A double-site sgRNA for knocking out VP1u gene of duck short beak dwarf syndrome virus and a CRISPR / Cas9 system and application thereof
By designing a dual-site sgRNA and CRISPR/Cas9 system, the VP1u gene of the duck short-beak dwarf syndrome virus was specifically targeted and knocked out, solving the problem of difficult effective knockout in existing technologies, achieving viral replication prevention and efficient gene editing, and providing technical support for viral function research and treatment.
Patent Information
- Application Number
- CN202410611236.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-16
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2044-05-16
AI Technical Summary
Existing technologies make it difficult to effectively target and knock out the VP1u gene of the duck short-beak dwarf syndrome virus, which affects viral replication and host cell infection, and there is a lack of effective gene editing technology.
A dual-site sgRNA (up3-sgRNA and ud3-sgRNA) and CRISPR/Cas9 system were designed and constructed to specifically target and knock out the SBDSV VP1u gene, and efficient gene editing was achieved through the expression vectors VP1u-UP3Cas9-PX459 and VP1u-UD3Cas9-PX459.
The efficient knockout of the SBDSV VP1u gene was achieved, preventing viral replication, providing a basis for viral function research, genetic engineering vaccines and targeted therapy, and significantly reducing viral load.
Smart Images

Figure CN118638779B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application mainly relates to the field of genetic engineering technology, in particular to a double-site sgRNA sequence for targeting and knocking out VP1u gene of duck short beak dwarfism syndrome virus and application thereof, and further relates to a duck short beak dwarfism syndrome virus VP1u gene editing technology by CRISPR / cas9 technology and application thereof. BACKGROUND
[0002] Duck short beak dwarfism syndrome (SBDS) is a new epidemic disease that has been prevalent in cherry valley ducks and half-ban ducks in many provinces and cities of China since 2015, which is characterized by short beak (shortened beak, severe tongue exposure), lameness (fractured foot bones), severe growth disorder (stiff duck), and uneven feathers, etc., causing great economic losses to breeders. The pathogen of duck short beak dwarfism syndrome is a goose parvovirus (GPV) variant or novel goose parvovirus. In view of the clinical characteristics of short beak and growth disorder, the virus is named as short beak dwarfism syndrome goose parvovirus (SBDS-GPV), also known as duck short beak dwarfism syndrome virus (SBDSV). The virus has a genome of about 5100 bp, which is a single-stranded DNA virus with hairpin ITR regions at both ends, and a coding region in the middle containing two major open reading frames (ORF). The left ORF encodes non-structural proteins NS1 (Rep1) and NS2 (Rep2). The right ORF encodes structural proteins VP1, VP2 and VP3. The 145 amino acid region at the N-terminus of VP1, which is more than VP2, is called "VP1 unique region (VP1u)". The parvovirus capsid protein VP1u is essential for viral infectivity, especially for the entry of viral nucleic acid into the cell and transmission to the nucleus, and plays a crucial role in the formation of viral capsid, virus particle production and viral nucleic acid entry into the nucleus.
[0003] The CRISPR / Cas system is the most widely used genome editing technology at present. The technology is composed of a Cas protein with endonuclease function and a single-stranded guide RNA (sgRNA) with a target gene. The sgRNA can guide the Cas protein to knock out, insert and mutate the target gene. Among them, the CRISPR / Cas9 system is the most in-depth studied and the most mature applied high-efficiency gene editing tool, which has broad application prospects in gene function research, model animal construction, gene therapy, including cancer, liver disease and cardiovascular disease, etc. SUMMARY
[0004] The application aims to provide a double-site sgRNA for knocking out a duck short-beak dwarf syndrome virus VP1u gene, a CRISPR / Cas9 system and application thereof.
[0005] The application achieves the goal by the following technical solutions.
