a QTL for total root surface area of ​​seedling roots under drought stress in Doumai / Shi 4185 RIL population and acquisition of its KASP marker:

[0027] 1. Acquisition of phenotype

[0028] For the Doumai / Shi 4185 RIL population, plump and uniform-sized wheat seeds were selected, soaked in 10% H2O solution for 10 min, rinsed with deionized water three times, and then cultured on moist filter paper (25°C). At the one-leaf-one-heart stage, seedlings with uniform growth were selected and transferred to Hoagland culture solution (16h light / 8h dark, 22-25°C) with 20% PEG6000 for further culture. The nutrient solution was replaced every 3 days. After 21 days, the roots were rinsed with deionized water and placed in a transparent root tray filled with deionized water. The seedling roots were scanned using WinRHIZOLA6400XL (Epson) large-format perspective scanner dedicated to seedling roots, and the total root surface area of ​​the seedling roots of each sample was analyzed using WinRHIZOPro software. The genomic DNA of young leaves of 249 families was extracted by CTAB method, and the DNA samples were adjusted to a standard concentration of 50 ng / ul using NanoDrop2000c, and the qualified DNA was used for SNP typing. SNP analysis was performed using Illumina's 90K SNP chip.

[0029] 2. Construction of linkage map

[0030] The 90K SNP chip contains a total of 80,547 markers, and there are 11,012 markers that differ between the parents. After removing markers with heterozygous and missing rates greater than 10% between the parents, the IciMapping 4.1 bin function was used to remove redundant markers and construct linkage groups. The total length of the genetic map was 2030.0 cM.

[0031] 3. QTL Analysis

[0032] The IciMapping 4.1 ICIM-ADD method was used for QTL analysis, with an LOD value of 3.0. A stable QTL was located on chromosome 4A and named QDTRS.daas-4AL ,and wsnp_Ex_c7280_12498193 (725.6 Mb) is tightly linked and can explain 9.6% of the phenotypic variation. wsnp_Ex_c7280_12498193 Convert to Kasp_ 4AL_DTRS , and detected the genotypes of 108 wheat varieties.

[0033] 4. Use of primer pairs

[0034] The experimental materials are 108 wheat varieties, see Table 1 for details.

[0035] 1. For 108 wheat varieties, plump and uniform-sized wheat seeds were selected, soaked in 10% H2O solution for 10 min, rinsed with deionized water three times, and then cultured on moist filter paper (25°C). At the one-leaf-one-heart stage, seedlings with uniform growth were selected and transferred to Hoagland culture solution containing 20% ​​PEG6000 (16h light / 8h dark, 22-25°C) for continued cultivation. The nutrient solution was replaced every 3 days. After 21 days, the roots were rinsed with deionized water and placed in a transparent root tray filled with deionized water. The seedling roots were scanned using WinRHIZOLA6400XL (Epson) large-format perspective scanner dedicated to seedling roots, and the total root surface area of ​​the seedling roots was obtained using WinRHIZOPro software.

[0036] 2. Utilize Kasp_4AL_DTRS All experimental materials were labeled and tested. The results are shown in Tables 1, 2 and Figure 1 .

[0037] Figure 1 The detected genotypes of Kasp_4AL_DTRS in 108 varieties, Figure 1 Kasp_4AL_DTRS genotyping results of 108 wheat varieties (red is Shi 4185 genotype GG, blue is Doumai genotype AA, green is heterozygous AG, pink is test failure); Among the 108 wheat varieties, 42 varieties showed Doumai genotype AA (blue), with a total root surface area of ​​5.97; 60 varieties showed Shi 4185 genotype GG (red), with a total root surface area of ​​6.99; Statistical test showed QDTRS.daas-4AL The gene effects reached significant differences ( P <0.05).

[0038] Table 1 Genotype detection results of 108 wheat varieties and total root surface area at seedling stage under drought stress

