A circular ribozyme system and its applications

Abstract

The present invention belongs to the field of biomedicine, and particularly relates to a circular ribozyme system and its application. The circular ribozyme system includes a first RNA component and a second RNA component; the structure of the first RNA component includes a first matching sequence - enzyme region - third matching sequence - loop region; the structure of the second RNA component includes a fourth matching sequence - 5' corresponding sequence - sequence to be cyclized or cleavage site - 3' corresponding sequence - second matching sequence. The purpose of the present invention is to provide a method for cyclizing a sequence to be cyclized, in which the ribozyme that plays a major role can be stably reused, with high stability and high efficiency of repeated use.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and specifically relates to a ring ribozyme system and application thereof. Background Art

[0002] Circular RNA is a single-stranded RNA molecule that is mainly formed during the mRNA splicing process in cells through the reverse splicing mechanism. It does not have a 5' cap and a 3' poly (A) tail structure. Compared with linear RNA, the circular structure has excellent stability and is not easily degraded by nucleases. Recent studies have shown that circular RNA has the functions of adsorbing miRNA, proteins, protein translation and biomarkers. Due to the widespread use of mRNA vaccines in the human body, circular RNA has become a key technology platform in the field of RNA vaccine research and development with its unique advantages. Especially in the research on the new coronavirus, the successful application of circular RNA vaccines has provided potential possibilities for its use in vaccine preparation.

[0003] In the patent application with application number 202410221889X, we developed a SIE system for preparing circular RNA in vitro, which mainly includes two linear RNA components. The main function of component 1 (the first nucleic acid component) is to act as a ribozyme to catalyze the cyclization of the substrate RNA (the second nucleic acid component). In the SIE system, the ribozyme of component 1 can be recovered and reused, but the recovery requires multiple steps, which is prone to content loss and will lead to a decrease in its subsequent utilization rate. Summary of the invention

[0004] In order to solve the problem that linear ribozymes are easily degraded and have a low reuse rate, the present invention replaces the linear ribozyme in the previously developed SIE system with a circular ribozyme to improve the stability of the ribozyme and the efficiency of repeated use. Specifically, the present invention provides the following technical solutions:

[0005] In one aspect, the present invention provides an RNA composition for preparing circular RNA, the RNA composition comprising a first RNA component and a second RNA component;

[0006] The structure of the first RNA component includes a first matching sequence-enzyme region-third matching sequence-loop region;

[0007] The structure of the second RNA component includes the fourth matching sequence-5' corresponding sequence-sequence to be cyclized or restriction site-3' corresponding sequence-second matching sequence.

[0008] Preferably, the first RNA component is circular, that is, the first RNA component is a circular RNA.

[0009] The 3' corresponding sequence in the second RNA component corresponds to the 5' end of the enzyme region in the first RNA component, and the 5' corresponding sequence in the second RNA component corresponds to the 3' end of the enzyme region in the first RNA component. The "corresponding" means that the RNA sequences can interact to form a certain secondary structure.

[0010] In other embodiments, the enzyme region may also be the intron of the T4 bacteriophage td gene, specifically the RNA encoded by the DNA shown in SEQ ID NOs. 13, 16, 19, 22, 25, 28.

[0011] Preferably, each of SEQ ID NOs. 13, 16, 19, 22, 25, 28 contains the following sequence: TAGGACTGGTTCTA (SEQ ID NO. 46), and any other sequence of any length can also be connected (inserted) between the 7th and 8th nucleotides of the fragment shown in SEQ ID NO. 46.

[0012] More preferably, a sequence capable of forming a stem-loop structure can also be connected between the 7th and 8th nucleotides of the sequence shown in SEQ ID NO. 46, such as

[0013] CGGCTATTATGCGTTACCGGCGACGGAGATGTTTTCTTGGGTCTACCGTTTAATATTGCGTCATCCGTCGCAGGTAAACCATCATACCCG (SEQ ID NO. 48).

[0014] In the cyclic ribozyme system of the present invention, when the "enzyme region" selects the RNA encoded by SEQ ID NO. 13, the 5' corresponding sequence and 3' corresponding sequence in the RNA composition respectively select SEQ ID NOs. 14-15; when the "enzyme region" selects the RNA encoded by the modified SEQ ID NOs. 16, 19, 22, 25, 28, the 5' corresponding sequence and 3' corresponding sequence in the RNA composition respectively select SEQ ID NOs. 17-18, 20-21, 23-24, 26-27, 29-30.

[0015] In other embodiments, the enzyme region may also be the intron of the Anabaena tRNA gene, specifically the RNA encoded by the DNA shown in SEQ ID NOs. 31, 34, 37, 40, 43, 49.

