A grape miR395 gene related to gray mold and its target gene APS1 and its application

Abstract

The present invention belongs to the field of gene technology and discloses a grape miR395 gene associated with gray mold. The nucleotide sequence of the grape miR395 gene is shown in SEQ ID NO. 1. The present invention discovered and developed a regulatory site for the grape miR395 gene, located at deoxyribonucleotides 486 to 506 of the APS1 (VIT_05s0020g04210) gene, and a cleavage site at deoxyribonucleotide 497. This new regulatory site provides a new genetic resource for breeding grapes resistant to gray mold and for specific traits.

Description

Technical Field

[0001] The present invention belongs to the field of gene technology, in particular to a grape miR395 gene related to gray mold, a target gene APS1 thereof and applications thereof. Background Art

[0002] Gray mold (Botrytis cinerea) is a typical lethal pathogen that, upon invading its host, triggers programmed cell death, leading to decay. While it can infect a wide range of plants, including strawberries and grapes, it is most destructive to mature or aging tissues of dicot hosts. Whether pre-harvest or post-harvest, as long as the host's physiology is suitable and the environment is conducive to the germination and growth of gray mold, gray mold outbreaks can occur, causing significant economic losses.

[0003] Among measures to prevent and control gray mold, the use of fungicides is the most common method. However, because gray mold is prone to developing resistance and mutation, long-term use of fungicides can lead to a gradual buildup of resistance, reducing the effectiveness of fungicides. Furthermore, drug-resistant pathogens can spread unchecked, leading to outbreaks and further harming crops. Furthermore, excessive use of fungicides can pollute the environment, harming ecological balance and human health.

[0004] Over the course of evolution, plants have developed disease-resistance genes to combat various pathogens. Discovering and utilizing these genes to improve plant disease resistance is a fundamental way to prevent and control disease while protecting the environment.

[0005] MicroRNA (miRNA) is a class of endogenous, single-stranded, non-coding small RNA molecules approximately 20-24 nucleotides in length. Transcribed from endogenous miRNA genes, these single-stranded RNAs, containing a double-stranded stem-loop structure, are cleaved by DCL proteins. They bind to the RNA-induced silencing complex (RISC) and cleave target gene mRNAs through base pairing, inhibiting mRNA translation. In recent years, numerous studies have revealed that miRNAs are important regulatory factors involved in plant disease resistance responses. They may participate in plant disease resistance by inhibiting or activating the expression of certain target genes, regulating plant signaling pathways, activating transcription factors involved in disease resistance pathways, and modulating various metabolic pathways within the plant. Although significant progress has been made in theoretical research on miRNAs, the current resource of disease resistance-related miRNAs in grapes remains very limited. Discovering new miRNAs involved in disease resistance regulation and fully utilizing them in production is crucial for breeding disease-resistant grape varieties and generating economic value.

[0006] Through searching, we found the following patent publications related to the patent application of this invention:

[0007] 1. A method for preventing gray mold in fruit by pre-harvest low-sulfur treatment (CN113980927A) discloses a method for preventing gray mold in fruit by pre-harvest low-sulfur treatment. By controlling the application of sulfur-containing fertilizers during the fruit cultivation process, the sulfur content in the fruit is reduced, thereby reducing the fruit's susceptibility to gray mold infection and reducing the incidence of gray mold in the fruit. This method requires long-term treatment during the growth and development of the crop, which is time-consuming and costly. It is a preventive measure for gray mold, but its effectiveness is limited, and prevention and control at the genetic level of the fruit itself is urgently needed.

[0008] 2. Botrytis cinerea genes Bcmet3 and Bcmet16 related to pathogenicity and their applications (CN111118039A) disclose Botrytis cinerea genes Bcmet3 and Bcmet16 related to pathogenicity and their applications in preventing and treating botrytis cinerea. It was found that Bcmet3 and Bcmet16 are important genes that affect the pathogenicity of Botrytis cinerea, and knocking out these two genes can significantly reduce the infection ability of Botrytis cinerea. The two genes can be used as targets in the design and screening of anti-Botrytis cinerea agents or other treatments to develop new fungicides. This patent discovered two important pathogenic genes in Botrytis cinerea, which can be used to develop new fungicides. However, due to the easy variation of Botrytis cinerea itself, long-term use of fungicides may cause it to develop drug resistance, and there is still room for improvement.

[0009] 3. A miRNA associated with rice blast resistance, its corresponding precursor, and its application (CN111118005A) discloses a miRNA-T21 associated with rice blast resistance. It was identified and confirmed to negatively regulate blast resistance by inhibiting the expression of OsCYS1 and OsPAO4, thereby regulating cysteine ​​synthesis and H2O2 accumulation. However, miRNA resources related to disease resistance in grapes are rare and warrant further exploration.

[0010] By comparison, the patent application of the present invention is essentially different from the above patent disclosure documents. Summary of the Invention

[0011] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a grape miR395 gene related to gray mold and its target gene APS1 and applications.