[0006] In the design of the target point 1, the up-sgRNA nucleotide sequence upstream of the 3' end of the NS2 gene is designed, and the nucleotide sequence of the up-sgRNA is at least one of the following sequences:
[0007] (1) up1-sgRNA-attactgttatgaacatggg (SEQ ID No. 1),
[0008] (2) up2-sgRNA-aaaattactgttatgaacat (SEQ ID No. 2),
[0009] (3) up3-sgRNA-aaaattactgttatgaaca (SEQ ID No. 3);
[0010] The up-sgRNA takes the NS2 gene of the SBDSV M15 strain as a template, and the up-sgRNA upstream of the 3' end of the NS2 gene is designed.
[0011] In the design of the target point 2, the ud-sgRNA nucleotide sequence downstream of the 5' end of the VP2u gene is designed, and the nucleotide sequence of the ud-sgRNA is at least one of the following sequences:
[0012] (1) ud1-sgRNA-taagaagcctaaactcaccg (SEQ ID No. 4),
[0013] (2) ud2-sgRNA-actcaccgaggaagtcagtg (SEQ ID No. 5),
[0014] (3) ud3-sgRNA-accgaggaagtcagtgcggg (SEQ ID No. 6);
[0015] The above three ud-sgRNAs are located at the 5' end of the VP2 gene of the SBDSV M15 strain.
[0016] The SBDSV M15 strain (also referred to as the SBDS-GPV M15 strain) is isolated and identified by the Animal Virus Research Room of the Institute of Animal Husbandry and Veterinary Medicine, Fujian Academy of Agricultural Sciences, and is preserved in the China Center for Type Culture Collection (CCTCC) in Wuhan University, Wuhan, China, on March 16, 2016, and the preservation number is CCTCC:V201612.
[0017] The up-sgRNA and ud-sgRNA with the highest knockout efficiency are finally screened by Western Blot and IFA.
[0018] In constructing the expression vector, the CACCG is added to the 5' end of the sgRNA nucleotide sequence to obtain the positive strand; and the DNA complementary strand corresponding to the sgRNA nucleotide sequence is obtained, and the AAAC is added to the 5' end of the complementary strand and the C is added to the 3' end to obtain the negative strand, and the sequences of the corresponding positive strand and negative strand are shown in Table 1; the design principle is to add the complementary sticky ends generated by BbsI site cleavage at both ends of the sgRNA, denature, anneal and hybridize the synthesized forward oligonucleotide and reverse oligonucleotide to form a DNA double-stranded complex. The upstream and downstream double-stranded complexes are respectively connected with the pX459-v2 CRISPR / Cas9 vector subjected to BbsI enzyme digestion, so as to obtain the corresponding upstream expression vector VP1u-upCas9-PX459 and downstream expression vector VP1u-udCas9-PX459.
[0019] Table 1 sgRNA sequence corresponding positive strand and negative strand sequence
[0020]
[0021] The Western Blot and IFA finally screen out the sgRNAs with the highest knockout efficiency, which are up3-sgRNA and ud3-sgRNA.
[0022] The principle diagram of the SBDSV VP1U gene knockout of the present application is shown in Figure 5 .
[0023] Therefore, the present application provides a double-site sgRNA for knocking out the VP1U gene of duck short-beak dwarf syndrome virus, which includes up3-sgRNA and ud3-sgRNA.
[0024] The nucleotide sequence of the up3-sgRNA is aaaattactgttatgaaca (as shown in SEQ ID No. 3),
[0025] The nucleotide sequence of the ud3-sgRNA is accgaggaagtcagtgcggg (as shown in SEQ ID No. 6).
[0026] The corresponding sense strand nucleotide sequence of the up3-sgRNA is F-CACCGaaaattactgttatgaaca (as shown in SEQ ID NO. 11);
[0027] The corresponding antisense strand nucleotide sequence of the up3-sgRNA is R-AAACtgttcataacagtaattttC (as shown in SEQ ID NO. 12);
[0028] The corresponding sense strand nucleotide sequence of the ud3-sgRNA is F-CACCGaccgaggaagtcagtgcggg (as shown in SEQ ID NO. 17);
[0029] The corresponding antisense strand nucleotide sequence of the ud3-sgRNA is R-AAACcccgcactgacttcctcggtC (as shown in SEQ ID NO. 18).
[0030] The application also provides an expression vector comprising the double-site sgRNA.