[0016] Preferably, each of SEQ ID NO.31, 34, 37, 40, 43, 49 contains the following sequence: GTAAGTTATGACTTAC (SEQ ID NO.47), and any sequence of any length can be ligated (inserted) between the 8th and 9th nucleotides of the segment shown in SEQ ID NO.47.

[0017] More preferably, a sequence capable of forming a stem-loop structure can be ligated between the 8th and 9th nucleotides of the sequence shown in SEQ ID NO.47, such as

[0018] CGGCTATTATGCGTTACCGGCGACGGAGATGTTTTCTTGGGTCTACCGTTTAATATTGCGTCATCCGTCGCAGGTAAACCATCATACCCG (SEQ ID NO.48).

[0019] In the cyclic ribozyme system of the present invention, when the "enzyme region" selects the RNA encoded by the altered SEQ ID NO.31, the 5' corresponding sequence and the 3' corresponding sequence in the RNA composition are correspondingly selected as SEQ ID NO.32-33; when the "enzyme region" selects the RNA encoded by the altered SEQ ID NO.34, 37, 40, 43, 49, the 5' corresponding sequence and the 3' corresponding sequence in the RNA composition are correspondingly selected as SEQ ID NO.35-36, 38-39, 41-42, 44-45, 2-3.

[0020] Most preferably, the enzyme region is the RNA encoded by the DNA shown in SEQ ID NO.1; or the RNA encoded by a DNA having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity with the sequence shown in SEQ ID NO.1;

[0021] The 5' corresponding sequence in the second RNA component is the RNA encoded by the DNA shown in SEQ ID NO.2; or the RNA encoded by a DNA having 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity with the sequence shown in SEQ ID NO.2;

[0022] The 3' corresponding sequence in the second RNA component is the RNA encoded by the DNA shown in SEQ ID NO.3; or the RNA encoded by a DNA having 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity with the sequence shown in SEQ ID NO.3.

[0023] Preferably, the loop region can have an arbitrary sequence of arbitrary length, as long as the first RNA component forms a loop without affecting the enzymatic activity of the enzyme region.

[0024] Preferably, the loop region is the RNA encoded by the DNA shown in SEQ ID NO.4; or the RNA encoded by the DNA having 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity with the sequence shown in SEQ ID NO.4.

[0025] Preferably, the sequences of the first matching sequence and the second matching sequence are complementary to each other.

[0026] Preferably, the sequences of the third matching sequence and the fourth matching sequence are complementary to each other.

[0027] Specifically, the above complementarity is reverse complementarity.

[0028] In the present application, the "complementarity" can be complete complementarity or incomplete complementarity. The purpose of incomplete complementarity is to avoid the immune response caused by the formation of long double-stranded RNA structures in downstream cell applications. For example, the first matching sequence and the second matching sequence shown in SEQ ID NO.7-8 used in the specific examples are not completely complementary, and the third matching sequence and the fourth matching sequence shown in SEQ ID NO.9-10 used in the specific examples are not completely complementary.

[0029] Preferably, the first matching sequence, the second matching sequence, the third matching sequence, and the fourth matching sequence, independently of each other, can have a length of or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more nt.

[0030] Preferably, the length of the first matching sequence, the second matching sequence, the third matching sequence, or the fourth matching sequence is at least 5 nt.

[0031] Preferably, the length of the first matching sequence, the second matching sequence, the third matching sequence, or the fourth matching sequence is 5-50 nt.

[0032] Most preferably, in the specific embodiments of the present invention, the RNAs transcribed from the DNAs with the sequences shown in SEQ ID NO.7-10 are used as the first matching sequence, the second matching sequence, the third matching sequence, and the fourth matching sequence to prepare the first component and the second component of the present invention.

[0033] Preferably, the first RNA component and the second RNA component in the RNA composition can be mixed in any ratio.

[0034] Preferably, the first RNA component in the nucleic acid composition is 0.5 times or more of the second RNA component. For example, the molar ratio of the first RNA component to the second RNA component is 0.5, 1, 2, 3 or more.

[0035] Most preferably, the molar ratio of the first RNA component to the second RNA component is 2.

[0036] In the present application, when the first RNA component is circular, there are different description methods when describing the structure starting from the nucleotides at different positions in the circular RNA. The "first matching sequence - enzyme region - third matching sequence - loop region" takes the first nucleotide of the first matching sequence as the nucleotide at position 1, and sequentially records the composition of the first component RNA in the direction from the 5' end to the 3' end. After circularization, the 3' end of the loop region is connected to the 5' end of the first matching sequence to form a ring. As long as any RNA is connected end to end and is the same as the circular RNA formed by connecting end to end with the aforementioned "the structure of the first RNA component includes the first matching sequence - enzyme region - third matching sequence - loop region", the linear sequence or the circularized structure of this RNA is within the protection scope of the present invention.

