A method for rapid detection of three pathogenic bacteria of sugarcane tip rot

Abstract

The present invention discloses a method for rapidly detecting three pathogens of sugarcane tip rot, comprising the following steps: extracting genomic DNA; providing primer pairs: selecting upstream and downstream primers for one or more detection primers for Fusarium verticillioides, Fusarium spp., and Fusarium spp.; providing detection reagents: the detection reagents include 2×Easy Taq PCR SuperMix and sterile deionized water; placing the primers into a PCR reaction system for PCR reaction; and determining the results: performing agarose gel electrophoresis on the amplified products and determining the results based on the electrophoresis results. The present invention can simultaneously detect the three pathogens of sugarcane tip rot, Fusarium verticillioides, and Fusarium spp., in a single PCR amplification reaction. The multiplex PCR detection method established by the present invention can be used to detect the pathogens of Fusarium verticillioides, Fusarium spp., and Fusarium spp., and can also detect sugarcane disease samples infected with Fusarium verticillioides, Fusarium spp., and Fusarium spp. in the field.

Description

Technical Field

[0001] The invention relates to the technical field of pathogen detection, and in particular to a method for rapidly detecting three pathogenic bacteria of sugarcane tip rot. Background Art

[0002] Sugarcane tip rot is a common and epidemic fungal disease, primarily caused by a complex infection of Fusarium spp., posing a serious challenge to the development of the sugarcane industry. Tip rot has the greatest impact on the hardness of sugarcane parent varieties, and nearly all major domestically cultivated and imported sugarcane varieties in my country are susceptible to tip rot. Therefore, tip rot poses a serious threat to sugarcane production, and timely and rapid detection of infected plants is crucial to preventing the spread of the disease.

[0003] The pathogen causing sugarcane tip rot is a Fusarium species belonging to the subphylum Deuteromycotina. Its asexual stage is Fusarium moniliforme, and its sexual stage is Gibberella moniliforme. Sugarcane tip rot is named after the symptom of deformed or twisted shoots, and therefore, there are many different pathogenic species. Currently, 11 species have been reported to cause sugarcane tip rot: Fusarium verticillioides, Fusarium sacchariflora, Fusarium sacchariflora, Fusarium nematodes, Fusarium submycota, Fusarium rubromorpha, Fusarium oxysporum, Fusarium fujikura, Fusarium sacchariflora, Fusarium versicolor, and Fusarium simoniae. Previous studies have shown that Fusarium sacchariflora is the primary cause of sugarcane tip rot in China. Later studies have shown that Fusarium moniliforme is the dominant species in the sugarcane production areas of Pu'er, Lincang, Honghe, and Yuxi, Yunnan. Fusarium verticillioides is also frequently detected, with other species present, and complex infections are common.

[0004] Currently, Fusarium identification is primarily based on gene sequences including ITS, β-Tubulin, TEF, mtSSU, CAM, 5.8S rDNA, 18S rDNA, 28S rDNA, IGS, ATP, RPB1, RPB2, and Histone3. ITS sequences are the most widely used. rDNA-ITS sequences have been used to identify Fusarium chlamydophyllum, Fusarium laminarum, and Fusarium oxysporum, pathogens of important crops. ITS, TEF, RPB1, and RPB2 sequences have been used to identify Fusarium spp., Fusarium rubrodifolium, and Fusarium versicolor. While these sequences can identify some Fusarium species to the species level, the limited diversity of some Fusarium species in the intergenic regions makes them infeasible for complete species identification, limiting their application.

[0005] Therefore, the present invention designed specific primers FV-F / FV-R based on the chromosome 1 sequence of Fusarium verticillioides strain 7600, a sugarcane tip rot pathogen; specific primers FP-F / FP-R based on the unknown functional protein sequence of Fusarium solani strain 7600; and specific primers FS-F / FS-R based on the RNA polymerase II subunit β (RPB2) gene sequence of Fusarium solani, a sugarcane tip rot pathogen. The present invention can detect three pathogens, Fusarium verticillioides, Fusarium solani, and Fusarium saccharum, through a single PCR amplification reaction. The multiplex PCR detection method established by the present invention can be used to detect the pathogens Fusarium pseudo-verticillioides, Fusarium solani, and Fusarium saccharum, and can also detect sugarcane disease samples infected with Fusarium verticillioides, Fusarium solani, and Fusarium saccharum in the field. Summary of the Invention

[0006] The present invention aims to save a lot of manpower, material resources and financial resources compared with traditional single-plex PCR detection, and provides a method for rapidly detecting three pathogens of sugarcane tip rot.