[0031] The expression vector comprises expression vector VP1u-UP3Cas9-PX459 and expression vector VP1u-UD3Cas9-PX459.
[0032] The construction method of the expression vector VP1u-UP3Cas9-PX459 and the expression vector VP1u-UD3Cas9-PX459 is as follows:
[0033] CACCG is added to the 5' end of the sequence SEQ ID NO. 3 and SEQ ID NO. 6 to obtain the corresponding sense strands SEQ ID NO. 11 and SEQ ID NO. 17, AAAC is added to the 5' end and C is added to the 3' end of the DNA complementary strand corresponding to the sequence SEQ ID NO. 3 and SEQ ID NO. 6 to obtain the negative strands SEQ ID NO. 12 and SEQ ID NO. 18; the above-mentioned sense strands and negative strands are synthesized respectively, and the synthesized sense strands and the corresponding negative strands are annealed and hybridized to form the corresponding double-stranded complexes; the double-stranded complexes are respectively connected with the pX459-v2 CRISPR / Cas9 vector subjected to BbsI enzyme digestion, so as to obtain the expression vectors VP1u-UP3Cas9-PX459 and VP1u-UD3Cas9-PX459 respectively.
[0034] The application further provides a CRISPR / Cas9 system for knocking out the VP1U gene of duck short-beak dwarf syndrome virus, which comprises the double-site sgRNA and Cas9 protein.
[0035] The application further provides a construction method of the CRISPR / Cas9 system, which comprises the following steps:
[0036] (1) CACCG is added to the 5' end of the sequence SEQ ID NO. 3 and SEQ ID NO. 6 to obtain the corresponding sense strands SEQ ID NO. 11 and SEQ ID NO. 17, AAAC is added to the 5' end and C is added to the 3' end of the DNA complementary strand corresponding to the sequence SEQ ID NO. 3 and SEQ ID NO. 6 to obtain the negative strands SEQ ID NO. 12 and SEQ ID NO. 18; the above-mentioned sense strands and negative strands are synthesized respectively, and the synthesized sense strands and the corresponding negative strands are annealed and hybridized to form the corresponding double-stranded complexes;
[0037] (2) the double-stranded complexes prepared in step (1) are respectively connected with the vector pX459-v2 CRISPR / Cas9 subjected to BbsI enzyme digestion, so as to obtain the expression vectors VP1u-UP3Cas9-PX459 and VP1u-UD3Cas9-PX459 respectively;
[0038] (3) the expression vectors VP1u-UP3Cas9-PX459 and VP1u-UD3Cas9-PX459 obtained in step (2) are co-transfected into the cultured cells.
[0039] Preferably, the cells are 293T cells or DEF cells.
[0040] The application of the double-site sgRNA in targeted knockout of a duck short-beak dwarfism syndrome virus VP1U gene.
[0041] The application of the double-site sgRNA in research on the function of the SBDSV virus VP1U protein.
[0042] The application of the double-site sgRNA in the preparation of a duck short-beak dwarfism syndrome virus genetic engineering vaccine and targeted therapy drugs.
[0043] Compared with the prior art, the application has the following advantages: the application first uses double-site sgRNA to knockout the duck short-beak dwarfism syndrome virus VP1U protein, and through in-vitro cell level analysis, first selects double-site sgRNA (up3-sgRNA and ud3-sgRNA) with the best knockout activity on the SBDSV VP1U genome. The double-site sgRNA guide sequence provided by the application can specifically target and knockout the vp1u protein fragment of SBDSV through the CRISPR / Cas9 system, can effectively interfere with the replication of SBDSV, and prevent the infection of the virus on host cells, thereby providing an effective technical means for realizing virus gene editing, providing a recombinant virus model for research on the function of the SBDSV virus VP1u protein, and laying a foundation for research on the pathogenic mechanism of SBDSV, the development of a genetic engineering vaccine, and the development of targeted therapy drugs. BRIEF DESCRIPTION OF DRAWINGS
[0044] Figure 1 is a result graph of a protein immunoblotting test in the fifth embodiment of the application.