[0012] The technical solution adopted by the present invention to solve its technical problem is:

[0013] A grape miR395 gene related to gray mold, the nucleotide sequence of the grape miR395 gene is shown in SEQ ID NO.1;

[0014] The nucleotide sequence shown in SEQ ID NO.1 consists of 426 deoxyribonucleotides of the grape miR395 gene and its upstream and downstream non-coding sequences. In the sequence shown in SEQ ID NO.1, deoxyribonucleotides from positions 140 to 226 represent the miR395 gene transcribed sequence; deoxyribonucleotides from positions 196 to 216 represent the mature sequence of the miR395 gene; and the remaining sequences represent upstream and downstream non-coding sequences.

[0015] The application of the grape miR395 gene as described above in the breeding of grapes resistant to gray mold and / or the cultivation of new transgenic varieties.

[0016] The application of the grape miR395 gene as described above in the regulation of grape resistance to gray mold.

[0017] Furthermore, the regulation can affect the resistance of grapes to gray mold by regulating the expression level of the grape miR395 gene.

[0018] Furthermore, the grape miR395 gene negatively regulates gray mold resistance by suppressing the expression of the target gene VvAPS1 to regulate sulfate accumulation.

[0019] Application of overexpression of the grape miR395 gene as described above in improving resistance to grape botrytis cinerea.

[0020] The regulatory site APS1 of the grape miR395 gene as described above is the target gene of the grape miR395 gene, and its sequence is shown in SEQ ID NO.2;

[0021] The nucleotide sequence shown in SEQ ID NO.2 consists of 4294 deoxyribonucleotides of the APS1 (VIT_05s0020g04210) gene and its upstream and downstream non-coding sequences; the deoxyribonucleotides from positions 486 to 506 in the sequence shown in SEQ ID NO.2 are target sites regulated by the miR395 gene.

[0022] The application of the regulatory site APS1 of the grape miR395 gene as described above in the breeding of grapes resistant to gray mold and / or the cultivation of new transgenic varieties.

[0023] The application of the regulatory site APS1 of the grape miR395 gene as described above in the accumulation of sulfate ions in grape berries.

[0024] Furthermore, the regulatory site APS1 has a negative regulatory effect on sulfate ion accumulation in grape berries.

[0025] The advantages and positive effects achieved by the present invention are:

[0026] 1. The present invention discovered and developed that the regulatory site of the grape miR395 gene is the 486th to 506th deoxyribonucleotides of the APS1 (VIT_05s0020g04210) gene, and the cleavage site is the 497th deoxyribonucleotide. This new regulatory site provides a new genetic resource for breeding grapes resistant to gray mold and for specific traits.

[0027] 2. The grape miR395 gene of the present invention can enhance the fruit's resistance to gray mold by regulating the accumulation of sulfate ions in grape fruit.

[0028] 3. This study, through studying the biological functions of the grape miR395 gene, found that it plays a key regulatory role in grape resistance to gray mold. Modulating the expression level of grape miR395 can influence grape resistance to gray mold. Overexpression of this miRNA significantly enhances gray mold resistance. CRISPR / Cas9 gene editing technology can be used to target and edit the miRNA and its target gene, APS1, to improve gray mold resistance in grapes.

[0029] 4. The present invention found that grape miR395 regulates sulfate accumulation by inhibiting the expression of the target gene VvAPS1, thereby negatively regulating gray mold resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Figure 1 is a map of the regulatory sites of the grape miR395 gene in grapes according to the present invention; the grape miR395 gene has one target mRNA in grapes, which is transcribed from the gene VIT_05s0020g04210; the recognition site of miR395 is a 21-nt nucleotide sequence, and the corresponding recognition sites and cleavage sites of grape miR395 and the target mRNA are shown in the figure;

[0031] Figure 2 Figure 3 is a map of the starting transformation vector pNC-Cam2304-MSC35S in the present invention; pNC-Cam2304-MSC35S-miR395, pNC-Cam2304-MSC35S-miR395-STTM and pNC-Cam2304-MSC35S-APS1 all use this as the starting vector; the starting transformation vector is provided by Hainan Nixing Biotechnology Co., Ltd.

[0032] Figure 3 This is a map of the starting transformation vector pNC-Cam2304-RNAi in the present invention; wherein, pNC-Cam2304-APS1 uses this as the starting vector; the starting transformation vector is provided by Hainan Nixing Biotechnology Co., Ltd.

[0033] Figure 4 Figure 1 is a graph showing the expression levels of miR395 and its target genes in grape berries after transient transformation of the miR395 gene in the present invention; the upper graph shows the expression levels of miR395 and its target genes in grape berries with transient overexpression of miR395, and the lower graph shows the expression levels of miR395 and its target genes in grape berries with transient silencing of miR395;

[0034] Figure 5 This is a graph showing the expression level of the APS1 gene in grape fruit after transient transformation of the APS1 gene in the present invention;

[0035] Figure 6 This is a diagram showing the diameter of lesions on grape berries inoculated with Botrytis cinerea after transient transformation of the miR395 gene and the APS1 gene in the present invention;

[0036] Figure 7 This is a graph showing the results of sulfate ion concentration detection in grape fruit after transient transformation of the miR395 gene in the present invention;

[0037] Figure 8 This is a graph showing the results of sulfate ion concentration detection in grape berries after transient transformation of the APS1 gene in the present invention. DETAILED DESCRIPTION

[0038] The present invention will be further described below with reference to the following examples. The following examples are descriptive rather than restrictive, and the scope of protection of the present invention cannot be limited by the following examples.