[0037] In the specific embodiments of the present invention, to prepare the first RNA component into a circular form, the DNA shown in SEQ ID NO.1 is disconnected between positions 159-160, and DNA is designed starting from the 160th nucleotide of the DNA shown in SEQ ID NO.1 to prepare the first RNA component. More specifically, the sequence shown in SEQ ID NO.11 is composed of the 160th-298th positions of the DNA shown in SEQ ID NO.1, SEQ ID NO.9 (third matching sequence), SEQ ID NO.4 (loop region), SEQ ID NO.7 (first matching sequence), and the 1st-159th positions of the DNA shown in SEQ ID NO.1 from the 5' end to the 3' end. The circular RNA obtained by transcribing and circularizing the DNA molecule with the DNA sequence shown in SEQ ID NO.7 is the first RNA component of the present invention. The DNA sequence shown in SEQ ID NO.7 and especially the prepared circular RNA are within the protection scope of the present invention.

[0038] In a second aspect, the present invention provides a DNA molecule or a DNA molecule composition encoding the aforementioned RNA composition.

[0039] The first DNA encoding the aforementioned first RNA component and the second DNA encoding the aforementioned second RNA component may be in two DNA molecules or in non-directly connected positions in one DNA molecule.

[0040] In a third aspect, the present invention further provides a vector or a composition of vectors, wherein the vector or the composition of vectors contains the DNA molecule or the DNA molecule composition.

[0041] The first DNA encoding the aforementioned first RNA component and the second DNA encoding the aforementioned second RNA component may be in one vector or may be present in different vectors respectively.

[0042] On the other hand, the present invention provides a method for stably and efficiently generating circular RNA, which includes incubating the aforementioned first RNA component and the second RNA component in a cyclization buffer after mixing.

[0043] Specifically, the circular RNA prepared by the method includes the sequence of the target RNA, and constructing the sequence containing the target RNA into circular RNA can enable the stable and continuous high expression of the target RNA.

[0044] Specifically, the method may further include the step of preparing the first RNA component and / or the second RNA component. The first RNA component is circular and can be prepared by conventional methods known in the art.

[0045] Preferably, the molar ratio of the first RNA component to the second RNA component is 0.5, 1, 2, 3 or higher.

[0046] Preferably, the molar ratio of the first RNA component to the second RNA component is 2.

[0047] Preferably, the method further includes a step of purifying and extracting the product to improve the purity.

[0048] Preferably, the incubation is carried out at a temperature of 37 - 60 °C.

[0049] Preferably, the incubation is carried out at a temperature of 55 °C.

[0050] Preferably, the duration of the incubation is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 minutes or more.

[0051] Most preferably, the duration of the incubation is 15 minutes.

[0052] Preferably, the buffer solution contains GTP or an excess of GMP.

[0053] Preferably, the concentration of GTP in the buffer solution is 2 mM.

[0054] Preferably, the buffer solution contains magnesium ions (Mg 2+ ).

[0055] Preferably, the buffer solution contains MgCl 2 .

[0056] Preferably, the buffer solution contains 10 mM of MgCl 2 .

[0057] Preferably, the pH value of the buffer solution is 7 - 8, preferably 7.5.

[0058] Preferably, the composition of the buffer solution is 50 mM Tris-HCl, 10 mM MgCl 2 , 1 mM DTT, pH 7.5.

[0059] Preferably, the method is carried out in vitro.

[0060] Preferably, the method is for therapeutic or non-therapeutic purposes.

[0061] On the other hand, the present invention provides a circular RNA prepared by the above method.

[0062] Specifically, the circular RNA prepared by the method retains (residual) the sequences of the 5'-corresponding sequence and the 3'-corresponding sequence in a part of the second component.

[0063] Specifically, the retained sequences are as shown in SEQ ID NO.5 - 6, and the retained sequences are connected end to end to make the product circular, that is, the product is circular RNA, and the circular RNA contains the sequence of the target RNA.

[0064] On the other hand, the present invention provides a composition containing the circular RNA.

[0065] Preferably, the composition containing the circular RNA is a pharmaceutical composition, and the pharmaceutical composition further contains a pharmaceutically acceptable carrier.

