Use of rice os05g0498700 protein and its coding gene in improving plant resistance to abiotic stress
By knocking out or mutating the rice Os05g0498700 gene and using CRISPR/Cas9 technology, the germination and growth problems of rice seeds under anaerobic stress were solved, and the promotion of seed germination and seedling growth and the enhancement of stress resistance were achieved.
Patent Information
- Application Number
- CN202410618897.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-17
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2044-05-17
AI Technical Summary
Rice seeds are susceptible to anaerobic stress during direct seeding, which leads to seed dormancy and hinders seedling growth. Existing technologies are unable to effectively solve this problem.
By knocking out or mutating the rice Os05g0498700 gene, its function is impaired or its expression level is reduced. Gene editing vectors are then constructed using CRISPR/Cas9 gene editing technology to transform plant cells, thereby breaking seed dormancy, promoting seed germination and seedling growth, and improving resistance to abiotic stresses.
It significantly improved the germination ability of rice seeds and seedling growth under anaerobic conditions, enhanced the tolerance of rice to anaerobic stress, and promoted normal seed germination and seedling growth.
Smart Images

Figure CN118685443B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the novel use of rice Os05g0498700 protein and its encoding gene, in particular to the novel use of rice Os05g0498700 protein and its encoding gene in improving the resistance of plants to abiotic stress, and belongs to the field of novel use of rice Os05g0498700 protein and its encoding gene. BACKGROUND
[0002] Rice is currently one of the most important food crops in the world, and therefore plays a key role in the lives of billions of people worldwide. In order to save economic costs, high-efficiency and labor-saving rice planting methods are being developed all over the world, including direct sowing of rice seeds. Compared with traditional planting systems, direct-sown rice is significantly more likely to be subjected to external stress in the field, with anaerobic conditions being the main stress that direct-sown rice has to cope with (Mondal S, Khan MIR, Entila F, et al (2020) Responses of AG1 and AG2 QTL introgression lines and seed pre-treatment on growth and physiological processes during anaerobic germination of rice under flooding. Sci Rep 10: 10214.). Anaerobic stress affects the absorption of nutrients and water by rice seedlings, leading to an imbalance in plant energy metabolism. At this time, high levels of reactive oxygen species are produced in plant cells, making it impossible for plants to grow normally, and therefore, solving the problem of anaerobic stress during the germination stage of rice is of great significance for large-scale direct sowing (Yu S-M, Lee H-T, Lo S-F, Ho T-HD (2021) How does rice cope with too little oxygen during its early life? New Phytol 229: 36-41.). SUMMARY
[0003] One of the purposes of the present application is to provide the use of rice Os05g0498700 protein or its encoding gene in breaking the dormancy of plant seeds, promoting seed germination or seedling growth.
[0004] The second purpose of the present application is to provide the use of rice Os05g0498700 protein or its encoding gene in improving the resistance of plants to abiotic stress.
[0005] In order to achieve the above-mentioned purposes of the application, the main technical solutions adopted by the present application include:
[0006] One aspect of the present application is to apply rice Os05g0498700 protein or its encoding gene to break the seed dormancy of plants, promote the seed germination of plants or promote the growth of plant seedlings.
[0007] In a preferred embodiment of the present application, the plant is preferably rice.
[0008] In a preferred embodiment of the present application, the method for applying rice Os05g0498700 protein or its encoding gene to break the seed dormancy of plants, promote the seed germination of plants or promote the growth of plant seedlings comprises: knocking out or mutating the Os05g0498700 gene in rice, so as to make the rice Os05g0498700 protein function-defective or the expression amount of the Os05g0498700 gene reduced or its normal function defective.
[0009] Another aspect of the present application is to apply rice Os05g0498700 protein or its encoding gene to improve the abiotic stress resistance of plants.
[0010] In a preferred embodiment of the present application, the abiotic stress resistance comprises anaerobic stress; more preferably, the abiotic stress resistance comprises promoting the seed germination or seedling growth of rice under anaerobic stress.