[0039] The various experimental operations involved in the specific embodiments are all routine techniques in the field. For parts not specifically annotated in this document, ordinary technicians in this field can refer to various commonly used reference books, scientific literature or related instructions, manuals, etc. before the filing date of this invention to implement them.

[0040] A grape miR395 gene related to gray mold, the nucleotide sequence of the grape miR395 gene is shown in SEQ ID NO.1;

[0041] The nucleotide sequence shown in SEQ ID NO.1 consists of 426 deoxyribonucleotides of the grape miR395 gene and its upstream and downstream non-coding sequences. In the sequence shown in SEQ ID NO.1, deoxyribonucleotides from positions 140 to 226 represent the miR395 gene transcribed sequence; deoxyribonucleotides from positions 196 to 216 represent the mature sequence of the miR395 gene; and the remaining sequences represent upstream and downstream non-coding sequences.

[0042] The application of the grape miR395 gene as described above in the breeding of grapes resistant to gray mold and / or the cultivation of new transgenic varieties.

[0043] The application of the grape miR395 gene as described above in the regulation of grape resistance to gray mold.

[0044] Preferably, the regulation is to affect the resistance of grapes to gray mold by regulating the expression level of the grape miR395 gene.

[0045] Preferably, the grape miR395 gene negatively regulates gray mold resistance by suppressing the expression of the target gene VvAPS1 to regulate sulfate accumulation.

[0046] Application of overexpression of the grape miR395 gene as described above in improving resistance to grape botrytis cinerea.

[0047] The regulatory site APS1 of the grape miR395 gene as described above is the target gene of the grape miR395 gene, and its sequence is shown in SEQ ID NO.2;

[0048] The nucleotide sequence shown in SEQ ID NO.2 consists of 4294 deoxyribonucleotides of the APS1 (VIT_05s0020g04210) gene and its upstream and downstream non-coding sequences; the deoxyribonucleotides from positions 486 to 506 in the sequence shown in SEQ ID NO.2 are target sites regulated by the miR395 gene.

[0049] The application of the regulatory site APS1 of the grape miR395 gene as described above in the breeding of grapes resistant to gray mold and / or the cultivation of new transgenic varieties.

[0050] The application of the regulatory site APS1 of the grape miR395 gene as described above in the accumulation of sulfate ions in grape berries.

[0051] Preferably, the regulatory site APS1 has a negative regulatory effect on sulfate ion accumulation in grape berries.

[0052] Specifically, the relevant preparation and detection are as follows:

[0053] Example 1: Acquisition of miR395 target gene and overexpression material

[0054] (1) Based on the principle of sequence complementarity between plant miRNA and target mRNA, the recognition site of the miR395 gene in grapes was obtained through degradation group sequencing and 5' RACE experiments. It was found that the target gene of the miR395 gene in grapes is APS1, which is transcribed from the gene.

[0055] The recognition site of the miR395 gene is a nucleotide sequence of 21 nt in length. There is a good sequence match between the miR395 gene and the target gene mRNA at the corresponding recognition site. Figure 1 .

[0056] (2) Construction of miR395 gene overexpression / silencing vector

[0057] This example is about pNC-Cam2304-MSC35S-miR395 and

[0058] Construction method of pNC-Cam2304-MSC35S-miR395-STTM vector.

[0059] First, using Sunshine Rose grape genomic DNA as a template, the following forward and reverse sequences were designed: forward primer miR395F 5'-TGGGAACATGAGAACTCGCT-3', and reverse primer miR395R 5'-GCGGTTGACCTGTAATGGCT-3'. The miR395 gene sequence was amplified using PCR using a high-fidelity DNA polymerase. The miR395 gene fragment was recovered by electrophoresis. Following the instructions for the pNC-AEnTopo Blunt-End Cloning Vector Kit (from Nixing Bio), the recovered miR395 gene fragment was ligated with the entry vector pNC-AEnTopo. The ligation product was transformed into Escherichia coli DH5α and cultured overnight at 37°C to obtain a single clone. Select a single clone for culture and perform PCR verification. The clone that is verified correctly is further sequenced for verification. After culturing the clone that is sequenced correctly, extract the plasmid. Refer to the instructions of the Nimble Cloning Kit of Nimble Biotechnology and perform homologous recombination with the target plasmid pNC-Cam2304-MSC35S at a molar ratio of about 1:1. Repeat the transformation of Escherichia coli DH5α to the sequencing step to obtain the plant transformation vector (pNC-Cam2304-MSC35S-miR395). The map of the plant transformation vector is shown in Figure 2 .