[0066] On the other hand, the present invention also provides a cell, which contains one or more of the aforementioned RNA composition, DNA molecule or DNA molecule composition, vector or vector composition, circular RNA prepared by the aforementioned method or composition containing the same.

[0067] On the other hand, the present invention provides a circular RNA prepared by the above method, a composition containing the circular RNA prepared by the above method, and the use of the aforementioned cell in stably and highly expressing a target RNA.

[0068] Preferably, the use is to increase the content or expression of the target RNA in isolated cells, or the use in preparing an increase in the content or expression of the target RNA in cells. Specifically, for example, the use in preparing protein products (protein vaccines) and RNA products (such as RNA vaccines).

[0069] On the other hand, the present invention provides the use of any one of the aforementioned RNA composition, DNA molecule or DNA molecule composition, vector or vector composition, circular RNA prepared by the above method, composition containing the circular RNA prepared by the above method, and the aforementioned cell in preparing circular RNA and increasing the content or expression of the target RNA in cells.

[0070] On the other hand, the present invention provides a method for expressing a target gene or target RNA in a cell, wherein the method includes the step of transferring the circular RNA prepared by the present invention into the cell.

[0071] On the other hand, the present invention provides a method for preventing or treating a disease, wherein the method includes administering an effective amount of the circular RNA prepared by the present invention or a composition containing the circular RNA to a subject.

[0072] General concept

[0073] The "target RNA" in the present invention is present in the "sequence to be circularized (GOI)" and can be any naturally occurring sequence or synthetic sequence. Exemplarily, the "target RNA" in the present invention can be RNA of any antigen (such as viral antigen, pathogenic viral antigen), antibody (including monoclonal antibody, polyclonal antibody, multispecific antibody, single-chain antibody, intact antibody and antibody fragment), antigen-binding fragment, chimeric antigen receptor (CAR), fluorescent protein, protein with disease therapeutic activity, protein with gene editing activity, etc. Proteins with disease therapeutic activity can include but are not limited to enzyme replacement proteins, proteins for supplementation, protein vaccines, antigens (such as tumor antigens, viruses, bacteria), hormones, cytokines, antibodies, immunotherapies (such as cancer), cell reprogramming / transdifferentiation factors, transcription factors, chimeric antigen receptors, transposases or nucleases, immune effectors (such as those affecting susceptibility to immune response / signal), regulated death effector proteins (such as inducers of apoptosis or necrosis), non-lytic inhibitors of tumors (such as oncoprotein inhibitors), epigenetic modifiers, epigenetic enzymes, transcription factors, DNA or protein modifying enzymes, DNA intercalators, efflux pump inhibitors, nuclear receptor activators or inhibitors, proteasome inhibitors, enzyme competitive inhibitors, protein synthesis effectors or inhibitors, nucleases, protein fragments or domains, ligands or receptors, and CRISPR systems or their components, etc.

[0074] To further enable the continuous and stable high expression of the target RNA (target gene), when preparing circular RNA, other elements can also be connected before and after the target RNA sequence. That is, the sequence to be circularized (GOI) contains the target RNA sequence and can further contain other sequences. Specifically, in a specific embodiment of the present invention, the "EGFP (positions 905 - 1624 in SEQ ID NO.12)" is used as the target gene in the sequence to be circularized, its 5' end is connected to IRES (positions 164 - 904 in SEQ ID NO.12), spacer (positions 86 - 163 in SEQ ID NO.12) is inserted at the 5' end of IRES, and spacer (positions 1625 - 1670 in SEQ ID NO.12) is inserted at the 3' end of EGFP.

[0075] The term "expression" includes any step involved in generating the protein translated from the target RNA, including but not limited to: transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0076] As used in the present disclosure, "complementary" between sequences refers to the phenomenon in which the bases of each nucleotide residue in a nucleic acid molecule are hydrogen-bonded to each other according to the corresponding relationships of A with T, A with U, G with T, G with U, and G with C. Complementarity can be "incomplete" or "complete". "Complete" complementarity between nucleic acid molecules means that each nucleic acid base matches another base under the base pairing rules.

[0077] The "element" described in the present invention can be used to regulate the transcription of recombinant nucleic acid molecules, to regulate the translation of circular RNAs, to achieve the specific expression of circular RNAs between different tissues, or to purify circular RNAs, etc. Specifically, for example, (i) transcriptional level regulatory elements, (ii) translational level regulatory elements, (iii) purification elements. Exemplarily, the elements include IRES (Internal ribosome entry site, IRES), 5'UTR sequences, 3'UTR, Kozak sequences, sequences containing m6A modification (N(6)-methyladenosine modification), and complementary sequences of ribosomal 18S rRNA.

