In situ molecular labeling probe, kit and method for identifying Aspergillus

Abstract

The present invention belongs to the technical field of microbial detection, and specifically relates to an in situ molecular labeling probe, a kit and an identification method of Aspergillus for in situ detection of tissues. The molecular labeling probe includes an oligonucleotide with a base sequence of SEQ ID NO.1 or SEQ ID NO.2, and a probe for identifying Aspergillus can be obtained by labeling the aforementioned oligonucleotide with a marker. Based on the probe, the present invention also develops a corresponding Aspergillus identification kit and an Aspergillus identification method. The in situ molecular labeling probe of the present invention has been proven to be able to quickly, highly sensitively and specifically identify whether the pathogenic fungal pathogen of the infection belongs to the genus Aspergillus, which will be conducive to early determination of an accurate antifungal treatment plan. The present invention provides an efficient and reliable detection means for confirming Aspergillus infection in invasive fungal diseases.

Description

Technical Field

[0001] The present invention relates to the technical field of biomolecule detection, and in particular to an in-situ molecular labeling probe for identifying Aspergillus, a kit and an Aspergillus identification method. Background Art

[0002] Invasive fungal infections have high morbidity and mortality in critically ill patients and immunosuppressed populations. Aspergillus is a common type of fungal infection, which has similar clinical manifestations to Mucor and lacks specificity, but is different from Mucor in treatment and drug selection.

[0003] Although there are many methods for detecting pathogenic fungi in clinical practice, they have not been able to meet the clinical needs of rapid, accurate, economical and easy operation. Histopathology is one of the gold standards for diagnosing invasive fungal infections, but due to the similar morphological structures of fungi, it is difficult to identify the species of fungal infections by observing the morphological characteristics of fungi only through HE staining and special staining methods. Although the morphological histopathological special staining method is simple and easy to operate, it cannot be accurately classified, especially difficult to distinguish infections of filamentous fungi such as Aspergillus and Mucor. It mostly relies on the personal experience of diagnostic workers and has a certain degree of subjectivity. When the fungal content is small and the morphology of fungi of different genera overlaps, it is easy to lead to misjudgment. Fungal culture method has high accuracy, but low positive rate, long culture cycle, and it is difficult to determine whether it is colonizing bacteria or pathogenic bacteria, which is not suitable for rapid diagnosis. G test and GM test can achieve rapid detection, but can only identify some genera, not species, and drug treatment may affect the accuracy of the results. At present, the commonly used molecular detection method for fungal detection is PCR, which can only be detected within a specific detection threshold, with a positive rate of 15-90%. The test samples are mostly limited to body fluid specimens such as blood, bronchoalveolar lavage fluid, and sputum. There is no test suitable for paraffin specimens. The fungal load in the sample has an important impact on the test results. There are also problems such as difficulty in excluding non-pathogenic bacteria and environmental contamination bacteria, high requirements for laboratory hardware configuration and technical operations, and unsuitability for popularization in primary hospitals. The problems with these detection methods will make it difficult to diagnose fungal infections in the early stage, seriously affecting the optimal use of antifungal drugs, and leading to poor patient prognosis.

[0004] In situ identification of the pathogenic fungal pathogens of infection from formalin-fixed paraffin-embedded tissues by molecular methods is an effective method for quickly determining invasive fungal infections, which can overcome the shortcomings of morphological staining, fungal culture, G test and GM test, and PCR detection methods; and is not affected by the fungal load of the sample, and can be detected even if only one fungal DNA is present. At present, there is no standard and unified hybridization method for in situ hybridization detection of Aspergillus, and no large-scale experimental data has been found. The present invention not only develops a specific Aspergillus detection probe but also proposes a standard Aspergillus identification method. Summary of the invention

[0005] 1. Technical issues to be resolved

[0006] In view of the above-mentioned shortcomings and deficiencies of the prior art, the present invention provides an in situ molecular labeling probe, a kit and a method for identifying Aspergillus for rapid, sensitive and specific identification of whether the pathogenic fungal pathogen of infection belongs to Aspergillus, which is conducive to early determination of an accurate antifungal treatment plan.