[0045] Figure 2 is an imaging graph in a Keyence multifunctional fluorescence microscope system in the sixth embodiment of the application.
[0046] Figure 3 is an imaging graph in a Keyence multifunctional fluorescence microscope system in the sixth embodiment of the application.
[0047] Figure 4 is a SBDSV TaqMan fluorescence quantitative PCR detection result graph in the seventh embodiment of the application, wherein 1: empty vector PX459-SBDSV-M15; 2: VP1u-UP3Cas9-PX459 and VP1u-UD3Cas9-PX459 plasmid-SBDSV-M15; 3: empty vector PX459-mDEF.
[0048] Figure 5 is a principle diagram of SBDSV VP1U gene knockout. DETAILED DESCRIPTION
[0049] The application will be described in detail below in combination with the drawings and embodiments of the specification.
[0050] The application will be further explained by the following specific examples. All the molecular biological techniques involved in the following examples, including cell culture, PCR, electrophoresis, cell transfection, immunofluorescence, etc., are conventional techniques known to those skilled in the art, and the relevant equipment and instruments involved are also available to those skilled in the art through public channels.
[0051] Example 1: Synthesis of sgRNA
[0052] According to the SBDSV NS and VP genome sequences, the Benchling online design website (https: / / benchling.com / ) was used to select three high-specificity, low-off-target, and GC content of 35%-50% upstream up-sgRNAs and downstream ud-sgRNAs near the 3' end of the SBDSV NS2 gene and near the 5' end of the VP2u gene, respectively. https: / / benchling.com / Chemical synthesis of sgRNA sequences (the sgRNA sequences of the application were synthesized by Shanghai Generay Biotech Co., Ltd.) was then performed. Then, CACCG was added to the 5' end of the sgRNA sequence to obtain the sense strand, and AAAC was added to the 5' end of the antisense strand, and C was added to the 3' end, as shown in Table 1.
[0053] The sequences of the upstream up-sgRNAs are as follows:
[0054] (1) up1-sgRNA-attactgttatgaacatggg (SEQ ID No. 1),
[0055] (2) up2-sgRNA-aaaattactgttatgaacat (SEQ ID No. 2),
[0056] (3) up3-sgRNA-aaaattactgttatgaaca (SEQ ID No. 3);
[0057] The sequences of the downstream ud-sgRNAs are as follows:
[0058] (1) ud1-sgRNA-taagaagcctaaactcaccg (SEQ ID No. 4),
[0059] (2) ud2-sgRNA-actcaccgaggaagtcagtg (SEQ ID No. 5),
[0060] (3) ud3-sgRNA-accgaggaagtcagtgcggg (SEQ ID No. 6);
[0061] Table 1 sgRNA sequence corresponding to the sense strand and the negative strand sequence
[0062]
[0063] The above-mentioned sense strand and negative strand are chemically synthesized, and the synthesized sense strand and negative strand sequence primers are annealed and hybridized to form a double-stranded complex;
[0064] The reaction system (50 μL system) for annealing and hybridizing the sense strand and the negative strand to form a double-stranded complex is as follows:
[0065]
[0066] The reaction conditions for annealing and hybridization are as follows: first, 95°C for 5 min; then, 95°C for 3 min at a rate of 5°C per minute; finally, 25°C for 3 min; the double-stranded complex formed by the reaction is permanently stored at 4°C;
[0067] Example 2: Construction of CRISPR / Cas9 editing plasmid (i.e., expression vector) VP1u-upCas9-PX459 and VP1u-udCas9-PX459 containing double-site sgRNA specific gene knockout and extraction of plasmid
[0068] Take 1 μg of empty vector pX459-v2 CRISPR / Cas9 and use BbsI endonuclease (purchased from NEW ENGLAND BioLabs Inc.) for enzyme digestion, a total of 50 μL system. The enzyme digestion system is shown in Table 1, and the enzyme digestion reaction conditions are as follows: first, 37°C for 15 min, then 65°C for 20 min.