[0060] pNC-Cam2304-MSC35S-miR395-STTM was prepared by Hangzhou Qingke Biotechnology Co., Ltd. according to the above steps. The STTM target sequence was 5′-GAGTTCCCCCctaAAACACTTCAG-3′.

[0061] pNC-Cam2304-MSC35S-APS1 was prepared by referring to the above steps, wherein the upstream primer of APS1 sequence was 5'-ATGGCGTCCATTTCCACACT-3', and the downstream primer was 5'-TTAAGCAGGAACAGTTTCCGGG-3'.

[0062] pNC-Cam2304-RNAi-APS1 was transformed with the vector pNC-Cam2304-RNAi according to the above steps. The APS1-RNAi sequence used the APS1 gene sequence as a template, the upstream primer was 5'-TCCCATGCACTATGCTGGTC-3', and the downstream primer was 5'-TTAAGCAGGAACAGTTTCCGGG-3'. Figure 3 .

[0063] (3) Transient transformation and identification of miR395 gene in grape fruit

[0064] The pNC-Cam2304-MSC35S-miR395 and pNC-Cam2304-MSC35S-miR395-STTM vectors were transformed into Agrobacterium, and then introduced into the rose hip fruit at the color change stage by vacuum infiltration mediated by Agrobacterium. Total RNA was extracted using the Universal Plant Total RNA Isolation Kit. First, the grape fruit sample was frozen in liquid nitrogen and ground into a powder. The sample was transferred to a 1.5 mL centrifuge tube. PSL reagent was added at a ratio of 0.6 mL lysis buffer to 200 mg of sample, mixed evenly, and centrifuged at 12,000 rpm for 5 min. The supernatant was added with anhydrous ethanol at a ratio of 2:1, mixed evenly, and transferred to a collection tube. The sample was centrifuged at 12,000 rpm for 30 s and the filtrate was discarded. 700 μL Buffer RWA was added and the sample was centrifuged at 12,000 rpm for 30 s and the filtrate was discarded. 500 μL Buffer RWB was added and the sample was centrifuged at 12,000 rpm for 30 s and the filtrate was discarded. The previous step was repeated and the sample was centrifuged at 12,000 rpm for 2 min. 50 μL RNase-free H2O was added and the sample was centrifuged at 12,000 rpm for 1 min. The sample was frozen at -80°C for later use. Subsequently, miR395 was reverse transcribed using the Novozymes miRNA 1st Strand cDNA Synthesis Kit (by stem-loop) based on the stem-loop method. The reverse transcription primer was 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGAGTTC-3'. The expression level of the miR395 gene was detected by qRT-PCR technology. The forward primer was 5'-GCGCTGAAGTGTTTGGGG-3' and the reverse primer was 5'-AGTGCAGGGTCCGAGGTATT-3'. The results showed that the expression level of the miR395 gene in the fruit transformed with pNC-Cam2304-MSC35S-miR395 was significantly higher than that in the wild-type control group, and the expression level of the miR395 gene in the fruit transformed with pNC-Cam2304-MSC35S-miR395-STTM was significantly lower than that in the wild-type control group (see Figure 4 ), indicating that the transient transformation experiment was successful and the plasmid could be normally expressed in the Sunshine Rose grape fruit at the color change stage.

[0065] (4) Analysis of target gene expression in grape berries after transient transformation of miR395 gene

[0066] The expression of target genes in grape berries transiently transformed with the miR395 gene was measured using the Novozymes HiScript III All-in-one RT SuperMix Perfect for qPCR Kit. The following steps were used: 0.5 μg of total RNA sample from grape berries transiently transformed with miR395, stored at -80°C, was added to 1 μL of Enzyme Mix and 4 μL of 5× All-in-one qRT SuperMix. The total volume was made up to 20 μL with RNase-free HO. Mix thoroughly by gently pipetting, and briefly centrifuge to collect the cDNA at the bottom of the tube. The tube was placed in a PCR instrument and the reaction program was set to: 50°C for 15 minutes, 85°C for 5 seconds. The cDNA sample was obtained and stored at -20°C.

[0067] The quantitative reagent of Novozymes was used to quantify miRNA. The reaction system was as follows: 5 μL 2×Taq ProUniversal SYBR qPCR Master Mix, 0.2 μL 10 μmol / L upstream and downstream primers, 1 μL cDNA, and sterile water was added to 10 μL for quantitative detection. The quantitative PCR instrument was set to the following reaction program: 95°C for 30s; 95°C for 10s, 60°C for 30s, and 40 cycles. GAPDH was used as the internal reference gene, and all reactions were repeated three times. The qRT-PCR results showed that the expression level of the target gene APS1 (VIT_05s0020g04210) in miR395 overexpressed grape berries was significantly lower than their expression levels in the wild type (see Figure 5 ).