[0011] In a preferred embodiment of the present application, the method for applying rice Os05g0498700 protein or its encoding gene to improve the abiotic stress resistance of plants comprises: knocking out or mutating the Os05g0498700 gene in rice, so as to make the rice Os05g0498700 protein function-defective or the expression amount of the Os05g0498700 gene reduced or its normal function defective.
[0012] Another aspect of the present application is to provide a method for promoting the seed germination and seedling growth of plants, comprising: constructing a gene editing vector of Os05g0498700 gene or a gene knockout vector of Os05g0498700 gene, transforming the gene editing vector or the gene knockout vector into a receptor plant, and obtaining a transgenic plant with function-defective Os05g0498700 protein.
[0013] In still another aspect of the present application, a method for breeding a plant variety resistant to abiotic stress is provided, comprising: constructing a gene editing vector of Os05g0498700 gene or a gene knockout vector of Os05g0498700 gene, transforming the gene editing vector or the gene knockout vector into a recipient plant to obtain a transgenic plant with a functional deficiency of Os05g0498700 protein; for example: (1) designing sgRNA according to Os05g0498700 gene to construct a CRISPR / Cas9 plant genome editing vector; (3) transforming the constructed CRISPR / Cas9 plant genome editing vector into tissues or cells of the target plant to obtain transformants, and then regenerating a complete regenerated plant and its clonal or offspring from the transformants by plant tissue culture, and performing genotyping on the regenerated plant to obtain a transgenic plant with the target gene edited.
[0014] Those skilled in the art can knock out or mutate the Os05g0498700 gene in rice by using conventional gene knockout or gene editing techniques, for example, constructing an Os05g0498700 gene knockout vector or using a gene editing technique to construct a CRISPR / Cas9 gene editing vector of Os05g0498700 gene, etc., to knock out or mutate the Os05g0498700 gene in rice, which are all well known to those skilled in the art.
[0015] As a preferred embodiment of the present application, the "abiotic stress" in the present application includes anaerobic stress.
[0016] As a preferred embodiment of the present application, the amino acid sequence of the rice Os05g0498700 protein is shown in SEQ ID NO. 2; the CDS nucleotide sequence of the coding gene of the rice Os05g0498700 protein is shown in SEQ ID NO. 1, and the nucleotide sequence of the full-length gene of the coding gene of the rice Os05g0498700 protein is shown in SEQ ID NO. 3. In addition, those skilled in the art can also optimize the polynucleotides shown in SEQ ID NO. 1 or SEQ ID NO. 3 to enhance the expression efficiency in plants, especially in rice.
[0017] The transformation protocols described herein and the methods used to introduce the polynucleotide or polypeptide into the plant can vary depending on the type of plant (monocot or dicot) or plant cell being transformed. Suitable methods for introducing the polynucleotide or polypeptide into a plant cell include microinjection, electroporation, Agrobacterium-mediated transformation, direct gene transfer, and high velocity ballistic bombardment, among others. In particular embodiments, the genes of the present application can be provided to a plant using a variety of transient transformation methods. The transformed cells can be regenerated into stably transformed plants using conventional methods (McCormick et al. Plant Cell Reports. 1986. 5: 81-84).
[0018] The present application can be used to transform any plant species, including but not limited to monocotyledonous or dicotyledonous plants; more preferably, the plants include crops, vegetables or ornamental plants, fruit trees, etc., such as rice, cotton, corn, sorghum, wheat, soybean, potato, barley, tomato, bean, peanut or sugarcane, etc., preferably rice.
[0019] The present inventors previously screened Os05g0498700 for its ability to enhance the anaerobic germination tolerance of rice by joint analysis of the transcriptome and QTL of "Nipponbare" (NIP, more anaerobic stress-tolerant) and "Haidao86" (HD86, not tolerant to anaerobic conditions) and their hybrid offspring: In previous studies, the japonica rice varieties "Nipponbare" (NIP, more anaerobic stress-tolerant) and "Haidao86" (HD86, not tolerant to anaerobic conditions) and their hybrid offspring were used for experiments, and transcriptome analysis was performed on the parent and differentiated offspring plants grown under normal and anaerobic stress conditions, and GO (Gene Ontology), KEGG (Kyoto Encyclopedia of Genes and Genomes) and WGCNA (weighted gene co-expression network analysis) analysis was performed on the differential genes; anaerobic QTL (quantitative trait locus) mapping was performed using a 159-DHs population derived from the cross of NIP and HD86. In combination with the results of transcriptome analysis and QTL mapping, Os05g0498700 was screened for its ability to enhance the anaerobic germination tolerance of rice.