[0069] The enzyme-digested empty vector plasmid pX459-v2 CRISPR / Cas9 and the sgRNA double-stranded complex obtained in Example 1 are connected by T4 ligase (purchased from NEW ENGLAND BioLabs Inc.) at 25°C for 15 min, wherein the connection reaction system (10 μL) is shown in Table 2, and the connection product can be permanently stored at 4°C. After connection, the Trans109 (purchased from TransZ) competent E. coli is transformed, inoculated on Amp + resistant solid LB plates, and incubated at 37°C in a CO2 bacterial incubator for 16 h. Single colonies are picked and inoculated on Amp + resistant liquid LB, and after 16 h of shaking at 37°C, the bacterial solution is sent to Beijing Qianke Biological Technology Co., Ltd. for sequencing (using PX459 universal primers). The bacteria containing the pX459-v2 CRISPR / Cas9 plasmid with the correct sgRNA sequence are inoculated in 200 ml of Amp+ The liquid LB resistance was incubated at 37°C for 16h, and the positive plasmids VP1u-upCas9-PX459 and VP1u-udCas9-PX459 were extracted by a plasmid extraction kit (purchased from Nanjing Novizen Biotech Co., Ltd.), wherein the expression vectors corresponding to up3-sgRNA and ud3-sgRNA were expression vector VP1u-UP3Cas9-PX459 (also referred to as plasmid VP1u-UP3Cas9-PX459) and expression vector VP1u-UD3Cas9-PX459 (also referred to as plasmid VP1u-UD3Cas9-PX459), respectively.
[0070] Table 2 reaction system
[0071]
[0072] Table 3 reaction system
[0073]
[0074] Example Three: Construction of SBDSV NS2 overexpression vector plasmid pLEX-MCS-NS2 and SBDSV VP2 overexpression vector plasmid pLEX-MCS-VP2.
[0075] The pLEX-MCS plasmid was linearized by using XhoI and BamHI enzymes, and the NS2 gene and VP2 gene were amplified from the SBDSV viral genome as a template and cloned into the pLEX-MCS vector to construct the pLEX-MCS-NS2 and pLEX-MCS-VP2 plasmids.
[0076] Example Four: Cell transfection
[0077] DMEM (containing 10% fetal bovine serum) complete medium was used for cell culture, and 293T cells were subcultured in a 6-well plate 2 days before transfection, 2ml per well. The next day, when the cells grew to 60%-70% density, 2μg of previously successfully constructed plasmid VP1u-upCas9-PX459 and pLEX-MCS-NS2 plasmid, 2μg of VP1u-udCas9-PX459 and pLEX-MCS-VP2 plasmid were transfected into the growing cells by non-liposome FuGENE HD Transfection Reagent (purchased from Promega), and then the cells were cultured in a 37°C, 6% CO2 incubator for 6h, and then replaced with fresh complete medium (containing 10% fetal bovine serum) for further incubation for 24h.
[0078] Example 5: Screening of dual sgRNA sites for efficient knockout of VP1u gene by Western Blot
[0079] 24 hours after transfection, cells were lysed with RIPA lysis buffer, and the lysed protein samples were placed in a refrigerated centrifuge and centrifuged at 12,000 rpm for 10 minutes to obtain the supernatant. Polyacrylamide gel was prepared and electrophoresis was performed. After electrophoresis, the protein gel was transferred to a wet transfer instrument NC membrane and blocked. After that, it was rinsed three times with TBST. Then, mouse anti-His-TAG ascites was diluted 5000 times with TBST and incubated at room temperature for 2 hours. The primary antibody was recovered and the membrane was rinsed with TBST. Goat anti-mouse IgG was diluted 2*10^6 times with TBST and incubated for 40 minutes. The images were recorded with a near-infrared imager. The results are shown in Figure 2. Figure 1 As shown in the figure, up1-sgRNA and up3-sgRNA targeting the upstream NS gene site had high knockout efficiency and significantly inhibited the expression of NS2 protein; the three sgRNAs targeting the downstream VP2 gene, ud1-sgRNA, ud2-sgRNA and ud3-sgRNA all had high knockout efficiency and significantly inhibited the expression of VP2 protein.