[0068] Among them, the APS1 forward primer was 5'-CTTCGCGGGTTCATGAGAGA-3', and the reverse primer was

[0069] 5'-AGTCCCCCAAGTTCTGGCTA-3'; GAPDH forward primer

[0070] 5′-TCTCTTTGGTGAGAAGCCAG-3′, reverse primer 5′-CCAACAACGAACATAGGAGC-3′.

[0071] Example 2: Analysis of the gray mold resistance phenotype of grape berries transiently transformed with miR395 gene

[0072] Botrytis cinerea B05.10 was cultured on PDA medium for 10-12 days to produce spores. Scrape the spores, elute with a sterile 0.01% Triton X-100 solution, and filter the mycelium to obtain a spore suspension. Count the spores using a hemocytometer and adjust the concentration of the spore suspension to 1×10 6CFU / mL. Three days after transient transformation (same as in step (3) of Example 1), a 1.5×1.5×3 mm hole was made at the equator of the grape berries using a syringe needle. 10 μL of the spore suspension was inoculated into the wound and allowed to dry for 30 minutes. The berries were placed on a sterilized tray and incubated in a 26°C, 90% humidity incubator for 5 days. The diameter of the lesions on the berries was measured using a vernier caliper using the cross-hatch method.

[0073] See the results Figure 6 ,from Figure 6 As can be seen, the lesion diameter in grape berries transiently overexpressing miR395 was significantly smaller than that in the control group, decreasing by approximately 31% compared to the control group. In grape berries transiently silenced by miR395, the lesion diameter was significantly larger than that in the control group, increasing by approximately 21% compared to the control group. This result indicates that the miR395 gene positively regulates gray mold resistance in grape berries. In contrast, the lesion diameter in grape berries transiently overexpressing APS1 was significantly larger than that in the control group, increasing by approximately 19% compared to the control group. In grape berries transiently silenced by APS1, the lesion diameter was significantly smaller than that in the control group, decreasing by approximately 29% compared to the control group. This result indicates that the APS1 gene negatively regulates gray mold resistance in grape berries.

[0074] Example 3: Analysis of sulfate ion content in grape berries transiently transformed with miR395 gene

[0075] (1) Analysis of sulfate ion content in grape berries transiently transformed with miR395 gene

[0076] The sulfate ion content in the fruit of the rose hip cultivar at the color change stage after transient transformation (the transient transformation step is the same as step (3) of Example 1) was detected. The main analysis steps are as follows: the fruit sample is crushed with liquid nitrogen, dissolved in deionized water, ultrasonically extracted for 10 minutes, the supernatant after centrifugation is filtered with a 0.22 micron filter membrane, and the sulfate ion content in the filtrate is measured on an ion chromatograph. Compared with the wild type, the sulfate ion content in the rose hip cultivar with overexpression of the miR395 gene is higher, while the sulfate ion content in the rose hip cultivar with silenced miR395 gene is lower (see Figure 7 This result indicates that the miR395 gene has a positive regulatory effect on the accumulation of sulfate ions in grape berries.

[0077] (2) Analysis of sulfate ion content in grape berries transiently transformed with APS1 gene

[0078] The sulfate ion content in the fruit of the rose hip cultivar at the veraison stage after transient transformation (the transient transformation step is the same as step (3) of Example 1) was detected. The main analysis steps are as follows: the fruit sample is crushed with liquid nitrogen, dissolved in deionized water, ultrasonically extracted for 10 minutes, the supernatant after centrifugation is filtered with a 0.22 micron filter membrane, and the sulfate ion content in the filtrate is measured on an ion chromatograph. Compared with the wild type, the sulfate ion content in the fruit of the rose hip cultivar with overexpression of the APS1 gene is lower, while the sulfate ion content in the fruit of the rose hip cultivar with silenced APS1 gene is higher (see Figure 8 This result indicates that the APS1 gene has a negative regulatory effect on sulfate ion accumulation in grape berries.

[0079] The relevant sequences in the present invention are as follows:

[0080] Sequence Listing SEQ ID NO. 1 is the nucleotide sequence of the grape miR395 gene. The sequence length is 426 bp.

[0081] Sequence Listing SEQ ID NO. 2 is a nucleotide fragment of the regulatory site APS1 (VIT_05s0020g04210) of the grape miR395 gene (the sequence from positions 486 to 506 of the fragment is the recognition site of the grape miR395 gene). The sequence length is 4294 bp.

[0082] Sequence Listing SEQ ID NO. 3 is the mRNA nucleotide sequence of the grape APS1 gene. The sequence is 1957 bp long, with the CDS region extending from nucleotides 147 to 1550.