[0078] The terms "circular" or "circularized" in the present invention have the same meaning. Any RNA presenting a circular structure can be referred to as "circular RNA" or "circularized RNA".

[0079] The backbone of the vector or vector composition described in the present invention can be selected from conventional vectors according to actual circumstances. Vectors are well known to those skilled in the art and include, but are not limited to: plasmids; phagemids; cosmids; artificial chromosomes, such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs); phages such as λ phage or M13 phage, and animal viruses, etc.

[0080] The "cell" described in the present invention includes any type of cell system, including eukaryotic cells, such as mammalian cells, insect cells, yeast cells; and prokaryotic cells, such as Escherichia coli cells. Cells include cultured cells, and also include cells inside transgenic animals, transgenic plants, or cultured plant tissues or animal tissues. Preferably, the host cell is a human cell, including human immune cells; the immune cells include T cells, B cells, NK cells, etc.

[0081] The term "cell" encompasses progeny cells that are different from the parental cells after introducing the RNA composition, DNA molecule or DNA molecule composition, vector or vector composition described in the present invention. The cells can be specifically prepared by "transformation, transfection, transduction".

[0082] As used in the present invention, the terms "transformation, transfection, transduction" have the meanings generally understood by those skilled in the art, i.e., the process of introducing exogenous DNA into a host. The methods of transformation, transfection, and transduction include any method of introducing nucleic acids into cells, including but not limited to electroporation, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method. In a specific embodiment, the cells do not include embryonic cells. In a specific embodiment, the cells are isolated cells or commercially available cell lines.

[0083] The composition of the present invention may further include a reagent that promotes gene transformation. Specifically, the gene transformation includes introducing the aforementioned RNA composition, DNA molecule or DNA molecule composition, vector or vector composition of the present invention into cells. The reagents include lipids and liposomes (DOTMA, DOGS, DOPE, etc.), calcium phosphate, polyethylene glycol (PEG), cationic polymers (such as polyethyleneimine (PEI)), DEAE-dextran, nanoparticles, or commercially available transfection reagents of the lipo series.

[0084] Preferably, the "pharmaceutically acceptable carrier" includes any one or a combination of at least two of diluents, excipients, fillers, binders, wetting agents, disintegrants, emulsifiers, cosolvents, solubilizers, osmotic pressure regulators, surfactants, coating materials, colorants, pH regulators, antioxidants, bacteriostatic agents, or buffers.

[0085] As used herein, a "pharmaceutically acceptable carrier" should be compatible with the circular RNA, i.e., it can be blended with it without significantly reducing the effect of the pharmaceutical composition under normal circumstances. Specific examples of some substances that can be used as a "pharmaceutically acceptable carrier" or its components are sugars, such as lactose, glucose, and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethylcellulose, ethyl cellulose, and methyl cellulose; tragacanth powder; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils, such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, and cocoa butter; polyols, such as propylene glycol, glycerol, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers, such as wetting agents, such as sodium lauryl sulfate; coloring agents; flavoring agents; tabletting agents, stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic saline solutions; and phosphate buffer solutions, etc. The compositions of the present invention can be made into various dosage forms as needed, and the beneficial dose for the patient can be determined by a physician according to factors such as the type of patient, age, weight, and general disease condition, and the mode of administration. The mode of administration can be, for example, injection or other treatment methods.

[0086] As used in the present disclosure, the term "effective amount" refers to the amount or dose of the RNA composition, DNA molecule or DNA molecule composition, vector or vector composition, circular RNA prepared by the present invention or the composition containing the circular RNA, or cells of the present invention, especially the amount or dose of the circular RNA prepared by the present invention or the composition containing the circular RNA; after being administered to a patient in a single or multiple doses, it produces an expected effect in the patient in need of treatment or prevention. The effective amount can be easily determined by an attending physician who is a person skilled in the art by considering various factors such as: the species of the mammal; its size, age, and general health; the specific disease involved; the degree or severity of the disease; the response of the individual patient; the specific antibody administered; the mode of administration; the bioavailability characteristics of the administered formulation; the selected dosing regimen; and the use of any concomitant therapies.

[0087] Beneficial effects:

[0088] The object of the present invention is to provide a method for circularizing a sequence to be circularized, in which the ribozyme playing a major role can be stably reused, with high stability and high efficiency of repeated use. Description of the drawings

[0089] Figure 1 It is a schematic diagram of a two-component circular ribozyme system.

[0090] Figure 2 It is an electrophoresis result diagram of the circular RNA product obtained by preparing the circular ribozyme system.

[0091] Figure 3It is the HPLC result diagram before the purification of the circular product of the circular ribozyme system.