[0080] Example 6: Determining the dual sgRNA sites for knocking out the VP1u gene by IFA
[0081] The adherent cells to be tested were washed twice with PBS and then fixed with methanol for 30 minutes. Primary antibody was added and incubated at room temperature for 30 minutes. The cells were rinsed three times with T-PBS. Goat anti-mouse IFIT diluted 1:100 in T-PBS was added and incubated at room temperature for 30 minutes. The cells were then rinsed with T-PBS. DAPI solution (1×) was incubated at room temperature for 5 minutes in the dark. The cells were then rinsed three times with T-PBS. The images were taken using a Keyence laser confocal microscope. The results are shown in Figure 2. Figure 2 As shown, the sgRNA with the highest knockout efficiency in the upstream targeting NS gene site is up3-sgRNA; the sgRNA with the highest knockout efficiency in the downstream targeting VP2 gene site is ud3-sgRNA (as shown in Figure 2). Figure 3 shown).
[0082] Embodiment seven:
[0083] The constructed CRISPR / Cas9 editing plasmid system containing dual-site up3-sgRNA and ud3-sgRNA was used to knock out the VP1u gene of the SBDSV virus
[0084] mDEF cells were passaged and plated in 6-well plates, 2 ml per well. When the cells grew to 60%-70% density the next day, 2 μg of each of the previously successfully constructed plasmids VP1u-UP3Cas9-PX459 and VP1u-UD3Cas9-PX459 were transfected into the growing cells, and a control well with empty vector plasmid was set up, with 2 μg of empty vector plasmid pX459-v2 CRISPR / Cas9 PX459; the cells were transfected with non-liposome FuGENE HD Transfection Reagent (purchased from Promega) and incubated at 37°C in a 6% CO2 incubator for 6 h, then replaced with fresh DMEM complete medium (containing 10% fetal bovine serum) and incubated for another 24 h, inoculated with SBDSV-M15 at an MOI of 0.2, and incubated for 24 h, then frozen and thawed 3 times, and the virus DNA was extracted. The TaqMan-MGB fluorescent quantitative PCR method was used to detect the SBDSV viral load. The primer and probe sequences were designed for the VP2 gene, and the TaqMan fluorescent quantitative PCR primer amplification fragment contained the ud3-sgRNA knockout site sequence, to verify the virus knockout effect.
[0085] Primer and probe sequences
[0086] M15-F 5'- GAAGCTTACTGACCATTACCCAGTAG-3' M15-R 5'- CCCGCACTGACTTCCTCG-3' M15-probe 5'- FAM-AAGCCTAAACTCAC-MGB-3'
[0087] The reaction system was as follows:
[0088] Component Volume added 2x T5 Fast qPCR Mix (probe) 10 μL Upstream primer (10 uM) 0.8 μL Downstream primer (10 uM) 0.8 μL Probe (10 uM) 0.7 μL DNA template 1 μL [dH2Oupto] 20 μL
[0089] The reaction procedure was as follows:
[0090]
[0091] The results are shown in Figure 4 The mDEF cells transfected with the CRISPR / Cas9 editing plasmid system containing the double sites up3-sgRNA and ud3-sgRNA had a cycle threshold (Ct value) of 27.13 when detected by TaqMan-MGB fluorescent quantitative PCR 24 h after inoculation with SBDSV virus, while the mDEF cells transfected with empty plasmid PX459 had a TaqMan-MGB fluorescent quantitative PCR cycle threshold (Ct value) of 18.9 24 h after inoculation with SBDSV virus. The results showed that the double-site up3-sgRNA, ud3-sgRNA CRISPR / Cas9 editing plasmid system constructed could effectively knockout the SBDSV virus VP1u protein, thereby inhibiting the early replication of the virus in the host cell mDEF, and significantly reducing the SBDSV viral load in the mDEF cells.
[0092] The above describes the embodiments of the present embodiment, but the present embodiment is not limited to the above-described specific embodiments, and the above-described specific embodiments are only illustrative but not restrictive, and those skilled in the art can make many forms under the inspiration of the present embodiment, which all belong to the protection of the present embodiment.