[0083] SEQ ID NO.1

[0084] miR395

[0085] 1 agtggtctct gtccagtcct gccctttggg aacatgagaa ctcgctataa atacaaggct

[0086] 61 cattagtcag ttgacttacc aaataccatg cagcaagcca aacaagttgg atgcatattg

[0087] 121 aatacataat ccattaggtg ccccctagag ttcccctgac cacttcactg ggggatcttc

[0088] 181 tgtaatgact tcctactgaa gtgtttgggg gaactcctag tgtcatttaa taccctatca

[0089] 241 actacagtta tgatcaaggt ttatggtgag tctgctcttc tttactatac ataactcatg

[0090] 301 ttcctttaac aagaactact gtttagaaat tagatatgtt gcagttaact catagctttt

[0091] 361 gttgaattct gtctactgtg ttagccatta caggtcaacc aagggcactt gtggtctgct

[0092] 421 gagacc

[0093] SEQ ID NO.2

[0094] APS1 gene sequence

[0095] 1 gcacgattca gtccacgtct cgtcaataaa aattcatttt tctatctata ttccccaaat

[0096] 61 tcccctcttt ttttctctct ctcctctctc cattattagc ttccaaacag gccaggcgta

[0097] 121 gaaccagagc ttggcctccg cttccaatgg cgtccatttc cacactcttcaccaaaaccc​​​​​​​​301 ccgctttgat cgagccggac ggtggcaagc tcgtagagct cttcgtggaggagtctctga