[0020] The application further analyzes the relationship between the candidate genes and the response of rice to abiotic stress by cloning and functionally analyzing the genes of the CRISPR knockout rice plants under anaerobic conditions, and the results show that knocking out the mutant Os05g0498700 gene in rice can significantly improve the ability of rice to resist anaerobic stress. The application has very important theoretical and practical significance for improving and enhancing the stress resistance of rice and accelerating the process of stress resistance molecular breeding.
[0021] Definitions of terms related to the invention
[0022] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which this application belongs.
[0023] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides in single- or double-stranded form, and polymers thereof. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. The term also means oligonucleotide analogs, including PNAs (peptide nucleic acids), DNA analogs used in antisense technology (phosphorothioates, phosphoramidates, etc.), unless specifically limited otherwise. Unless specifically indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including, but not limited to, simplifying degenerate codon substitutions) and complementary sequences as well as the sequence explicitly indicated. Specifically, a degenerate codon variation can result from the substitution of one nucleotide base for another at a position in the sequence, which results in a change in the represented amino acid. For example, the codons guanine- cytosine (GCN), guanine-adenine (GAN), and guanine-uracil (GUU) each encode the amino acid valine (V).
[0024] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to mean a polymer of amino acid residues. That is, a description in terms of a polypeptide equally applies to a description in terms of a peptide and to a description in terms of a protein, and vice versa. The terms apply to naturally-occurring amino acid polymers as well as to amino acid polymers in which one or more of the amino acid residues are non-naturally encoded amino acids. As used herein, the terms encompass amino acid chains of any length including full-length proteins (i.e., antigens) in which the amino acid residues are connected by covalent peptide bonds.
[0025] The term "recombinant host cell strain" or "host cell" means a cell which contains a polynucleotide of the application, regardless of the methodology used for insertion of the polynucleotide into the host cell, such as direct uptake, transduction, conjugation, or other methods known in the art. The exogenous polynucleotide can be maintained as a non-integrated vector, such as a plasmid, or can be integrated into the host genome. The host cell can be a prokaryotic or eukaryotic cell, and the host cell can also be a monocot or dicot plant cell.
[0026] The term "transformation" as used herein refers to the genetic transformation of a polynucleotide or polypeptide into a plant in such a way that the polynucleotide or polypeptide is introduced into a plant cell. Methods for introducing the polynucleotide or polypeptide into a plant are known in the art, including but not limited to stable transformation, transient transformation, and virus-mediated transformation. "Stable transformation" refers to a polynucleotide construct that is integrated into the genome of a plant cell and can be inherited by its progeny; "transient transformation" refers to a polynucleotide that is introduced into a plant but can only be expressed or present in the plant temporarily. BRIEF DESCRIPTION OF DRAWINGS
[0027] Figure 1 PCR positive identification of knockout material transgenic plants, wherein lane 1 is a 2000bp Mark marker, lane 2 is a positive control of wild type material added with knockout mutation identification primers, lanes 3-10 are identification results of knockout materials, and lane 11 is a negative control added with double distilled water.
[0028] Figure 2 Knockout of the rice Os05g0498700 gene.
[0029] Figure 3 Phenotype of seed germination and growth of Os05g0498700 CRISPR knockout transgenic plants and wild type plants under normal environment or anaerobic stress. DETAILED DESCRIPTION
[0030] The present application will be further described with reference to the following specific examples. The advantages and features of the present application will become apparent from the description. These examples are illustrative only and are not intended to limit the scope of the present application. Those skilled in the art will appreciate that modifications and variations can be made to the details and forms of the present application without departing from the spirit and scope of the present application.