[0007] In order to achieve the above object, the present invention is implemented by the following technical solution: a method for rapidly detecting three pathogenic bacteria of sugarcane tip rot, characterized in that it comprises the following steps:

[0008] S1. Genomic DNA extraction: Use a fungal genomic DNA extraction kit according to the instructions to extract genomic DNA of Fusarium verticillioides, Fusarium solani, and Fusarium saccharum strains as test samples; use genomic DNA from healthy sugarcane leaves as a negative control, and sterile ddH2O as a blank control. Store in a -20°C refrigerator.

[0009] S2. providing primer pairs: selecting upstream primers and downstream primers for detecting one or more of the three pathogens of sugarcane tip rot, Fusarium verticillioides, Fusarium solani, and Fusarium saccharum;

[0010] S3. Provide detection reagents: Detection reagents include 2×Easy Taq PCR SuperMix and sterile deionized water;

[0011] S4. Place in PCR reaction system to carry out PCR reaction:

[0012] S4.1. Prepare the following materials: Take 5–15 μL of 2× Easy Taq PCR SuperMix, 0.75–2.25 μL of upstream primer, 0.75–2.25 μL of downstream primer, 1–3 μL of genomic DNA, and 2.5–7.5 μL of sterile deionized water.

[0013] S4.2. Reaction process: The above materials were mixed and pre-denatured at 92-96°C for 2-4 min, denatured at 92-96°C for 25-35 s, annealed at 56-60°C for 25-35 s, and extended at 70-74°C for 1-2 min for 34-36 cycles, followed by a final extension at 72°C for 4-6 min.

[0014] S5. Result determination: The product obtained in S4 is subjected to agarose gel electrophoresis. Based on the electrophoresis results showing a 292 bp band amplified from Fusarium solani, a 592 bp band amplified from Fusarium solani, a 723 bp band amplified from Fusarium saccharum, the target band amplified from the negative control, and the target band amplified from the blank control, the sample to be tested is determined; when the electrophoresis results of the sample to be tested contain bands corresponding to the three pathogens, the sample to be tested is determined to contain the corresponding pathogens.

[0015] Furthermore, in S2, the nucleotide sequences of the primer pairs obtained by specific amplification of the upstream primer and the downstream primer for the three pathogenic bacteria Fusarium verticillioides, Fusarium solani and Fusarium saccharum are as follows:

[0016] Fusarium verticillium specific amplification primer pair: product length is 292 bp, and the sequences are FV-F: TTGTCTATGCGCTGGCCTTT and FV-R: AGATAGAGCGCCTCGTCGTA;

[0017] Fusarium spp. specific amplification primer pair: product length is 592 bp, and the sequences are FP-F: ATCATCAACGGTCTCGCTGG and FP-R: ACTCCTTTTCACTGTTCGCGG;

[0018] Sugarcane Fusarium spp. specific amplification primer pair: the product length is 723 bp, and the sequences are FS-F: TCTCGCCACTACTCGTTC and FS-R: TCACCCTCCATACCCTCT.

[0019] Furthermore, in S2, the upstream primer and the downstream primer are used at a concentration of 8 to 12 μM.

[0020] Furthermore, in S5, the indicators of the samples to be tested are determined to be:

[0021] The target band of 292 bp can be amplified using the genomic DNA of Fusarium verticillium, a fungus causing sugarcane tip rot, as a template.

[0022] The target band of 592 bp was amplified using the genomic DNA of Fusarium solani, a fungus causing sugarcane tip rot, as a template.

[0023] The target band of 723 bp can be amplified using the genomic DNA of Fusarium saccharum as template;

[0024] The negative control and blank control showed no bands.

[0025] The beneficial effects of the present invention are:

[0026] The three pairs of PCR primers designed in the present invention have good specificity and high detection accuracy. It was determined that there was no cross-reaction between the pathogens causing sugarcane tip rot, namely, Fusarium verticillioides, Fusarium solani, and Fusarium saccharum; the established multiplex PCR has strong specificity, good stability, and good repeatability; compared with traditional identification methods, the multiplex PCR detection greatly shortens the detection time, is simple and fast, and has the advantages of saving labor, time, and money; it is feasible, fast, and accurate in practical application; it can detect Fusarium verticillioides, Fusarium solani, and Fusarium saccharum strains, as well as sugarcane disease samples infected with Fusarium verticillioides, Fusarium solani, and Fusarium saccharum in the field, and can achieve rapid detection and identification without isolating the pathogens; from the above, it can be seen that the primers designed and the established system of the present invention can be used for the rapid detection of the three pathogens of sugarcane tip rot, thereby providing a theoretical basis and technical support for the detection of sugarcane tip rot. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0028] Figure 1 The electrophoresis diagram of PCR detection of the specificity of the detection primers provided by the present invention;