[0092] Figure 4 It is the HPLC result diagram after the purification of the circular product.

[0093] Figure 5 It is the result diagram of DNA sequencing to verify the splicing site of circular RNA.

[0094] Figure 6 It is the expression result diagram of the circular product in cells. Detailed implementation manners

[0095] The present invention will be further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention, according to the technical solution and inventive concept of the present invention, makes equivalent substitutions or changes, and should be covered within the protection scope of the present invention.

[0096] The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels without special instructions.

[0097] Unless otherwise defined or clearly indicated by the background, all technical and scientific terms in this disclosure have the same meaning as commonly understood by those of ordinary skill in the art to which this disclosure belongs.

[0098] Example 1. Preparation of circular RNA

[0099] Step 1: Prepare Component 1 - Circular ribozyme

[0100] The sequence shown in SEQ ID NO.11 was constructed on a plasmid, and the DNA sequence shown in SEQ ID NO.11 was transcribed into RNA and circularized according to the method in the article "Engineering circular RNA for potent and stable Translation in eukaryotic cells".

[0101] Step 2: Prepare Component 2

[0102] 1. The sequence shown in SEQ ID NO.12 was constructed on a plasmid and extracted, referring to the instruction manual of the Tiangen plasmid extraction kit.

[0103] 2. The plasmid was linearized. A single restriction site reserved in the plasmid DNA in advance can be used for linearization, and it can be referred to the instruction manual of Takara restriction enzymes.

[0104] 3. Purification of linearized plasmid:

[0105] 1) Make up the digested product to 500 μL, add an equal volume of organic solvent (phenol / chloroform / i-amyl alcohol 25:24:1), mix well, and centrifuge at 12,000 rpm for 15 min at 4°C.

[0106] 2) After centrifugation, transfer the DNA in the upper aqueous phase to a new EP tube, approximately aspirate 400 μL. Add an equal volume of chloroform, with a total volume of 800 μL, vortex to mix well. Centrifuge at 12,000 rpm for 15 min at 4°C.

[0107] 3) Take 300 μL of the supernatant and put it into a new centrifuge tube, add 30 μL of 3 M sodium acetate. Then add twice the volume (660 μL) of pre-cooled absolute ethanol. Mix well and precipitate at -20°C for at least 30 min.

[0108] 4) Centrifuge at 14,000 rpm for 15 min at 4°C to collect the DNA precipitate.

[0109] 5) After removing the supernatant, slowly add 750 μL of ice-cold 70% ethanol to the EP tube. Gently shake, centrifuge at 14,000 rpm for 5 min at 4°C to collect the DNA precipitate.

[0110] 6) Repeat step 5);

[0111] 7) Discard the supernatant, invert the centrifuge tube, and air-dry. Dissolve it with 20 μL of RNase-free water.

[0112] 4. In vitro transcription:

[0113] 1) Prepare the following system in an EP tube using the in vitro transcription kit from NEB:

[0114] Component Quantity (μL) 10X Reaction buffer 2 ATP 2 GTP 2 UTP 2 CTP 2 T7 RNA polymerase Mix 2 Template DNA (1μg / μL) 1 RNase-free water 7 Total 20

[0115] 2) Gently mix and centrifuge to the bottom of the tube, and incubate the reactants in a PCR instrument at a constant temperature of 37°C for 2 h.

[0116] 3) Add DNase I (Takara) to degrade the DNA template, configure the reaction system according to the following table, mix well, and place it in a 37°C metal bath for 20 - 30 min.

[0117] Component Quantity (μL) Total RNA 20 10X Dnase I Buffer 10 Nuclease free water 60 Recombinant DNAse I 8 RNase inhibitor 2 Total Rection Volume 100

[0118] 4) After incubation, add 2.5 μL of 0.5 M EDTA to the reactants, mix well and centrifuge, place it in an 80°C water bath for 2 min to inactivate DNase I, and then perform RNA column purification to obtain RNA.

[0119] Step 3: Cyclization

[0120] Mix the circular ribozyme prepared in Step 1 with the RNA component obtained by in vitro transcription in Step 2 at a molar ratio of 2:1. Add cyclization buffer (50 mM Tris-HCl, 10 mM MgCl 2 , 1 mM DTT, pH 7.5) and GTP to a final concentration of 2 mM / L, incubate at 55 °C for 15 min, and then perform RNA column purification to obtain a reaction product containing circular RNA. The electrophoresis analysis results show that circular RNA was successfully obtained ( Figure 2 ).