[0031] Example 1 Genetic transformation experiment of Os05g0498700 gene in rice
[0032] 1. Construction of Os05g0498700 gene CRISPR knockout vector
[0033] The target site for knockout was designed according to the cDNA sequence of Os05g0498700 gene, and the website used was: http: / / skl.scau.edu.cn / dsdecode / ;
[0034] Target site sequence: 5'-GAATCCT-3',
[0035] Experimental methods and vectors were from the laboratory of Academician Liu Yaoguang (Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu YG. A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Molecular Plant, 2015, 8(8): 1274-1284), and the recombinant vector was named pYLCRISPR / Cas9Pubi-Os05g0498700.
[0036] 2. Agrobacterium transformation
[0037] The knockout vector pYLCRISPR / Cas9Pubi-Os05g0498700 was transformed into Agrobacterium EHA105 competent cells by freeze-thaw method (publicly available from the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, and the non-patent literature describing the material is: Ruifang Yang, Qicai Tang, Huimei Wang, Xiaobo Zhang, Gang Pan, Hong Wang and Jumin Tu Analyses of two rice (Oryza sativa) cyclin-dependent kinase inhibitors and effects of transgenic expression of OsiICK6 on plant growth and development, 2011, Annals of Botany, 107: 1087-1101), and the method was referred to the molecular cloning experiment guide.
[0038] 3. Genetic transformation
[0039] The genetic transformation was performed by Agrobacterium-mediated genetic transformation method with Nipponbare as the receptor material, and the medium formula was shown in Table 1.
[0040] Table 1 Medium used for genetic transformation and its formula
[0041]
[0042] The specific method was as follows:
[0043] 1) Wound induction
[0044] Take an appropriate amount of mature rice seeds, after shelling, first wash with 70% alcohol for 1 min, constantly shaking during the process, then use 15% sodium hypochlorite to disinfect for 30 min (can be placed on a shaker to shake); finally, rinse with sterile distilled water for 4-5 times, dry the surface water of the seeds with sterile filter paper, and then inoculate. The seeds after disinfection are inoculated in the induction medium containing 2.0 mg / L 2,4-D, and cultured in the dark at 28°C for 30-40 days. The callus obtained is cultured in the subculture medium, subcultured every 2 weeks, until embryogenic callus is formed.
[0045] 2) Agrobacterium infection
[0046] a) The Agrobacterium carrying the expression plasmid vector pYLCRISPR / Cas9Pubi-Os05g0498700 is streaked on the surface of LB solid medium containing antibiotics (50 mg / L kanamycin or spectinomycin, 25 mg / L rifampicin), and cultured at 28°C, 200 rpm overnight.
[0047] b) A sterile toothpick is used to pick a single colony and inoculate into 5 mL of YEB liquid medium containing the corresponding antibiotic, and cultured at 28°C with shaking until OD600=0.5.
[0048] c) The activated fresh bacterial liquid is inoculated into 25 mL of the same YEB liquid medium at a ratio of 1:100, and cultured under the same conditions until OD600=0.5.
[0049] d) The bacterial liquid is centrifuged at 5000g, 4°C for 10 min to collect the bacterial cells, and the supernatant is discarded; 25 mL of 10 mM MgSO4 is added to suspend the bacterial cells, and a pipette gun is used to gently suck and beat to fully suspend them, and then centrifuged at 5000g, 4°C for 10 min to collect the bacterial cells again, and the supernatant is discarded.
[0050] e) Resuspend with 25 mL of AA-AS infiltration medium containing 200 μM acetyl-syringone (AS).
[0051] f) The well-grown embryogenic callus is transferred from the subculture medium to a culture dish with sterile filter paper on the surface (the callus is cut into 0.3-0.4 mm size), and air-dried on a clean bench for 10-20 min.
[0052] g) Dry the embryogenic callus and immerse it in a 50 mL centrifuge tube containing the above bacterial liquid for 20 min, shaking every 5 min during the process; then pour off the bacterial liquid, take out the callus and air-dry it on sterile filter paper for 10-20 min, and then transfer it to CC medium containing 200 μM acetyl-syringone (AS) with sterile filter paper on the surface, and incubate in the dark at 25°C for 3 days.