Claims
1. A dual-site sgRNA for knocking out the VP1U gene of duck short-beak syndrome virus, characterized by: It includes up3-sgRNA and ud3-sgRNA; The nucleotide sequence of the up3-sgRNA is shown in SEQ ID No. 3, The nucleotide sequence of the ud3-sgRNA is shown in SEQ ID No.
6.
2. An expression vector comprising the dual-site sgRNA according to claim 1.
3. The expression vector according to claim 2, wherein: The expression vectors include expression vector VP1u-UP3Cas9-PX459 and expression vector VP1u-UD3Cas9-PX459; The construction method of the expression vector VP1u-UP3Cas9-PX459 and the expression vector VP1u-UD3Cas9-PX459 is: In claim 1, CACCG is added to the 5' end of the sequences SEQ ID NO.3 and SEQ ID NO.6 to obtain the corresponding positive strands, and the nucleotide sequences of the positive strands are SEQ ID NO.11 and SEQ ID NO.17, respectively. AAAC is added to the 5' end and C is added to the 3' end of the DNA complementary strands corresponding to the sequences SEQ ID NO.3 and SEQ ID NO.6 to obtain the negative strands, and the nucleotide sequences of the negative strands are SEQ ID NO.12 and SEQ ID NO.18, respectively. The above-mentioned positive strands and negative strands are synthesized respectively, and the synthesized positive strands and the corresponding negative strands are annealed and hybridized to form corresponding double-stranded complexes; the double-stranded complexes are respectively ligated with the pX459-v2 CRISPR / Cas9 vector digested with BbsI, thereby obtaining expression vectors VP1u-UP3Cas9-PX459 and VP1u-UD3Cas9-PX459, respectively.
4. A CRISPR / Cas9 system for knocking out the VP1U gene of duck short-beak syndrome virus, characterized by: The CRISPR / Cas9 system includes the dual-site sgRNA and Cas9 protein according to claim 1.
5. The method for constructing the CRISPR / Cas9 system according to claim 4, wherein: It includes the following steps: (1) CACCG is added to the 5' end of the sequences SEQ ID NO. 3 and SEQ ID NO. 6 in claim 1 to obtain the corresponding sense strands, the nucleotide sequences of which are SEQ ID NO. 11 and SEQ ID NO. 17, respectively. AAAC is added to the 5' end and C is added to the 3' end of the DNA complementary strands corresponding to the sequences SEQ ID NO. 3 and SEQ ID NO. 6 to obtain the negative sense strands, the nucleotide sequences of which are SEQ ID NO. 12 and SEQ ID NO. 18, respectively. The sense strands and negative sense strands are synthesized separately, and the synthesized sense strands and the corresponding negative sense strands are annealed and hybridized to form corresponding double-stranded complexes; (2) The double-stranded complex prepared in step (1) was connected to the vector pX459-v2 CRISPR / Cas9 digested with BbsI, thereby obtaining expression vectors VP1u-UP3Cas9-PX459 and VP1u-UD3Cas9-PX459, respectively; (3) The expression vectors VP1u-UP3Cas9-PX459 and VP1u-UD3Cas9-PX459 obtained in step (2) are co-transfected into cultured cells.
6. The method for constructing the CRISPR / Cas9 system according to claim 5, wherein: The cells are 293T cells or DEF cells.
7. Use of the dual-site sgRNA as claimed in claim 1 in the targeted knockout of the VP1U gene of duck short-beak dwarf syndrome virus for non-disease diagnosis and treatment purposes.
8. Use of the dual-site sgRNA as claimed in claim 1 in the study of the function of the duck short-beak syndrome virus VP1U protein for non-disease diagnosis and treatment purposes.
9. Use of the dual-site sgRNA as claimed in claim 1 in the preparation of a targeted therapeutic drug for duck short-beak dwarf syndrome virus.
Citation Information
Patent Citations
Preparation method of short-billed dwarf syndrome gosling plague inactivated vaccine
CN105861449A
SiRNA for inhibiting duck RIG-I gene expression
CN112481263A