[0007] (II) Technical solution

[0008] In a first aspect, the present invention provides an in situ molecular labeling probe for identifying Aspergillus, comprising an oligonucleotide having a base sequence of SEQ ID NO.1 or SEQ ID NO.2.

[0009] The sequence of SEQ ID NO.1 is ATCATAGAAACACCGCCCGATCCCTAGTC, and the sequence of SEQ ID NO.2 is CCCCGAAGGGCATTGGTTTTTTATCTAAT. The oligonucleotides of SEQ ID NO.1-2 are designed with the conservative sequence of 18SrRNA of Aspergillus genome as the target gene, and can hybridize with the target gene to generate a strong signal.

[0010] According to a preferred embodiment of the present invention, the in situ molecular labeling probe for identifying Aspergillus further comprises a label coupled to the oligonucleotide; the label is a radioactive label or a non-radioactive label.

[0011] Among them, the radioactive marker is at least one of 32P, 35S, and 3H; the non-radioactive marker is at least one of biotin, digoxigenin, fluorescein, and enzyme labeling; the aforementioned markers can be labeled by end labeling, random primer labeling, nick translation labeling, or in vitro transcription labeling.

[0012] According to a preferred embodiment of the present invention, the marker is digoxin, and digoxin is labeled at the 3'-end of the base sequence shown in SEQ ID NO.1 or SEQ ID NO.2.

[0013] Digoxigenin (DIG) has the following advantages as a probe marker: ① Good safety, no risk of radioactive contamination, safer for the human body and the environment; ② High sensitivity: Anti-digoxigenin antibodies have a high affinity for digoxigenin, which can achieve a fairly high detection sensitivity, especially in in situ hybridization (ISH), Southern / Northern / Western Blotting and other experiments. ③ Easy to detect: Digoxigenin labeling can be visualized through a variety of detection methods, such as enzyme-linked reaction (such as coupling with alkaline phosphatase or horseradish peroxidase, and then reacting with the corresponding substrate to develop color or emit light), fluorescence detection (such as observing under a fluorescence microscope after binding with fluorescein), etc., providing flexible and diverse detection schemes. ④ Good stability: Digoxigenin markers are relatively stable and not easy to degrade, which prolongs the storage time and service life of the markers. ⑤ Low cost: Compared with isotope labeling, digoxigenin labeling has lower costs, is more convenient to use, and does not require special safety protection facilities.

[0014] According to a preferred embodiment of the present invention, the in situ molecular marker probe can detect and identify cells, tissue sections, DNA / RNA samples, etc. as test samples, and can specifically and highly sensitively detect a variety of common clinical Aspergillus pathogens, including Aspergillus niger, Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus, Aspergillus nidulans, and other Aspergillus reported as pathogenic Aspergillus in individual cases, such as Aspergillus versicolor, Aspergillus ustus, Aspergillus glaucus, Aspergillus tubingensis, etc., and can accurately distinguish Mucor and Aspergillus. When the Aspergillus is any of the aforementioned, the test result is positive.

[0015] In a second aspect, the present invention provides an Aspergillus identification kit, which comprises the in situ molecular labeling probe of any one of the above embodiments.

[0016] According to a preferred embodiment of the present invention, the identification kit comprises: a digoxigenin-labeled in situ molecular labeling probe, an anti-digoxigenin antibody, a DAB color developer, hematoxylin and a blueing solution.

[0017] In a third aspect, the present invention provides a method for identifying Aspergillus, which uses the in situ molecular labeling probe of any one of the above embodiments for detection and identification.