[0029] Figure 2 This is an electrophoresis diagram of a sugarcane tip rot sample PCR detection provided in Example 2 of the present invention;

[0030] Figure 3 This is an electrophoresis diagram of PCR detection of sugarcane tip rot provided in Example 3 of the present invention. DETAILED DESCRIPTION

[0031] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0032] This example provides a method for verifying the effectiveness of primers for detecting three pathogens of sugarcane tip rot. The specific steps are as follows:

[0033] The fungal genomic DNA extraction kit was used according to the instructions to extract genomic DNA of Fusarium verticillioides, Fusarium solani and Fusarium saccharum. The genomic DNA of healthy sugarcane leaves was used as a control sample. The genomic DNA of different types of sugarcane tip rot pathogens Fusarium verticillioides, Fusarium solani and Fusarium saccharum were used as templates; the genomic DNA of healthy sugarcane leaves was used as a negative control, and sterile ddH2O was used as a blank control. Figure 1 As shown in the figure, the target band of 592bp can be amplified using the genomic DNA of Fusarium verticillioides as a template, the target band of 292bp can be amplified using the genomic DNA of Fusarium solani as a template, and the target band of 723bp can be amplified using the genomic DNA of Fusarium solani as a template. The negative control and blank control showed no band. This indicates that these three primer pairs can only amplify Fusarium verticillioides, Fusarium solani and Fusarium solani, and the target band size is consistent with the target band size (see Figure 1 ), and no target bands were amplified in other strains, indicating that the primer pair had good specificity.

[0034] Example 2

[0035] The difference between Example 2 and Example 1 is that this example provides multiple detection of sugarcane tip rot samples. The specific steps are as follows: genomic DNA of four naturally infected sugarcane tip rot samples in the field is used as a template; genomic DNA of healthy sugarcane leaves is used as a negative control, and sterile ddH2O is used as a blank control; the results are shown in FIG. Figure 2 As shown, lanes 7-10 amplified target bands of approximately 292 bp, 592 bp, and 723 bp, indicating that the pathogens causing sugarcane tip rot in Yongde sugarcane area include Fusarium solani, Fusarium verticillioides, and Fusarium saccharum.

[0036] Example 3

[0037] Compared with Example 1, Example 3 differs in that this example provides multiple detection of sugarcane tip rot disease samples. Compared with Example 2, Example 3 differs in that the sugarcane tip rot disease samples were naturally infected from fields in different places. The specific steps are as follows:

[0038] The genomic DNA of 12 naturally infected sugarcane tip rot samples in the field was used as template; the genomic DNA of healthy sugarcane leaves was used as negative control, and sterile ddH2O was used as blank control. The information of the test samples is shown in Table 2; the results are shown in Table 2. Figure 3As shown, lanes 1-3 are samples of naturally occurring sugarcane tip rot in the field of Yongde. The target bands of 592 bp, 292 bp, and 723 bp were amplified, respectively, indicating that the pathogens causing sugarcane tip rot in the Yongde sugarcane area are Fusarium verticillioides, Fusarium solani, and Fusarium saccharum. Lanes 4-6 amplified a clear band of approximately 292 bp and a band of 592 bp, indicating that the sugarcane tip rot in the Jinggu sugarcane area is caused by a mixed infection of Fusarium solani and Fusarium saccharum. Lanes 7-9 amplified target bands of approximately 592 bp and 723 bp, indicating that the sugarcane tip rot in the Zhenkang sugarcane area is caused by a mixed infection of Fusarium solani and Fusarium saccharum. Lanes 10-12 amplified target bands of approximately 292 bp and 723 bp, indicating that the sugarcane tip rot in the Kaiyuan sugarcane area is caused by a mixed infection of Fusarium solani and Fusarium saccharum. The results showed that this primer pair can be used to detect sugarcane shoot rot samples in the field.

[0039]

[0040]

[0041] Table 2

[0042] Example 3

[0043] Figure 1 Left, middle, and right, lane M is DNA Marker DL100; lanes 1 to 6 are: lane 2 is Fusarium solani (left), lane 1 is Fusarium verticillium (middle), lane 3 is Fusarium saccharum (right), lane 5 is the negative control (genomic DNA from healthy sugarcane leaves), and lane 6 is the blank control (sterile water);

[0044] Depend on Figure 1 It can be seen that there is no cross reaction among the three pathogens Fusarium verticillium, Fusarium solani and Fusarium saccharum.