[0053] h) Collect the calli without obvious Agrobacterium on the surface, rinse with sterile water containing 600 mg / L cefotaxime for 3 times, and suck the excess water.
[0054] i) Transfer the calli to the screening medium (N6 medium containing 500 mg / L cefotaxime and 50 mg / L hygromycin) for further screening for 2-3 times, each time for two weeks. Finally, fresh yellow hygromycin-resistant calli are obtained.
[0055] 3) Regeneration of transformant plants
[0056] Take fresh hygromycin-resistant calli, divide the calli into small pieces of 2 mm, inoculate into pre-differentiation medium, and incubate in dark at 28°C for 7 days, then transfer to a light incubation room (12 h light / 12 h dark) for further incubation for 8-9 days. Then transfer the calli that have differentiated into adventitious buds to the regeneration medium (250 mL tissue culture bottle) for further light incubation. When the adventitious buds grow into small seedlings of 4-6 cm in height, transfer to the rooting medium, and incubate in a light incubation room (12 h light / 12 h dark) at 28°C for about 15 days to obtain transformant plants, which are then transplanted to a greenhouse (T0 generation). One month later, take leaves for PCR positive identification (F: 5'-TGTTCGTTAACCCTAGCTTCTCT-3', R: 5'-GGCACCACTGTTTTTGCCAT-3'), and harvest the seeds of the positive plants (T1 generation).
[0057] Figure 1 PCR positive identification results of the transgenic plants of the knockout material; Figure 2 The knockout of the rice Os05g0498700 gene.
[0058] The following KO primers are identification primers for subsequent identification of whether the material is homozygous:
[0059] KO primers:
[0060] F; TGTTCGTTAACCCTAGCTTCTCT;
[0061] R; GGCACCACTGTTTTTGCCAT.
[0062] 5, Molecular identification and stress resistance identification of transgenic plants
[0063] 5.1 Molecular identification of transgenic plants
[0064] Os05g0498700 gene knockout japonica seeds and wild type japonica seeds were selected respectively, and were sowed in boxes containing grass carbon soil after germination, and the culture conditions were 16 / 8 h of light / dark, 26°C of light condition, 22°C of dark condition, and 30000 lx of light intensity.
[0065] Through molecular identification, the knockout condition of Os05g0498700 gene knockout japonica seeds and the type of knockout lines were obtained, and were as follows:
[0066] Knockout mutation:
[0067] GAA-CCT
[0068] Type 1 of knockout lines:
[0069] ATGGACAACTTGTGGCATCTCGGGGATGAGTTCCGTGGGCAGTCGAAGGTAGTGGAGGACCGTCAGTGGTCTCTCATGACATCGAAGTTGGCTGAGATCAACAAGTCCAAGGCGGAGAGGACGAATGAGCTTGACTATGCGCGGATGAACACCATCCCTGATGTCAAGCAATGGGATAAGGTATCCTACCACCAAGATGAGAGCAAGATGGACCACCTCAATCTTGGCCTTATGAATCTAGATCTTAAGATGAACGACATCAGGATGAATGACGCAGCTATGAAGAA-CCTTTCCGCGGCATGGCCTACAACATGAATC AGCTGTACCCCAAGGGAGGCAATGGCAATGTTAACTCGTTCAAGATGAATGTTGGGGTCAACAAATATTTGCATAGTCCAAATGGCAAAGATGTCAATGGCAAAAACAGTGGTGCCAACAGCAATGGAAGTAACAGCAGCGGGAACAACAGCAGCAACTCTGCTGTTGACAAACGATTCAAAACATTGCCAACAAGTGAGATGCTACCAAGGAATGAAGTGCTCGGTGGATATATCTTTGTTTGCAACAATGACACCATGCAGGAGGATCTCAAGAGGCAGCTTTTTGGGTTGCCAGCAAGATATCGTGATTCAGTCCGAGCAATTATTCCTGGTCTACCTCTTTTCCTCTATAACTACACGACCCATCAGCTTCATGGGGTATTTGAGGCTTCTAGTTTTGGAGGATCTAATATTGATCCCACTGCATGGGAAGATAAGAAGTGTAAAGGTGAATCTAGATTCCCAGCGCAGGTGAGGATCCGCATTAGAAAGCTCTGCAAGCCTTTGGAAGAGGATGCTTTCAGACCAGTGCTGCACCATTACGATGGTCCAAAGTTTCGTCTTGAGCTCTCCATAGCTGAGACCTTATCACTGCTAGACCTTTGTGAGAAAGAAGGCGTCTGA.