[0018] According to a preferred embodiment of the present invention, the detection method comprises:

[0019] S1. Take tissue paraffin sections as test samples, and sequentially bake, dewax, rehydrate with ethanol of decreasing concentration, permeabilize with permeabilization solution, repair and wash with pure water;

[0020] S2, using H2O2 to block the endogenous peroxidase of the test sample, and using lysozyme to digest the fungal cell wall of the test sample;

[0021] S3, using protease to digest the protein in the test sample, then washing with pure water to terminate the digestion, and dehydrating;

[0022] S4, adding digoxigenin-labeled in situ molecular labeling probe to the test sample, hybridizing in a hybridizer at 40-43°C for 2-4 hours, then washing, adding anti-digoxigenin antibody and incubating at 36.5-37.5°C for 20-40 minutes, and washing after the incubation;

[0023] S5. Perform DAB color development at room temperature, followed by washing, counterstaining with hematoxylin, treating the test samples with bluing solution, dehydrating with gradient ethanol concentrations, sealing, and observing and analyzing under a microscope.

[0024] Among them, in S1, the permeabilization treatment of the permeation solution is mainly achieved by chemical reagents such as Triton X-100, Tween or Nonidet P-40 (NP-40) and other non-ionic detergents. These reagents can destroy the lipid bilayer structure of the cell membrane and form temporary holes, so that the probe can penetrate the cell membrane faster and enter the cell, shorten the probe hybridization time, and improve the sensitivity and accuracy of subsequent detection. The repair treatment mainly uses EDTA to remove the cross-linking between metal ions and proteins, thereby restoring the original spatial conformation and activity of the antigen and improving the sensitivity and specificity of subsequent immunostaining.

[0025] (III) Beneficial effects

[0026] The present invention uses the conservative sequence of 18S rRNA of the Aspergillus genome as the target gene, designs a plurality of Aspergillus-specific probes that can be cross-linked with the target gene, and finally selects the probe with the base sequence of SEQ ID NO.1 or SEQ ID NO.2 through screening. After sequence alignment, the segment targeted by the probe is highly homologous to most fungi in the genus Aspergillus, has no homology or low homology to Mucor and Rhizopus, has no homology or low homology to bacteria, and has no homology to the human genome; therefore, the use of the probe to identify Aspergillus has high specificity and can generate high-intensity hybridization signals.

[0027] At present, there is no standard and unified hybridization method for in situ hybridization detection of Aspergillus, and there is no large-scale experimental data. The present invention proposes a standard Aspergillus identification method based on the developed Aspergillus detection probe. Among them, the oligonucleotide probe of sequence SEQ ID NO.1 has a sensitivity of up to 95% for detecting Aspergillus and has high specificity; followed by SEQ ID NO.2 oligonucleotide probe, which has a slightly lower sensitivity than SEQ ID NO.1 probe, but also has high specificity. They provide efficient and reliable detection means for confirming Aspergillus infection in invasive fungal diseases.

[0028] When tissue sections are used as test samples, the present invention uses a permeabilization solution (non-ionic detergent) to permeabilize the tissue samples at room temperature for 20 minutes, and hybridizes at 42° C. for 2 hours to achieve an effect equivalent to overnight hybridization, shortens the hybridization time, improves the identification efficiency of Aspergillus infection, and provides an earlier and faster guidance basis for determining antifungal treatment plans. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of the composition structure of fungal ribosomes.

[0030] Figure 2 The hybridization effect comparison of the ASP-P1 probe hybridization at 42°C overnight and the sample permeabilization solution permeabilization for 20 minutes + ASP-P1 probe hybridization at 42°C for 2 hours in Example 4 is shown. DETAILED DESCRIPTION

[0031] In order to better explain the present invention and facilitate understanding, the present invention is described in detail below through specific implementation modes in conjunction with the accompanying drawings.

[0032] Example 1

[0033] The process of designing an in situ molecular labeling probe for identifying Aspergillus genus in the present invention is as follows:

[0034] like Figure 1As shown in Figure 1, ribosomes are composed of ribosomal RNA (rRNA) and proteins. rRNA is usually divided into 5S rRNA, 5.8S rRNA, 18S rRNA, and 28S rRNA according to different sedimentation coefficients. Among them, 18S rRNA, 5.8S rRNA, 28S rRNA and the internal transcribed spacer (ITS1 and ITS2) between them are conserved regions. Conserved regions reflect the relationship between biological species and are often used to identify species and strains. The 18S rRNA gene is a DNA sequence that encodes the small subunit of the eukaryotic ribosome and is one of the most conserved genes in organisms. Previous studies have shown that various genera of fungi are highly conserved in the 18S and 28S rRNA regions.