[0101] 361 gggatgtgaa gaagagagaa gccttgcgga tgcccagaat caagctctcaaggatcgatc

[0102] 421 ttgagtgggt tcatgtattg agcgaaggat gggccagccc tcttcgcgggttcatgagag

[0103] 481 aatccgagtt cctccaaact cttcatttca attcgctccg actcgacgacggctccttcg

[0104] 541 tcaacatgtc ggtgccgatt gtgttggcca ttgatgatgc ggagaagcatcagattggtg

[0105] 601 actccaccaa ggtcgctctc gtcgactcca aggacaatac gattgcgattttaagcaggt

[0106] 661 atgataattt tcttcttc tttttggaaa tttgtcaat caccatgtttgaataagt

[0107] 721 tacaaccata ggctttatta tactatacat gcgtttggga ttttgattatttagtcgttt

[0108] 781 ttttttcttt ttaagcataa cgtaaattttt gttcacttttt gtattgtgatggatttatag

[0109] 841 agtagatggt ttgggttcac gtatggtgtt ttgttaatat atagactggttctgaggata

[0110] 901 ataccctcat cccctggtat tcattaacat ctagttatgt tggtatacaggtagattgtc

[0111] 961 aaattttcag tcattttgtc aaatttggta atttttttat tcaattgtattggtaatctt

[0112] 1021 cactgtgtag gataaattct aaagttttga ttctgtaaga gcattaaacattgacaatat

[0113] 1081 ccactatgcc gcttttttgg ggtatggatt gagattgtcc atggttttgtgccactttga

[0114] 1141 gctcaaaact tgttgatgag atgaagctaa gccgaccttt gatgcctgctagaggatgct

[0115] 1201 aattgtcatt tgcttctagt ttgatttgtt tatcagaaac cctcttgcactggtgttgga

[0116] 1261 atgaccttaa ttgtggcatt gttatagaaa tttactaaat cttatgtggaattagtacag

[0117] 1321 tattatttcc atctattgtg ctttagatgt tttcttcttc ttcttcttcggttaacaggg

[0118] 1381 gttgttctca ttttgtggtc actctcaagg tcttttttag tggtcaaactgttttatatg

[0119] 1441 ttcatccata catctgtgct ggtatttgga aatgtcaatg gcttgtgaaatgacaatcat

[0120] 1501 gtttaaaatt ataggtgaga atgcaaagtg aggtgttggg atctgtagatagctgatgcg

[0121] 1561 taggtttctc gctgtttaat tttctattct tagtatatcc ttttgagtcctttgaataca

[0122] 1621 aattcctttc ttccagtaaa tgtacattgt tgatgcatgg tttcatgatcatgctaggag

[0123] 1681 aaattcacag gggaaaatga ttagatgcgt agcctgaaaa gtcctcaatgacatggatta

[0124] 1741 ttttggtgat aaattatct cttgtgatag gttctggttc tggttctggtaaaaaaaatat

[0125] 1801ttatagtggg gtttcctgtt ctttattcca atcccactgc taagaaagtt attcacttct

[0126] 1861

[0127] 1921

[0128] 1981

[0129] 2041gataactgtg ggtgataaaa cttgaatctt cttaatggat aaccagcatt tcaagggagc

[0130] 2101atgccataat tcatcccgta tgatcaaccg tatgcctagg tgctacatca cctacctggt

[0131] 2161ctgcctagca tgtccttaag caggcaaaga taactgtttg caagtacttg ttatttaagt

[0132] 2221ttgtcagcat aatttactga cctttatgtt tttttgtgga ttaaaacaac tggaactttg

[0133] 2281ctttcatggg accttctgag tttctaataa tttggcaatc tacccatgat cccaaatttc

[0134] 2341caattctggg agtgcctatt taatcgaact tgcttgtcca ggttgttact tccatattga

[0135] 2401tgtagtaaag tcacttttag gaaatatgaa aacactctgc aaattggatt aacttcttta

[0136] 2461atgtgaaaca gttacatagg gttcctaggg atggctttgt catccataaa attgcgtact

[0137] 2521aggtgaagaa taatgtaatt ttggattgtt ccattcaact atttatggtg attgttcatc

[0138] 2581ccttattgat tcattgattt ggtaatttca gtattgagat ctacaagcac cacaaagaag

[0139] 2641aaaggatagc cagaacttgg gggactactg cccctggttt gccgtatgtg gatcaagcaa

[0140] 2701taaccaattc tggaaactgg ctgattggag gtgacttgga ggttgttgag ccagtcaagt

[0141] 2761acaatgatgg tcttgatcga tttcgactat cccctgccga actccgtgaa gaattcacca

[0142] 2821agcgcaatgc tgatgcagtg tttgctttcc agctcaggaa tcctgtgcac aatggtcatg

[0143] 2881ctttgctgat gactgacaca cggcgtcggc ttcttgagat gggctacaag aaccctgtcc

[0144] 2941tcttacttca tccattagga ggctatacaa aggcagatga tgttccgctt ggttggagaa

[0145] 3001tgaagcaaca tgagaaggtt catgaactga tcctatgatg tattgctcaa tttgaaaatc

[0146] 3061agttatccct ctgccagaag ggtccattat gtaattgcct taccttcagt tctaattctg

[0147] 3121attaatattg aaaatgttcc tcaggtgctt gaagatgggg ttcttgatcc agagacaact

[0148] 3181gtagtttcta ttttcccatc tcccatgcac tatgctggtc caactgaggt gcagtggcat

[0149] 3241gcaaaggctc gcattaatgc aggggctaac ttttacattg ttggtcggga cccagcaggc

[0150] 3301atgggccacc cagttgaga gagagactta tatgatgctg accatggga gaggtattg

[0151] 3361agcatggctc ctggactgga acggctaaac atccttcctt tcaaggtata taaactattg

[0152] 3421tagctcttat gaaactcaaa attgctttcc tgtttaattt atgaaatctg tagttcac

[0153] 3481aagttgaggt fathergcag gttgctgcat atgataaaac tcagaataaa atggcattct

[0154] 3541ttgatccctc aagggctcaa gacttcctct tcatatctgg cacaaaggta tattttttgc

[0155] 3601ataggaaaaa aatgcagacc tcttttttta tttcatatct aatgataatc ccaaaatggc

[0156] 3661tgaaaattat tcagactggg catgcatttt tttcaacatg gaaatatttg atggatgatg

[0157] 3721tttctgaaca aggccgctac attttgcaga tgagaactct agcgaagaac aaagagaacc

[0158] 3781ctccagacgg atttatgtgc ccgggtggtt gggaagtgtt ggtggaatat tatgacagtt

[0159] 3841tggtgcccag caacaacggc aaagtcccgg aaactgttcc tgcttaaatg gattgctgcc

[0160] 3901atctgattgg gagaaacctt aaatctattt atctccagtc tgcatcaaac tatgttgcca

[0161] 3961tctgatttgg gagaaacttt aaaaacctat ttgtcttctg tgtgtgattg gtgaagtttg

[0162] 4021gtaagaatgg tgtgtgcaga tcctgtaata aaaccacgag aagcagtgcc acagaggcag

[0163] 4081acatatgcct ctgtctgtaa attagagtgc ccatggttac atcttgaatc ggtggacctg

[0164] 4141gggcaactgc ctgcactgca ctgcactaca ctactttgtc aatgggcttt tataaaggac [[ID=!4]]

[0165] 4201ataggtttta tggcttttag atgataatcc ttgtaatttt tcagtcatgc atcaaagaga

[0166] 4261aaatagaaag aaggcagctc aatcagtttg ctta

[0167] SEQ ID NO.3<N

[0168] APS1 mRNA sequence

[0169] 147 - 1550 is the CDS sequence

[0170] 1gcacgattca gtccacgtct cgtcaataaa aattcatttt tctatctata ttccccaaat

[0171] 61tcccctcttt ttttctctct ctcctctctc cattattagc ttccaaacag gccaggcgta

[0172] It should be noted that there seems to be an error in the tag "!4" in the original text. It should probably be "

[0165] ". Also, the tag "<N " might be a misprint and should likely be "<" ". These are assumed corrections for the translation to make sense in the context of standard text and tag usage.121gaaccagagc ttggcctccg cttccaatgg cgtccatttc cacactcttc accaaaaccc