[0045] Figure 2 In the figure, lane M is DNA Marker DL100, lanes 1 and 2 are genomic DNA of Fusarium verticillioides strain; lanes 3 and 4 are genomic DNA of Fusarium solani strain; lanes 5 and 6 are genomic DNA of Fusarium solani strain; lanes 7-10 are samples of naturally occurring sugarcane tip rot in the Yongde field; lane 11 is a negative control (genomic DNA of healthy sugarcane leaves), and lane 12 is a blank control (sterile water);

[0046] Figure 3In the figure, lane M is DNA Marker DL100, lanes 1-3 are samples of sugarcane shoot rot naturally occurring in the field of Yongde; lanes 4-6 are samples of sugarcane shoot rot naturally occurring in the field of Jinggu; lanes 7-9 are samples of sugarcane shoot rot naturally occurring in the field of Zhenkang; lanes 10-12 are samples of sugarcane shoot rot naturally occurring in the field of Kaiyuan, lane 13 is a negative control (genomic DNA of healthy sugarcane leaves), and lane 14 is a blank control (sterile water).

[0047] The sugarcane tip rot Fusarium verticillium, Fusarium solani and Fusarium saccharum strains used in Examples 1-3 were isolated and preserved by the Sugarcane Research Institute of Yunnan Academy of Agricultural Sciences.

Claims

1. A method for rapid detection of three pathogens of sugarcane tip rot, characterized in that: The following steps are involved: S1. Genomic DNA extraction: Use a fungal genomic DNA extraction kit according to the instructions to extract genomic DNA of Fusarium verticillioides, Fusarium solani, and Fusarium saccharum strains as test samples; use genomic DNA from healthy sugarcane leaves as a negative control, and sterile ddH2O as a blank control. Store in a -20°C refrigerator. S2. providing primer pairs: selecting upstream primers and downstream primers for detecting one or more of the three pathogens of sugarcane tip rot, Fusarium verticillioides, Fusarium solani, and Fusarium saccharum; S3. Provide detection reagents: Detection reagents include 2×Easy Taq PCR SuperMix and sterile deionized water; S4. Place in PCR reaction system to carry out PCR reaction: S4.

1. Prepare the following materials: Take 5–15 μL of 2× Easy Taq PCR SuperMix, 0.75–2.25 μL of upstream primer, 0.75–2.25 μL of downstream primer, 1–3 μL of genomic DNA, and 2.5–7.5 μL of sterile deionized water. S4.

2. Reaction process: The above materials were mixed and pre-denatured at 92-96°C for 2-4 min, denatured at 92-96°C for 25-35 s, annealed at 56-60°C for 25-35 s, and extended at 70-74°C for 1-2 min for 34-36 cycles, followed by a final extension at 72°C for 4-6 min. S5. Result determination: Perform agarose gel electrophoresis on the products obtained in S4. Based on the electrophoresis results showing a 292 bp band amplified from Fusarium verticillioides, a 592 bp band amplified from Fusarium solani, a 723 bp band amplified from Fusarium saccharum, the target band amplified from the negative control, and the target band amplified from the blank control, determine the sample to be tested. If the electrophoresis results of the sample to be tested contain bands corresponding to the three pathogens, the sample to be tested is determined to contain the corresponding pathogens. In S2, the nucleotide sequences of the primer pairs obtained by specific amplification of three pathogenic bacteria, Fusarium verticillioides, Fusarium solani, and Fusarium saccharum, are as follows: Fusarium verticillium specific amplification primer pair: product length is 292 bp, and the sequences are FV-F: TTGTCTATGCGCTGGCCTTT and FV-R: AGATAGAGCGCCTCGTCGTA; Fusarium spp. specific amplification primer pair: product length is 592 bp, and the sequences are FP-F: ATCATCAACGGTCTCGCTGG and FP-R: ACTCCTTTTCACTGTTCGCGG; Sugarcane Fusarium spp. specific amplification primer pair: the product length is 723 bp, and the sequences are FS-F: TCTCGCCACTACTCGTTC and FS-R: TCACCCTCCATACCCTCT.

2. The method for rapid detection of three pathogens of sugarcane tip rot according to claim 1, characterized in that: In S2, the upstream primer and the downstream primer are used at a concentration of 8 to 12 μM.

3. The method for rapid detection of three pathogens of sugarcane tip rot according to claim 1, characterized in that: In S5, the indicators of the samples to be tested are: The target band of 292 bp can be amplified using the genomic DNA of Fusarium verticillium, a fungus causing sugarcane tip rot, as a template. The target band of 592 bp was amplified using the genomic DNA of Fusarium solani, a fungus causing sugarcane tip rot, as a template. The target band of 723 bp can be amplified using the genomic DNA of Fusarium saccharum as template; The negative control and blank control showed no bands.

Images