[0035] In order to obtain specific probes that can identify Aspergillus, the inventor team first downloaded nucleotide sequences of homologous conserved regions of multiple common clinical Aspergillus pathogens that cause human infections from NCBI, including Aspergillus niger, Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus, and Aspergillus sulcatus, and used the clustalW function of the Bioedit software to align the sequences, and selected segments that were highly homologous to common clinical Aspergillus pathogens. Subsequently, NCBI-BLAST was used for online sequence alignment to confirm whether the segment had no homology or low homology with nucleotide sequences other than Aspergillus (e.g., human genomic DNA, common clinical Mucor pathogens, and other fungi and bacteria other than Aspergillus).

[0036] After a large number of sequence comparisons and screening, the conservative sequence of the 18S rRNA of the Aspergillus genome was finally determined as the target gene, and several oligonucleotides that can specifically crosslink with the target gene were designed according to the principle of complementary pairing. However, since the target position of the oligonucleotide probe binding to rRNA can affect the hybridization signal intensity, 3 oligonucleotides were finally screened (see Table 1), among which the oligonucleotide shown in SEQ ID NO.1 or SEQ ID NO.2 can generate a strong signal after binding to the segment, with high sensitivity, and can be used for subsequent Aspergillus detection.

[0037] The sample detection experiment shows that the oligonucleotide probes ASP-P1 and ASP-P2 screened by the present invention can simultaneously detect a variety of common clinical Aspergillus pathogens (Aspergillus niger, Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus, Aspergillus groveus, and other Aspergillus), and the sensitivity of in situ hybridization detection of Aspergillus is high. That is to say, when any of the aforementioned Aspergillus is present in the test sample, the test results are all positive. In addition, the oligonucleotides designed and screened by the present invention can specifically and highly sensitively identify common clinical Aspergillus pathogens, but do not cross-link with other fungal species such as Candida albicans, Oleophaga, common clinical Mucor pathogens such as Mucor racemosus, Rhizopus arrhizus, etc., bacteria, etc., fully realizing the specificity of the nucleic acid probe without losing sensitivity.

[0038] Table 1:

[0039]

[0040]

[0041] It should be noted that the probe marker can be any known marker, such as a radioactive marker or a non-radioactive marker. The radioactive marker is at least one of 32P, 35S, and 3H; the non-radioactive marker is at least one of biotin, digoxigenin, fluorescein, and enzyme labeling; the labeling method can be any of terminal labeling, random primer labeling, nick translation labeling, or in vitro transcription labeling. In this embodiment, in order to facilitate subsequent detection and comparison, digoxigenin was uniformly used to label the oligonucleotides of the sequence SEQ ID NO.1-3 to obtain probes (the probe names are ASP-P1, ASP-P2, and ASP-P3), and digoxigenin was coupled to the 3'-end of the sequence.

[0042] Each probe used in this application was synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0043] Example 2

[0044] This example uses digoxigenin-labeled oligonucleotides of SEQ ID NO. 1-3 as probes to conduct a sample detection experiment. The experiment includes three parts:

[0045] 1. Sample sources: Positive control: 4 specimens confirmed as Aspergillus infection archived in the Pathology Department of Beijing Tongren Hospital, 1 wax block of Aspergillus fumigatus standard, 1 wax block of Aspergillus flavus standard, and 1 wax block of Aspergillus niger standard; Negative control: 1 wax block of Rhizopus arrhizus standard, 1 wax block of Mucor racemosus standard, 1 wax block of Candida albicans standard, 1 wax block of Oleophora oleifera standard, and 1 specimen confirmed as bacterial infection archived in the Pathology Department of Beijing Tongren Hospital; the standard wax block strains were purchased from the China Center for Microbiological Culture Collection.