[0173] 181cgaacccatc tccatctcta tgtctcccca gaacccccaa gtcccatttt acccccgcct

[0174] 241tcaggctccc cattcctctc cattccaaga cgagaaccca ccagaagtta cgggtttcgt

[0175] 301ccgctttgat cgagccggac ggtggcaagc tcgtagagct cttcgtggag gagtctctga

[0176] 361gggatgtgaa gaagagagaa gccttgcgga tgcccagaat caagctctca aggatcgatc

[0177] 421ttgagtgggt tcatgtattg agcgaaggat gggccagccc tcttcgcggg ttcatgagag

[0178] 481aatccgagtt cctccaaact cttcatttca attcgctccg actcgacgac ggctccttcg

[0179] 541tcaacatgtc ggtgccgatt gtgttggcca ttgatgatgc ggagaagcat cagattggtg

[0180] 601actccaccaa ggtcgctctc gtcgactcca aggacaatac gattgcgatt ttaagcagta

[0181] 661ttgagatcta caagcaccac aaagaagaaa ggatagccag aacttggggg actactgccc

[0182] 721ctggtttgcc gtatgtggat caagcaataa ccaattctgg aaactggctg attggaggtg

[0183] 781acttggaggt tgttgagcca gtcaagtaca atgatggtct tgatcgattt cgactatccc

[0184] 841ctgccgaact ccgtgaagaa ttcaccaagc gcaatgctga tgcagtgttt gctttccagc

[0185] 901tcaggaatcc tgtgcacaat ggtcatgctt tgctgatgac tgacacacgg cgtcggcttc

[0186] 961ttgagatggg ctacaagaac cctgtcctct tacttcatcc attaggaggc tatacaaagg

[0187] 1021cagatgatgt tccgcttggt tggagaatga agcaacatga gaaggtgctt gaagatgggg

[0188] 1081ttcttgatcc agagacaact gtagtttcta ttttcccatc tcccatgcac tatgctggtc

[0189] 1141caactgaggt gcagtggcat gcaaaggctc gcattaatgc aggggctaac ttttacattg

[0190] 1201ttggtcggga cccagcaggc atgggccacc cagttgagaa gagagactta tatgatgctg

[0191] 1261accatgggaa gaaggtattg agcatggctc ctggactgga acggctaaac atccttcctt

[0192] 1321tcaaggttgc tgcatatgat aaaactcaga ataaaatggc attctttgat ccctcaaggg

[0193] 1381ctcaagactt cctctcata tctggcacaa agatgagaac tctagcgaag aaaagaga

[0194] 1441accctccaga cggatttatg tgcccgggtg gttgggaagt gttggtggaa tattatgaca

[0195] 1501gtttggtgcc cagcaacaac ggcaaagtcc cggaaactgt tcctgcttaa atggattgct

[0196] 1561gccatctgat tgggagaaac cttaaatcta tttatctcca gtctgcatca aactatgttg

[0197] 1621ccatctgatt tgggagaaac tttaaaaacc tatttgtctt ctgtgtgtga ttggtgaagt

[0198] 1681ttggtaagaa tggtgtgtgc agatcctgta ataaaaccac gagaagcagt gccacagagg

[0199] 1741cagacatatg cctctgtctg taaattag tgcccatggt tacatcttga atcggtggac

[0200] 1801ctggggcaac tgcctgcact gcactgcact acactacttt gtcaatgggc ttttataaag

[0201] 1861gacataggtt tttggcttt tagatgataa tccttgtaat ttttcagtca tgcatcaaag

[0202] 1921agaaataga aagaaggcag ctcaatcagt ttgctta

[0203] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. Application of the grape miR395 gene in breeding grape varieties resistant to gray mold, the nucleotide sequence of the grape miR395 gene being shown in SEQ ID NO.1; The nucleotide sequence shown in SEQ ID NO.1 consists of 426 deoxyribonucleotides of the grape miR395 gene and its upstream and downstream non-coding sequences. In the sequence shown in SEQ ID NO.1, deoxyribonucleotides from positions 140 to 226 represent the miR395 gene transcribed sequence; deoxyribonucleotides from positions 196 to 216 represent the mature sequence of the miR395 gene; and the remaining sequences represent upstream and downstream non-coding sequences.

2. Application of the grape miR395 gene in regulating grape resistance to gray mold, the nucleotide sequence of the grape miR395 gene being shown in SEQ ID NO.1; The nucleotide sequence shown in SEQ ID NO.1 consists of 426 deoxyribonucleotides of the grape miR395 gene and its upstream and downstream non-coding sequences. In the sequence shown in SEQ ID NO.1, deoxyribonucleotides from positions 140 to 226 represent the miR395 gene transcribed sequence; deoxyribonucleotides from positions 196 to 216 represent the mature sequence of the miR395 gene; and the remaining sequences represent upstream and downstream non-coding sequences.

3. Application of overexpression of grape miR395 gene in improving resistance to grape gray mold, wherein the nucleotide sequence of the grape miR395 gene is shown in SEQ ID NO.1; The nucleotide sequence shown in SEQ ID NO.1 consists of 426 deoxyribonucleotides of the grape miR395 gene and its upstream and downstream non-coding sequences. In the sequence shown in SEQ ID NO.1, deoxyribonucleotides from positions 140 to 226 represent the miR395 gene transcribed sequence; deoxyribonucleotides from positions 196 to 216 represent the mature sequence of the miR395 gene; and the remaining sequences represent upstream and downstream non-coding sequences.

Images