[0039] serial number Variety name genotype <![CDATA[Total root surface area (cm 2 )]]> 1 Dwarf Anti-58 GG 7.7 2 Bainong3217 AA 3.1 3 Bainong64 GG 9.2 4 Bima No.4 GG 2.4 5 Gaoyou 503 GG 5.2 6 Gaocheng 8901 GG 10.4 7 Huapei No.5 GG 3.6 8 Huaimai 18 GG 5.9 9 Huaimai 20 AA 6.1 10 Huaimai 21 AA 3.2 11 Jimai 19 NN 11.4 12 Jimai 20 GG 6.0 13 Jimai 21 AA 2.2 14 Jimai 22 AA 6.3 15 Jinan 13 AA 4.1 16 Jinan 17 AA 2.1 17 Jining 16 AA 2.1 18 Hebei Normal University 02-1 GG 1.7 19 Jinmai 61 GG 4.8 20 Lankao24 AA 4.2 21 Lankao No.2 AA 9.4 22 Lankao 906 AA 5.3 23 Good Star 66 AA 12.8 24 Good Star 99 GG 3.3 25 Linhan 2 GG 5.8 26 Linkang 12 AA 5.6 27 Linmai No.2 GG 5.0 28 Linmai No.4 AA 4.0 29 Lumai 15 GG 3.6 30 Lumai 21 GG 5.8 31 Lumai 23 AA 6.8 32 Lumai No.5 AG 3.6 33 Lumai No.6 AA 5.6 34 Lumai No.7 GG 6.6 35 Lumai No.8 GG 3.9 36 Lumai No.9 GG 10.9 37 Luyuan 502 GG 7.1 38 Luohan No.2 AA 6.8 39 Lomai 21 GG 8.9 40 Neixiang 188 GG 5.9 41 No. 5 Neixiang AA 6.8 42 Shannong 20 GG 9.5 43 Shaanxi 150 GG 6.8 44 Shaanxi 229 GG 10.5 45 Shaanxi 253 GG 12.2 46 Shaanxi 354 AA 5.9 47 Shaanxi 512 AA 5.0 48 Shaanxi 715 AA 7.0 49 Shaanxi wheat 94 AA 11.3 50 Shaanxi Agricultural 78-59 AA 5.0 51 Shanyou 225 AA 7.1 52 Stone 4185 GG 5.4 53 Shijiazhuang 15 AA 4.3 54 Shi Xin 733 AA 5.9 55 Shiyou17 GG 7.1 56 Su Nong No.6 GG 11.6 57 Taishan No. 5 GG 8.8 58 Wanmai 19 GG 11.3 59 Wanmai 29 GG 8.4 60 Wanmai 38 GG 11.8 61 Wanmai 50 GG 13.8 62 Wanmai 52 GG 7.1 63 Wanmai 53 GG 9.5 64 Wennong 14 AA 7.7 65 Wennong No.5 GG 10.2 66 Wunong 148 AA 3.2 67 Northwest A&F University 291 GG 5.0 68 Xiaoyan22 AA 8.1 69 Xiaoyan54 AA 5.6 70 Xiaoyan No. 6 AA 8.6 71 Xiaoyan81 AA 6.9 72 Xinmai 19 GG 9.0 73 New wheat 9 AG 2.8 74 Tobacco Farmer 18 GG 6.0 75 Tobacco Farmer 19 GG 6.0 76 Yanzhan 4110 NN 5.8 77 Yumai 18 AA 8.6 78 Yumai 21 AA 5.3 79 Yumai No.2 AA 5.5 80 Yumai 34 GG 9.2 81 Yumai 35 GG 5.4 82 Yumai 47 AG 5.6 83 Yumai 49 GG 7.1 84 Yumai 50 AA 1.9 85 Yumai 63 AA 7.2 86 Yumai No.7 GG 6.2 87 Zheng 9023 AA 4.5 88 Zhengmai 366 GG 5.6 89 Zhengyin No. 1 GG 8.6 90 Zhengzhou No. 3 AA 9.4 91 Zhongmai 871 GG 10.8 92 Zhongmai 875 GG 7.0 93 Zhongmai 895 GG 9.2 94 Zhongyu No.5 GG 7.1 95 Zhou 8425B GG 6.0 96 Zhou Mai 16 GG 5.5 97 Zhou Mai 18 GG 2.6 98 Zhou Mai 19 GG 3.9 99 Zhou Mai 22 GG 4.7 100 Zhou Mai 23 GG 5.3 101 Zhou Mai 25 GG 4.5 102 Zhou Mai 26 NN 8.4 103 Zhou Mai 28 GG 5.6 104 Zhou Mai 30 AA 5.5 105 Zhou Mai 31 GG 3.8 106 Zhou Mai 32 AA 9.0 107 Zimai 12 AA 5.6 108 Zixuan No. 2 GG 7.9

[0040] “NN” represents missing phenotypic or genotypic data.

[0041] Table 2 QDTRS.daas-4AL Root surface area at seedling stage corresponding to different alleles in 108 natural populations

[0042]

[0043] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. It should be pointed out that a person skilled in the art can make several improvements and modifications without departing from the technical principles of the present invention, and these improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A KASP primer set for screening QTLs for total root surface area of ​​wheat seedlings under drought stress, characterized in that: It comprises primer A, primer B and primer C, wherein the nucleotide sequence of primer A is: GAAGGTGACCAAGTTCATGCTCATTGCCAAATGTTTGCTGTATT; The nucleotide sequence of primer B is: GAAGGTCGGAGTCAACGGATTCATTGCCAAATGTTTGCTGTATC; The nucleotide sequence of primer C is: CATTATCAGATGATACCACGTCG; among them, GAAGGTGACCAAGTTCATGCT is the tag sequence FAM, GAAGGTCGGAGTCAACGGATT is the tag sequence HEX.

2. Use of the primer set according to claim 1 in preparing a kit for assisting in screening QTLs for total root surface area of ​​wheat seedling roots under drought stress.

3. A kit for assisting in screening QTLs for total root surface area of ​​wheat seedlings under drought stress, characterized in that: Contains the primer set according to claim 1.

4. Use of the primer set according to claim 1 or the kit according to claim 3 in wheat breeding.

Images