[0070] 5.2 Identification of tolerance of transgenic rice plants seeds to anaerobic germination
[0071] To determine the tolerance of transgenic rice plant seeds to anaerobic germination, plump and uniform wild type Nipponbare seeds and Os05g0498700 gene knockout Nipponbare seeds were selected respectively and placed in a 50°C oven for three days to break dormancy, and then they were surface sterilized in 0.5% sodium hypochlorite solution for 30 minutes. Three replicates were set in normal and anaerobic stress, with 10 seeds in each replicate.
[0072] Anaerobic stress treatment: a glass tube with a diameter of 2.5 cm and a height of 12 cm was filled with water to a depth of 8 cm to simulate anaerobic stress.
[0073] Normal environment: the seeds were placed in a 9 cm diameter culture dish lined with two layers of wet filter paper kept moist.
[0074] The experimental conditions were 28°C, 24h in the dark, and the hypocotyl length was compared.
[0075] According to the experimental results of Figure 3 It can be seen from the experimental results that under normal environment, the germination ability of Os05g0498700 gene knockout Nipponbare seeds is significantly better than that of wild type Nipponbare seeds, indicating that knocking out Os05g0498700 gene in rice can improve the resistance to dormancy and promote seed germination and growth.
[0076] Under anaerobic stress treatment, the germination ability of Os05g0498700 gene knockout Nipponbare seeds is also significantly better than that of wild type Nipponbare seeds, indicating that knocking out Os05g0498700 gene in rice can effectively improve the ability of rice seeds to resist low oxygen stress.
Claims
1. The use of rice Os05g0498700 protein or its coding gene in improving the anaerobic stress resistance of rice, comprising: In rice Os05g0498700 Gene knockout or mutation can make rice Os05g0498700 protein functional defective or Os05g0498700 The expression level of the gene is reduced or its normal function is defective; the amino acid sequence of the rice Os05g0498700 protein is shown in SEQ ID NO.2; the CDS nucleotide sequence of the gene encoding the rice Os05g0498700 protein is shown in SEQ ID NO.
1.
2. Use according to claim 1, characterized in that, The anaerobic stress tolerance includes promoting the germination of rice seeds or the growth of seedlings under anaerobic stress.
3. A method of promoting germination and seedling growth of rice seeds under anaerobic stress, characterized in that, Comprises: Construction Os05g0498700 gene editing vector or Os05g0498700 gene knockout vector, transforming the recipient plant with the gene editing vector or the gene knockout vector to obtain a transgenic plant with a functional deficiency of Os05g0498700 protein; the rice Os05g0498700 The CDS nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the amino acid sequence of the rice Os05g0498700 protein is shown as SEQ ID NO.
2.
4. A method of breeding a rice variety that is resistant to anaerobic stress, characterized by, Comprises: Constructing Os05g0498700 a gene editing vector or Os05g0498700 a gene knockout vector of the gene, transforming the gene editing vector or the gene knockout vector into a recipient rice, and screening to obtain transgenic rice with a functional deficiency of the Os05g0498700 protein; Rice Os05g0498700 The CDS nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the amino acid sequence of the rice Os05g0498700 protein is shown as SEQ ID NO. 2.
Citation Information
Patent Citations
Methods of increasing abiotic stress tolerance and / or biomass in plants and plants generated thereby
CN101437947A
Methods to improve plant tolerance to abiotic stress and / or biomass, and the resulting plant
CN102260703A