[0046] 2. The in situ hybridization detection method for Aspergillus is as follows:

[0047] (1) Bake 4 μm paraffin sections at 65°C for 2 h;

[0048] (2) Dewaxing and rehydration: xylene dewaxing, room temperature, 10 min, repeated 3 times; anhydrous ethanol, room temperature, 3 min; 90% ethanol, room temperature, 3 min; 70% ethanol, room temperature, 3 min; pure water, room temperature, 3 min, washing;

[0049] (3) Permeabilization: 1% Triton X-100, room temperature, 20 min; pure water, room temperature, 3 min, washing;

[0050] (4) Repair: 1×EDTA, 98°C, 6 min; pure water, room temperature, 3 min, washing;

[0051] (5) Blocking endogenous peroxidase: 3% H2O2, room temperature, 10 min, pure water, room temperature, 3 min, washing;

[0052] (6) Fungal cell wall digestion: lysozyme 10 mg / mL, 37°C, 20 min, pure water, room temperature, 3 min, washing;

[0053] (7) Digestion: pepsin B working solution, 37°C, 30 min;

[0054] (8) Stop digestion: pure water, room temperature, 3 min, wash, 2 times;

[0055] (9) Dehydration: 70% ethanol, room temperature, 3 min; 90% ethanol, room temperature, 3 min; anhydrous ethanol, room temperature, 3 min;

[0056] (10) Add probe: 8-10 μL / sheet, cover with coverslip, and seal the edge of the coverslip with sealing glue;

[0057] (11) Hybridization: hybridizer, 42°C, 3 h;

[0058] (12) Uncovering and washing: Remove the sealing glue with tweezers, wash with 50% formamide, 37°C, 5 min, 3 times;

[0059] (13) Anti-digoxigenin antibody incubation: 37°C, 30 min;

[0060] (14) Washing: PBST, room temperature, 2 min, 3 times;

[0061] (15) DAB color development: DAB color development was performed according to the DAB color development protocol at room temperature for 5 min.

[0062] (16) Washing: pure water, room temperature, 2 min, 3 times;

[0063] (17) Counterstaining: hematoxylin, room temperature, 10 min;

[0064] (18) Bluing: Bluing solution, room temperature, 2 min;

[0065] (19) Dehydration: 70% ethanol, room temperature, 3 min; 90% ethanol, room temperature, 3 min; anhydrous ethanol, room temperature, 3 min;

[0066] (20) Sealing: Seal the slides with sealing glue and examine them under a microscope.

[0067] 3. The test results are shown in the table (Table 2), "+" indicates a positive probe test result, and "-" indicates a negative probe test result.

[0068] Table 2:

[0069]

[0070]

[0071] The sensitivity and specificity of the digoxigenin-labeled oligonucleotide probes of SEQ ID NO. 1-3 are shown in the following table (Table 3):

[0072] Table 3:

[0073] Probe Name Sensitivity Specificity ASP-P1 100％(7 / 7) 100％(5 / 5) ASP-P2 85.7％(6 / 7) 80％(4 / 5) ASP-P3 42.9％(3 / 7) 100％(5 / 5)

[0074] From the above sample test results, it can be seen that the three probes (ASP-P1, ASP-P2 and ASP-P3 probes) have good detection specificity, all above 80%, but the sensitivity of ASP-P3 probe is poor, only 42.9%. ASP-P1 probe has the best sensitivity and specificity, and it can be considered that this probe has the best detection effect for Aspergillus, followed by ASP-P2 probe, whose sensitivity is slightly lower than ASP-P1. Therefore, the following experiments were tested with ASP-P1 probe.

[0075] Example 3

[0076] In this example, the digoxigenin-labeled oligonucleotide of SEQ ID NO. 1 was used as a probe (ASP-P1 probe) to perform a sample detection experiment.

[0077] Sample source: A total of 32 tissue samples of known fungal infection types were selected from Beijing Tongren Hospital, including 19 Aspergillus infection samples (6 Aspergillus standard samples, 13 Aspergillus infection clinical samples), 13 non-Aspergillus infection cross samples (1 bacterial sample, 8 Mucor infection clinical samples, 4 Mucor standard samples), the sample section thickness was 4 μm, and the ASP-P1 probe was used to perform in situ hybridization detection of Aspergillus according to the method of Example 2. The test results are shown in Table 4, "+" indicates that the probe test result is positive, and "-" indicates that the probe test result is negative.