[0121] Example 2. Purity analysis of circular RNA

[0122] Separate and purify the cyclized product by high performance liquid chromatography (HPLC). The separation and purification adopt an isocratic elution method with 150 mM phosphate, and the separation chromatogram shows that the cyclized product can be effectively separated ( Figure 3 ).

[0123] Collect Figure 3 the corresponding main peak sample (Peak 1) in Figure 4 , and perform purity analysis on it using HPLC. The results show that the impurities in the cyclization reaction have been basically removed ( ).

[0124]

[0125] Perform a reverse transcription experiment using the collected circular RNA. The reverse transcription is carried out with reference to the TransGen Biotech reverse transcription kit. The product obtained by PCR amplification is embedded between EcoR1 and HidIII of the PUC57-kan vector by homologous recombination, and DNA sequencing is performed. The results prove that the circular RNA undergoes a splicing reaction at the expected position ( Figure 5 ).

[0126] According to the detection results, partial sequences of the 5'-corresponding sequence and 3'-corresponding sequence in the second component are present in the circular RNA product, and the sequences are as Figure 5 or as shown in SEQ ID NO.5-6.

[0127] Example 4. Expression analysis of circular RNA

[0128] After desalting, precipitation and other steps, the circular RNA prepared in Step 3 of Example 1 was transformed into 293T cells and cultured for 12 h, and then the expression of fluorescent protein was observed. The results show that the circular RNA can highly express green fluorescent protein ( Figure 6 ).

Claims

1. An RNA composition for preparing a circular RNA, the RNA composition comprising a first RNA component and a second RNA component; The structure of the first RNA component from the 5' end to the 3' end is composed of the first matching sequence-enzyme region-third matching sequence-loop region; The structure of the second RNA component from the 5' end to the 3' end is the fourth matching sequence-5' corresponding sequence-sequence to be cyclized-3' corresponding sequence-second matching sequence; The first RNA component is circular RNA; The enzyme region is the RNA encoded by the DNA shown in SEQ ID NO.1; The 5' corresponding sequence is the RNA encoded by the DNA shown in SEQ ID NO.2; The 3' corresponding sequence is the RNA encoded by the DNA shown in SEQ ID NO.3; The loop region is the RNA encoded by the DNA shown in SEQ ID NO.4; The first matching sequence, the second matching sequence, the third matching sequence, and the fourth matching sequence are RNAs transcribed from DNAs having the sequences shown in SEQ ID NOs. 7-10, respectively; The sequence to be cyclized includes target RNA.

2. An RNA composition for preparing a circular RNA, the RNA composition comprising a first RNA component and a second RNA component; The structure of the first RNA component from the 5' end to the 3' end is composed of the first matching sequence-enzyme region-third matching sequence-loop region; The structure of the second RNA component from the 5' end to the 3' end is the fourth matching sequence-5' corresponding sequence-enzyme cleavage site-3' corresponding sequence-second matching sequence; The first RNA component is circular RNA; The enzyme region is the RNA encoded by the DNA shown in SEQ ID NO.1; The 5' corresponding sequence is the RNA encoded by the DNA shown in SEQ ID NO.2; The 3' corresponding sequence is the RNA encoded by the DNA shown in SEQ ID NO.3; The loop region is the RNA encoded by the DNA shown in SEQ ID NO.4; The first matching sequence, the second matching sequence, the third matching sequence and the fourth matching sequence are RNAs transcribed from DNAs with the sequences shown in SEQ ID NOs. 7-10 respectively.

3. A DNA molecule or a DNA molecule composition, wherein the DNA molecule or the DNA molecule composition comprises a first DNA component and a second DNA component; The structure of the first DNA component from the 5' end to the 3' end is sequentially composed of the first matching sequence-enzyme region-third matching sequence-loop region; The structure of the second DNA component from the 5' end to the 3' end is the fourth matching sequence-5' corresponding sequence-sequence to be cyclized-3' corresponding sequence-second matching sequence; The first DNA component is transcribed into RNA and prepared into circular RNA; The sequence of the enzyme region is shown in SEQ ID NO.1; The sequences of the 5' corresponding sequence and the 3' corresponding sequence are shown in SEQ ID NO.2-3 respectively; The sequence of the loop region is shown in SEQ ID NO.4; The first matching sequence, the second matching sequence, the third matching sequence, and the fourth matching sequence are shown in SEQ ID NOs. 7-10 respectively; The sequence to be cyclized comprises DNA encoding the target RNA.