[0078] Table 4

[0079]

[0080]

[0081] According to statistics, the sensitivity of ASP-P1 probe for in situ hybridization detection of Aspergillus in samples reached 94.7% (18 / 19), and the specificity reached 92.3% (12 / 13).

[0082] Example 4

[0083] In this example, the ASP-P1 probe was used to perform overnight hybridization and 2-hour hybridization comparison on samples infected with Aspergillus at 42° C. The test samples were selected from the two samples in Example 3: Aspergillus clinical tissues Z-14 and Z-17.

[0084] The 2h hybridization was performed according to the "Aspergillus in situ hybridization detection method" in Example 2, and the setting in step (11) of the detection method was "hybridizer, 42°C, 2h".

[0085] The 42°C overnight hybridization is hybridization at 42°C for more than 12 hours in a hybridizer, but the pre-treatment process of the detection sample does not include step (3) in the "Aspergillus in situ hybridization detection method" in Example 2.

[0086] Comparison of the hybridization effects of the above two methods, see Figure 2 shown.

[0087] Depend on Figure 2 By comparison, it can be seen that when the test sample is permeabilized at room temperature for 20 minutes using a permeabilization solution during the pre-treatment process, followed by hybridization at 42°C for 2 hours, the hybridization effect can be equivalent to that of overnight (12 hours) hybridization. This can greatly shorten the hybridization time and improve the detection efficiency, and is particularly suitable for rapid detection of a large number of samples.

[0088] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for in situ identification of Aspergillus for non-diagnostic purposes, characterized in that: In situ molecular labeling probes are used for detection and identification; the detection method comprises the following steps: (1) Using tissue paraffin sections as test samples, bake 4 μm paraffin sections at 65°C for 2 h; (2) Dewaxing and rehydration: xylene dewaxing, room temperature, 10 min, repeated 3 times; anhydrous ethanol, room temperature, 3 min; 90% ethanol, room temperature, 3 min; 70% ethanol, room temperature, 3 min; pure water, room temperature, 3 min, washing; (3) Permeabilization: 1% Triton X-100, room temperature, 20 min; Pure water, room temperature, 3 min, washing; (4) Repair: 1×EDTA, 98°C, 6 min; pure water, room temperature, 3 min, washing; (5) Blocking endogenous peroxidase: 3% H2O2, room temperature, 10 min, pure water, room temperature, 3 min, washing; (6) Fungal cell wall digestion: lysozyme 10 mg / mL, 37°C, 20 min, pure water, room temperature, 3 min, washing; (7) Digestion: pepsin B working solution, 37°C, 30 min; (8) Stop digestion: pure water, room temperature, 3 min, wash, 2 times; (9) Dehydration: 70% ethanol, room temperature, 3 min; 90% ethanol, room temperature, 3 min; anhydrous ethanol, room temperature, 3 min; (10) Adding probe: 8-10 μL / sheet, covering with a coverslip, and sealing the edge of the coverslip with sealing glue; the base sequence of the probe is shown in SEQ ID NO.1, and digoxigenin is labeled at the 3'-end of the base sequence shown in SEQ ID NO.1; (11) Hybridization: hybridizer, 42°C, 2h or 3h; (12) Uncovering and washing: Remove the sealing glue with tweezers, wash with 50% formamide, 37°C, 5 min, 3 times; (13) Anti-digoxigenin antibody incubation: 37°C, 30 min; (14) Washing: PBST, room temperature, 2 min, 3 times; (15) DAB color development: DAB color development was performed according to the DAB color development protocol at room temperature for 5 min. (16) Washing: pure water, room temperature, 2 min, 3 times; (17) Counterstaining: hematoxylin, room temperature, 10 min; (18) Bluing: Bluing solution, room temperature, 2 min; (19) Dehydration: 70% ethanol, room temperature, 3 min; 90% ethanol, room temperature, 3 min; anhydrous ethanol, room temperature, 3 min; (20) Sealing: Seal the slides with sealing glue and examine them under a microscope.

Images