4. A DNA molecule or a DNA molecule composition, wherein the DNA molecule or the DNA molecule composition comprises a first DNA component and a second DNA component; The structure of the first DNA component from the 5' end to the 3' end is sequentially composed of the first matching sequence-enzyme region-third matching sequence-loop region; The structure of the second DNA component from the 5' end to the 3' end is the fourth matching sequence-5' corresponding sequence-enzyme cleavage site-3' corresponding sequence-second matching sequence; The first DNA component is transcribed into RNA and prepared into circular RNA; The sequence of the enzyme region is shown in SEQ ID NO.1; The sequences of the 5' corresponding sequence and the 3' corresponding sequence are shown in SEQ ID NO.2-3 respectively; The sequence of the loop region is shown in SEQ ID NO.4; The first matching sequence, the second matching sequence, the third matching sequence and the fourth matching sequence are shown in SEQ ID NOs. 7-10 respectively.

5. A vector or a vector composition, wherein the vector or the vector composition contains a DNA molecule or a DNA molecule composition encoding the RNA composition of claim 1.

6. The vector or the combination of vectors according to claim 5, wherein the vector is an expression vector.

7. A vector or a vector composition, wherein the vector or the vector composition contains a DNA molecule or a DNA molecule composition encoding the RNA composition of claim 2.

8. The vector or a combination of vectors according to claim 7, wherein the vector is an expression vector.

9. A method for stably and efficiently producing circular RNA, the method comprising mixing the first RNA component and the second RNA component in the RNA composition of claim 1 and incubating them in a circularization buffer; Alternatively, the method comprises transcribing the DNA molecule or DNA molecule composition of claim 3 into an RNA product, and incubating the RNA product in a cyclization buffer, wherein: The first DNA component is transcribed into an RNA product and made circular.

10. The method of claim 9, wherein the molar ratio of the first RNA component to the second RNA component is 2:

1. The method according to claim 9 , wherein the incubation is carried out at a temperature of 37-60° C. The method according to claim 11 , wherein the incubation is performed at 55° C.

13. The method of claim 9, wherein the incubation period is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 minutes. The method of claim 13 , wherein the incubation time is 15 minutes.

15. The method of claim 9, wherein the buffer contains GTP or excess GMP. The method according to claim 15 , wherein the concentration of GTP in the buffer is 2 mM.

17. The method of claim 9, wherein the buffer contains magnesium ions.

18. The method of claim 17, wherein the buffer contains MgCl2.

19. The method of claim 18, wherein the buffer contains 10 mM MgCl2.

20. The method of claim 9, wherein the pH value of the buffer is 7-8.

21. The method of claim 20, wherein the pH value of the buffer is 7.

5.

22. The method of claim 9, wherein the buffer comprises 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.

5.

23. A cell containing or expressing one or more of the RNA composition of claim 1, the DNA molecule or DNA molecule composition of claim 3, or the vector or vector combination of claims 5 or 6.

24. The cell of claim 23, which is a human immune cell.

25. The cell of claim 24, wherein the human immune cell is a T cell, a B cell or a NK cell.

26. A cell containing or expressing one or more of the RNA composition of claim 2, the DNA molecule or DNA molecule composition of claim 4, or the vector or vector combination of claims 7 or 8.

27. The cell of claim 26, which is a human immune cell.

28. The cell of claim 27, wherein the human immune cell is a T cell, a B cell or a NK cell.

29. A method for expressing a target RNA in a cell for non-therapeutic purposes, the method comprising the step of transferring the vector or a combination of vectors according to claim 5 or 6 into the cell.

30. The method of claim 29, wherein the method of transferring into cells is electroporation, calcium phosphate precipitation, calcium chloride precipitation, microinjection, polyethylene glycol method, DEAE-dextran method, cationic liposome method or lithium acetate-DMSO method.

31. Use of the RNA composition of claim 1, the DNA molecule or the DNA molecule composition of claim 3, the vector or the vector composition of claim 5 or 6, or the cell of any one of claims 23 to 25 in preparing circular RNA or increasing the content or expression of target RNA in cells, wherein the use is for non-therapeutic purposes.

32. The use according to claim 31, wherein the target RNA is an antigen, an antibody, an antigen binding fragment, a chimeric antigen receptor, a fluorescent protein, a protein with disease therapeutic activity, or a protein with gene editing activity.

33. Use of the cell according to any one of claims 23 to 25 in preparing a product that stably and highly expresses a target RNA.

34. The use according to claim 33, wherein the target RNA is an antigen, an antibody, an antigen binding fragment, a chimeric antigen receptor, a fluorescent protein, a protein with disease therapeutic activity, or a protein with gene editing activity.

35. The use according to claim 33, wherein the product is a vaccine.

36. The use according to claim 35, wherein the vaccine is an RNA vaccine.

Images